Print
Species identification of European forest pathogens of the genus Milesina (Pucciniales) using urediniospore morphology and molecular barcoding including M. woodwardiana sp. nov.
expand article infoBen Bubner§, Ramona Buchheit§, Frank Friedrich|, Volker Kummer, Markus Scholler§
‡ Thünen Institute of Forest Genetics, Waldsieversdorf, Germany
§ State Museum of Natural History Karlsruhe, Karlsruhe, Germany
| Competence Center for Material Moisture, Eggenstein-Leopoldshafen, Germany
¶ University of Potsdam, Potsdam, Germany
Open Access

Abstract

Species of rust fungi of the genus Milesina (Pucciniastraceae, Pucciniales) are distributed mainly in northern temperate regions. They host-alternate between needles of fir (Abies spp.) and fronds of ferns (species of Polypodiales). Milesina species are distinguished based on host taxonomy and urediniospore morphology. In this study, 12 species of Milesina from Europe were revised. Specimens were examined by light and scanning electron microscopy for urediniospore morphology with a focus on visualising germ pores (number, size and position) and echinulation. In addition, barcode loci (ITS, nad6, 28S) were used for species delimitation and for molecular phylogenetic analyses. Barcodes of 72 Milesina specimens were provided, including 11 of the 12 species.

Whereas urediniospore morphology features were sufficient to distinguish all 12 Milesina species except for 2 (M. blechni and M. kriegeriana), ITS sequences separated only 4 of 11 species. Sequencing with 28S and nad6 did not improve species resolution. Phylogenetic analysis, however, revealed four phylogenetic groups within Milesina that also correlate with specific urediniospore characters (germ pore number and position and echinulation). These groups are proposed as new sections within Milesina (sections Milesina, Vogesiacae M. Scholler & Bubner, sect. nov., Scolopendriorum M. Scholler & Bubner, sect. nov. and Carpaticae M. Scholler & Bubner, sect. nov.). In addition, Milesina woodwardiana Buchheit & M. Scholler, sp. nov. on Woodwardia radicans, a member of the type section Milesina, is newly described. An identification key for European Milesina species, based on urediniospore features, is provided.

Keywords

Abies alba, Polypodiales, GBOL, germ pores, host alternation, Uredinopsis, Europe

Introduction

Several genera of rust fungi (Pucciniales) in Europe alternate their hosts between Abies spp. (aecial host with spore states 0 and I) and ferns of the order Polypodiales (telial host with spore states II, III and IV or III and IV). These are species of the genera Calyptospora J.G. Kühn (Thekopsora Magnus p.p.), Hyalopsora Magnus, Milesina Magnus (= Milesia F.B. White; see Aime et al. 2018b) and possibly Uredinopsis Magnus (Gäumann 1959; Klenke and Scholler 2015). All are assigned to the Pucciniastraceae.

The genus Milesina Magnus was monographed by Faull (1932). Today, 36 species are known worldwide (Kirk et al. 2001) and 11 species in Europe (Gäumann 1959; Klenke and Scholler 2015). Most species occur in parts of the northern hemisphere with temperate climates and Abies populations (Faull 1932). A few species are also found in the southern hemisphere outside the natural area of Abies species (Liu 1971), for example, South and Central America, South Africa and New Zealand (Berndt 2008). According to Sinclair and Lyon (2005), species of the genus Milesina and Uredinopsis (both called fir-fern rust) may cause needle browning and/or defoliation and occasionally cause economic damage in Christmas tree plantations in Canada. Aeciospores from needles infect ferns. Symptoms on fern fronds are pale green to yellow spots, which later become necrotic and are typically confined by veins (Sinclair and Lyon 2005).

Fern rust species on the telial hosts are characterised and distinguished mainly by host taxonomy (telial host genus), size, shape and ornamentation of urediniospores (e.g. Moss 1926, Faull 1932, Berndt 2008) and the results of inoculation experiments (Hunter 1935, 1936, Kamei 1940, Klebahn 1916; Mayor 1944). In contrast to urediniospores, teliospores are either not formed regularly or at all and teliospore features are obscure. So far, it is not possible to morphologically distinguish species on their aecial hosts Abies spp. (spore and sori features). Urediniospore features alone were also hardly sufficient to distinguish species (e.g. Faull 1932, Gäumann 1959, Majewski 1977). Thus, fern host identification is often the only criterion to link records to a certain species. This is problematic because some fern species may be infected by two (or possibly even more) Milesina spp. (e.g. Dryopteris spp. and Polystichum spp. in Europe; Gäumann 1959, Klenke and Scholler 2015).

In the present study, the urediniospore morphology of European Milesina species was investigated by light and scanning electron microscopical techniques. The morphological approach is supplemented by a molecular phylogenetic approach based on the ITS (Internal Transcribed Spacer) region of the rDNA, which has been shown to be the best marker for barcode species within fungi (Schoch et al. 2012). As secondary barcodes, nad6 (subunit 6 of NADH dehydrogenase) and 28S rDNA have been used. The molecular data were generated within the German Barcode of Life Project GBOL (Geiger et al. 2016). The present study has three objectives, to:

i) provide a detailed morphological description of urediniospores of all European Milesina spp., including the development of a method to visualise their germ pores. Germ pores are known to be a valuable taxonomic feature, for example, in grass rust fungi (Cummins 1971). So far, germ pores have not been visualised in the major studies on Milesina spp. (Berndt 2008; Faull 1932).

ii) provide molecular barcodes (ITS, nad6, 28S) for Central European species of Milesina spp. within the German Barcode of Life project (Geiger et al. 2016).

iii) assess the assignment of morphological species by comparison with the molecular data.

Methods

Herbaria

Dried herbarium specimens from the following public herbaria were used: B, FH, G, GLM, GZU, HBG, KR, M, PUR, S and W (acronyms according to Index Herbariorum, Holmgren et al. 1990).

Light microscopy (LM)

Urediniospores and cross sections of sori (uredinia) from dried Milesina specimens were mounted in a mixture of lactic acid and glycerol (Kirk et al. 2001) and examined with a light microscope (Zeiss Axioskop 2 plus) at a magnification of 400× or 1000×. If a sufficient amount of spore material were available, 30 spores per specimen were arbitrarily selected and measured. The number of examined specimens was between two (M. magnusiana) and 23 (M. kriegeriana). The number of spores examined depended on sample size and varied for each measurement and also between specimens. The length and width of 30 spores (2–4 specimens per species) and sori (only specimens with Woodwardia host), the length of 15 spines, the cell wall thickness of 10 spores and the distance between 20 spines were measured for each specimen (2–16 specimens per species). For spine base diameters, see next chapter.

Germ pore number and their position in the wall of urediniospores were evaluated by an adapted technique originally developed for the genus Tranzschelia (Scholler et al. 2014). Spores were mounted in Hoyer’s medium (Cunningham 1972) on a slide, then cover slips were pressed until the spores were disrupted and released the plasma. Then the slides were placed on a drier at 40 °C. After two to five days, the numbers of germ pores were counted in phase contrast illumination at 400× magnification for 120 spores of each species. Only the specimens with the best observable germ pores were used for the analysis. In addition, the diameter of pores was measured at 400× magnification.

Specimens were photographed with a Jenoptik ProgRes CT3 digital camera attached to a Zeiss Axioskop 2 plus light microscope (Oberkochen), using differential interference contrast (DIC) and phase contrast as illumination techniques. Images were captured with PROGRES CAPTUREPRO version 2.10.0.1 software. The pictures of the uredinia of Milesina sp. were taken with a ProgRes CT3 digital camera (Jena) attached to a Zeiss Stemi 508 (Zeiss, Oberkochen). All values determined in this study were rounded to one decimal place and outliers were not included in the species description.

Scanning Electron Microscopy (SEM)

Uredinia and urediniospores of dried specimens of Milesina spp. were placed on a holder with conductive double-sided tape (Leit-Tabs, Plano GmbH). Scanning electron microscope images were obtained on a Philips XL 30 FEG environmental scanning electron microscope operated at acceleration voltages of 12 kV at a chamber pressure of 133 Pa (1 Torr). In order to achieve a better contrast and less charge effects, the samples were coated first with a mixture of gold (80%) and palladium (20%) (MED 020, BAL-TEC).

SEM studies were carried out to study surface structures which are not visible by light microscopy. Spine base diameters (30 per species) were also measured with SEM and the software IMAGEJ 1.5.

Statistical Analysis

The statistical analyses for germ pore numbers and boxplots were carried out with the programme R 3.4.3 (R Core Team 2017).

DNA extraction, PCR and sequencing

Samples were prepared from herbarium specimens by excising single rust pustules including the plant material. They were placed into micro tubes with 8–12 ceramic beads, 1.4 mm diameter (Bio-Budget technologies, Krefeld, Germany), frozen at -20 °C overnight and homogenised on a Bead Ruptor (biolabproducts, Bebensee, Germany) at a speed of 7.45 m/s for 25 s. After freezing the samples again for 10 min at -20 °C, homogenisation was repeated. DNA was extracted with the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Selected samples were homogenised with glass mini mortars and pestles (Roth, Karlsruhe, Germany) in 400 µl of the homogenisation buffer included in the extraction kit.

Molecular barcodes were generated for three loci: ITS (Internal Transcribed Spacer of the ribosomal DNA in the nucleus), 28S (coding for the large subunit of the ribosomal RNA gene located on the ribosomal DNA in the nucleus), nad6 (coding for subunit 6 of NADH dehydrogenase, mitochondrial DNA). Primer sequences are listed in Table 1.

PCR was performed with the Accuprime Taq Polymerase System (Life Technologies, Karlsruhe, Germany) using the supplied buffer II and the following final concentrations: 2 mM MgCl2, 0.2 mM of each dNTP and 500 nM of each primer. The PCR programme was as follows: 3 min denaturation at 94 °C, 40 amplification cycles (94 °C for 30 s, 50 °C for 30 s and 68 °C for 60 s) and 7 min strand completion at 68 °C. PCR products were visualised in 1.6% agarose gel. Deviations from the 50 °C annealing temperature are listed in Table 1.

After purification of the PCR product with QIAquick-PCR Purification Kit (Qiagen, Hilden, Germany), it was sent to GATC Biotech AG (Konstanz, Germany) for sequencing. Sequencing was performed with the same primers used for the PCR. Forward and reverse sequences were edited and assembled with the software package GENEIOUS 10.0 (Biomatters, Auckland, New Zealand).

Primers and PCR conditions.

Locus Primer Sequence Reference Annealing temperature Cycle number
ITS amplicon 1 ITS1F CTTGGTCATTTAGAGGAAGTAA (Gardes and Bruns 1993) 60–50 °C 10 cycles with -1 °C per cycle (60–50 °C), then 30 cycles (50 °C)
ITS4rust CAGATTACAAATTTGGGCT (Beenken et al. 2012)
amplicon 2* ITS5u CAAGGTTTCTGTAGGTG (Pfunder et al. 2001) 60–50 °C 10 cycles with -1 °C per cycle (60–50 °C), then 30 cycles (60 °C)
ITS4 TCCTCCGCTTATTGATATGC (O´Donnell 1993)
28S amplicon 1 ITS4BRF GGACCATGTACAAGTCTGTTGA (Vialle et al. 2009) 50 °C 40
LR5 ATCCTGAGGGAAACTTC (Vilgalys and Hester 2009)
nad6 amplicon 1 Nad6PucciF1 TTCGATAATAAGTAGCCTAATAGTG (Vialle et al. 2013) 47 °C 40
Nad6PucciR1 AAATACAATAGGGCCAATCAT (Vialle et al. 2013)

Phylogenetic analysis

Several comparison sequences were selected in order to compare the branch length between Milesina species with branch lengths between related genera. Criteria of selection were availability within the GBOL project and membership in the Pucciniales suborder Melampsorineae sensu Aime (2006) and Aime et al. (2018b). The genera included Puccinia (GenBank) Pucciniastrum, Uredinopsis, Cronartium (GenBank) and Melampsoridium as outgroup. GenBank accessions of Cronartium ribicola ITS sequences are DQ445908 (Hietala et al. 2008), GU727730 (Mulvey and Hansen 2011) and KX574673 (Vogler et al. 2017). GenBank accessions for Puccinia graminis are AY874141, AY874143 and AY874146 (Abbasi et al. 2005).

Sequences were aligned with the ClustalW algorithm implemented in the programme BioEdit, version 7.1.3.0 (Hall 1999) using the standard parameters offered by the programme. Alignments were used for phylogenetic reconstruction by three different methods:

i) Neighbour-Joining (NJ) analysis was performed with the programme PAUP* 4.0b10 (Sinauer, Sunderland, MA, USA) using the Kimura-2-parameter substitution model. Node support values for NJ were calculated from 1000 bootstrap replicates.

ii) Maximum-Likelihood (ML) analysis: The original NEXUS alignment was reformatted to the extended PHYLIP format using the programme Mesquite 2.75 (http://mesquiteproject.org/mesquite/mesquite.html). The PHYLIP alignment was analysed under the ML criterion on the web-based RAxML black box (Stamatakis et al. 2008 https://www.genome.jp/tools/raxml/. Both formats were accessed on 01.09.2018). The used substitution model was GTR without GAMMA correction for amongst-site heterogeneity. Node support values were calculated from 100 bootstrap replicates.

c) Bayesian Inference (BI) analysis: The DNA-Substitution model GTR+I+G was used for performing Bayesian analysis with the programme MrBayes 3.2 (Ronquist et al. 2012). Two independent MCMC runs were performed, each with four chains over 1 000 000 generations. Every 100th tree was sampled. Initial burn-in was 25% and summarisations were calculated after the standard deviation of split frequencies reached below 0.01. The resulting tree file contained posterior probability values for node support.

Tree files resulting from the three methods were visualised using the programme TreeGraph 2 (Stöver and Müller 2010). Alignments are provided as NEXUS files in the Online Supplemental Material (Suppl. materials 13).

Results

Barcoding success for ITS, nad6 and 28S

ITS sequences were generated for 72 specimens of 11 Milesina species (Table 2). These include 10 of 11 Milesina species known to be present in Europe. Only for M. magnusiana no material was available. In addition, we sequenced an unknown Milesina species from the Canary Islands which politically belongs to Europe but geographically may belong to Africa. All specimens are from the fungus collection of the State Museum of Natural History Museum Karlsruhe, Germany (Acronym KR) as listed in the Methods section. An additional 43 specimens (data not shown) yielded no sequences. Thus, the success rate for sequencing was 63%. Amongst the unsuccessful specimens, 17 were collected before 2010 and 12 failed specimens were collected in 2017. The oldest successfully sequenced specimens were from 1999 (M. murariae, KR-M-0025191; M. scolopendrii KR-M-0025400). No attempts have been made to sequence M. magnusiana because only two old species from 1933 and 1964 (M-0290299, M-0205474) were available. Nine ITS sequences were generated for the genera Chrysomyxa, Melampsoridium and Uredinopsis (Table 3).

Milesina specimens: herbarium, lab and GenBank accession numbers.

Species Host plant species Voucher (all herbarium KR) Lab no. ITS 28S nad6
M. blechni Struthiopteris spicant KR-M-0038517 B1426 MH908410
Struthiopteris spicant KR-M-0038523 B1427 MH908411
Struthiopteris spicant KR-M-0038519 B1428 MH908412 MK302189
Struthiopteris spicant KR-M-0038516 B1442 MH908421 MK302193
Struthiopteris spicant KR-M-0049039 B1893 MH908463
M. carpatica Dryopteris filix-mas KR-M-0048589 B1662 MH908451
Dryopteris filix-mas KR-M-0043192 B1780 MH908454
M. exigua Polystichum braunii KR-M-0050247 B2206 MH908478 MK302211 MK302182
M. feurichii Asplenium septentrionale KR-M-0043159 B1964 MH908476
M. kriegeriana Dryopteris carthusiana KR-M-0043170 B1435 MH908417
Dryopteris dilatata KR-M-0043182 B1438 MH908418
Dryopteris dilatata KR-M-0043165 B1440 MH908419 MK302191
Dryopteris dilatata KR-M-0039321 B1441 MH908420 MK302192
Dryopteris carthusiana KR-M-0048087 B1469 MH908441 MK302203
Dryopteris carthusiana KR-M-0048085 B1470 MH908442 MK302204 MK302166
Dryopteris carthusiana KR-M-0048086 B1471 MH908443 MK302205
Dryopteris dilatata KR-M-0043162 B1472 MH908444
Dryopteris dilatata KR-M-0048088 B1473 MH908445
Dryopteris dilatata KR-M-0043151 B1474 MH908446
Dryopteris dilatata KR-M-0043184 B1475 MH908447
Dryopteris filix-mas KR-M-0043178 B1476 MH908448
Dryopteris dilatata KR-M-0048357 B1494 MH908449
Dryopteris dilatata KR-M-0048477 B1602 MH908450 MK302206
Dryopteris dilatata KR-M-0048480 B1685 MH908452 MK302207
M. murariae Asplenium ruta-muraria KR-M-0048133 B1443 MH908422 MK302194
Asplenium ruta-muraria KR-M-0048134 B1444 MH908423 MK302195
Asplenium ruta-muraria KR-M-0048132 B1445 MH908424 MK302196
Asplenium ruta-muraria KR-M-0035461 B1446 MH908425 MK302197 MK302150
Asplenium ruta-muraria KR-M-0036224 B1447 MH908426 MK302151
Asplenium ruta-muraria KR-M-0036225 B1448 MH908427 MK302152
Asplenium ruta-muraria KR-M-0025768 B1449 MH908428 MK302153
Asplenium ruta-muraria KR-M-0025185 B1450 MH908429 MK302154
Asplenium ruta-muraria KR-M-0025184 B1451 MH908430 MK302155
Asplenium ruta-muraria KR-M-0025191 B1452 MH908431 MK302156
Asplenium ruta-muraria KR-M-0043149 B1852 MH908459 MK302168
Asplenium ruta-muraria KR-M-0043154 B1853 MH908460 MK302169
M. polypodii Polypodium vulgare KR-M-0043177 B1429 MH908413
Polypodium interjectum KR-M-0043189 B1431 MH908414
Polypodium vulgare KR-M-0043190 B1432 MH908415 MK302190
Polypodium vulgare KR-M-0043161 B1433 MH908416
Polypodium vulgare KR-M-0043152 B1466 MH908439 MK302164
Polypodium vulgare KR-M-0048818 B1846 MH908455
Polypodium vulgare KR-M-0043157 B1847 MH908456
Polypodium vulgare KR-M-0043146 B1848 MH908457
Polypodium vulgare KR-M-0043173 B1849 MH908458
Polypodium vulgare KR-M-0048694 B1778 MH908453 MK302167
M. scolopendrii Asplenium scolopendrium KR-M-0043186 B1455 MH908434 MK302198 MK302159
Asplenium scolopendrium KR-M-0043153 B1456 MH908435 MK302160
Asplenium scolopendrium KR-M-0025400 B1457 MH908436 MK302199 MK302161
Asplenium scolopendrium KR-M-0049066 B1896 MH908464 MK302170
Asplenium scolopendrium KR-M-0049049 B1897 MH908465 MK302171
Asplenium scolopendrium KR-M-0049050 B1898 MH908466 MK302208 MK302172
Asplenium scolopendrium KR-M-0049051 B1899 MH908467 MK302209 MK302173
M. sp. Abies alba KR-M-0043687 B1458 MH908437 MK302200 MK302162
Abies alba KR-M-0042052 B1459 MH908438 MK302201 MK302163
Abies alba KR-M-0018587 B1860 MH908461
Abies alba KR-M-0018624 B1861 MH908462
Abies alba KR-M-0049062 B1902 MH908468
Abies alba KR-M-0049038 B1903 MH908469
Abies alba KR-M-0049065 B1905 MH908470 MK302174
Abies alba KR-M-0049068 B1906 MH908471 MK302175
Abies alba KR-M-0049063 B1907 MH908472
Abies alba KR-M-0048773 B1911 MH908473
Abies alba KR-M-0050303 B2209 MH908480 MK302215 MK302184
M. vogesiaca Polystichum aculeatum KR-M-0003937 GBOL_1_f10 MH908490
Polystichum aculeatum KR-M-0043175 B1453 MH908432 MK302157
Polystichum aculeatum KR-M-0043160 B1454 MH908433 MK302158
Polystichum aculeatum KR-M-0043187 B1467 MH908440 MK302202 MK302165
M. whitei Polystichum aculeatum KR-M-0049177 B1965 MH908477
Polystichum aculeatum KR-M-0050248 B2207 MH908479 MK302212
M. woodwardiana sp. nov. Woodwardia radicans KR-M-0049033 B1912 MH908474 MK302176
Woodwardia radicans KR-M-0048787 B1914 MH908475

All 72 specimens with ITS sequences were sequenced for the loci nad6 and 28S. Twenty nine specimens yielded barcode sequences at the locus nad6 (sequencing success 40%), while 24 specimens were successfully sequenced at the locus 28S (sequencing success 33%, Table 2). Since no nad6 or 28S sequences could be generated for specimens of the genus Chrysomyxa, specimens of the genus Pucciniastrum were sequenced as replacements in nad6 and 28S phylograms (three sequences for nad6, one sequence for 28S, Table 3).

ITS barcodes specimens of Pucciniastraceae other than Milesina: herbarium, lab and accession numbers.

Species host plant species voucher (all herbarium KR) lab no. ITS 28S nad6
Chrysomyxa empetri Empetrum hermaphroditum KR-M-0040758 B1252 MH908481
Chrysomyxa pyrolata Pyrola minor KR-M-0048660 B1688 MH908484
Pyrola rotundifolia KR-M-0048741 B1689 MH908485
Melampsoridium betulinum Betula pendula KR-M-0035533 B1412 MH908482 MK302186
Betula pubescens KR-M-0048135 B1416 MH908483 MK302187
Betula pubescens KR-M-0048557 B1835 MH908487
Melampsoridium carpini Carpinus betulus KR-M-0048587 B1774 MH908486
Melampsoridium hiratsukanum Alnus incana KR-M-0049100 B2033 MK302178
Alnus glutinosa KR-M-0048149 B1420 MK302188
Pucciniastrum circaeae Circaea intermedia KR-M-0039060 B2038 MK302179
Pucciniastrum epilobii Epilobium ciliatum KR-M-0004576 B2039 MK302180
Epilobium palustre KR-M-0043058 B2040 MK302210 MK302181
Uredinopsis filicina Phegopteris connectilis KR-M-0050249 B2208 MH908488 MK302213 MK302183
Phegopteris connectilis KR-M-0012195 B2011 MK302177
Phegopteris connectilis KR-M-0050313 B2212 MH908489 MK302215 MK302185

Phylogenetic analysis of the ITS barcode

Phylogenetic analysis of the ITS barcode revealed four clades for clades within Milesina species. The nodes for the first, second and fourth clade have maximum support values of 100/1/100 for the three phylogenetic reconstruction methods ML, BI and NJ (Figure 1). In clade 1, the ITS sequences of the pairs M. whitei/kriegeriana and M. blechni/woodwardiana sp. nov. are almost identical within the pairs but differ between the pairs by one nucleotide (Figure 3). At position 381, the nucleotide T (M. whitei kriegeriana) is replaced by C (M. blechni/M. woodwardiana sp. nov.). Position 1 is the first nucleotide after the signature TCATTA for the 3´end of the 18S rDNA. This difference is also reflected in the ITS phylogram by a node with weak support of 67/0.69/54 (Figure 1).

Figure 1. 

ITS Phylogram of 11 Milesina species (excluding M. magnusiana). The phylogram is based on a 733-bp alignment. A Maximum Likelihood (ML) tree is shown with support values for ML, Bayesian Inference (BI) and Neighbour Joining (NJ), in the order ML/BI/NJ. Support values are presented when they are above 50 (ML, NJ) or 0.5 (BI). The host is indicated in brackets. Milesina specimens without species designation (host Abies alba) are not colour-coded. For comparison, several sequences were included from closely related genera. They were all newly generated within the GBOL project, except the GenBank sequences for Cronartium spp. The drawings on the right side present the typical arrangement of spines and germ pores (grey dots) on the Milesina urediniospores.

In clade 2, M. scolopendrii, M. polypodii and M. murariae cannot be distinguished by ITS sequences. Apart from single nucleotides at unspecific positions, the ITS sequences are identical. The sequence of M. feurichii differs from the other three species by two nucleotides with specific positions (Figure 4). This difference, however, is not reflected by bootstrap or posterior probability support (Figure 1). Clade 3 with M. vogesiaca and M. exigua has only weak support in the BI and NJ analysis (0.73 and 63) while the bootstrap support was below 50 for the ML analysis (Figure 1). In a version of the ITS phylogram with Puccinia graminis as outgroup (Online Suppl. material 1: Figure S1), the support values for clade 3, including M. exigua are 100/1/100. The only member of the fourth clade is M. carpatica with two identical sequences. The ITS sequence is clearly different from all other Milesina species investigated. In summary, amongst the 11 Milesina species, only four species (M. feurichii, M. vogesiaca, M. exigua and M. carpatica) can be unambiguously assigned by their ITS sequences.

Amongst the specimens on the aecial host Abies alba, nine grouped into clade 1 and two into clade 2 (Figure 1). Following the distinction at position 381, six Abies-dwelling specimens of clade 1 belong to the pair M. whitei/kriegeriana and three to the pair M. blechni/woodwardiana sp. nov.

The ITS phylogeny (Figure 1) does not confirm monophyly of Milesina species. High support values are available only for a clade containing all Milesina species and Uredinopsis filicina (node support (100/1/99, Figure 1). This indicates that the genus Milesina may be paraphyletic. The specimens of the three genera Melampsoridium, Cronartium and Chrysomyxa form a clade with a node support of 81/-/0.9, indicating that probably none of them is a sister group of Milesina. When the branch lengths from the clade defining node to the next deeper node are compared, it its apparent that the branch lengths for the Milesina clades are as long or even longer when compared to the branch lengths between the different genera Melampsoridium, Cronartium and Chrysomyxa. This indicates a relatively large genetic distance between the clades within the genus Milesina.

Phylogenetic analysis of nad6 and 28S barcodes

Due to the low sequencing success of these two markers, only seven (nad6) and eight (28S) Milesina species could be included in the analysis. Although no sequences are available for clade 4 (M. carpatica), the general pattern of the clades is the same as for the ITS phylogeny. Clade 1 and clade 2 consist of the same species (Figure 2) as in the ITS analysis and cannot be distinguished. In addition and in contrast to the ITS data, the distinction between the species pairs M. whitei/kriegeriana and M. blechni/woodwardiana sp. nov. is not possible. In confirmation of the ITS data, the support for a clade that contains all Milesina species and Uredinopsis filicina is high (99/1/100 for nad6, 96/0.96/64 for 28S, Figure 2). This again indicates that the genus Milesina is not monophyletic. The branch lengths from the clade defining node to the next deeper node are shorter between the Milesina clades as compared to the branch length between related species. This is in contrast to ITS data.

Figure 2. 

Phylograms of supplementary barcodes. The nad6 phylogram is based on a 550 bp alignment, the 28S phylogram on a 680 bp alignment. The technical description is the same as for Figure 1. All Milesina specimens from Figure 1 were attempted to sequence for the supplementary barcodes. Only the shown specimens resulted in sequences. The non-Milesina species were altered depending on availability. No GenBank sequences were included and the genus Chrysomyxa was replaced by Pucciniastrum.

Figure 3. 

Deviations from the consensus ITS sequence of section Milesina. The first line indicates the nucleotide positions in base pairs, the second line the consensus sequence. The order of specimens is as shown in Figure 1. “Milesina sp” denotes specimens from Abies alba. Deviations for single specimens can be found at 5 positions. All specimens of M. blechni and M. woodwardiana deviate at position 381 from M. whitei and kriegeriana.

The ambiguity in ITS data to determine a clade 3, consisting of both M. vogesiaca and M. exigua, is also found in the nad6 and 28S data. In the nad6 phylogram, M. exigua has an unsupported position next to Uredinopsis filicina. In the 28S phylogram, M. exigua is only in the same clade with M. vogesiaca if Uredinopsis filicina is included. Even then, the support values of 70/0.8/52 are relatively low.

Morphology of urediniospores

Germ pores

The number and position of the germ pores of all species were visualised. Germ pores provided three important features, namely (i) the number, (ii) the position and, finally, (iii) the size of pores. The four species with the highest number of germ pores per spore all belong to the section Milesina (Figure 5). All other species had similar germ pore numbers.

Figure 4. 

Deviations from the consensus ITS sequence of section Scolopendriorum. Description as for Figure 3. Milesina feurichii deviates from the other three species in positions 288 (A) and 521 (G).

Figure 5. 

Boxplot of germ pore numbers of urediniospores of 12 Milesina spp. and four sections. For each species 120 spores from two (M. magnusiana), three (M. feurichii) or four (all other species) specimens were evaluated. Median, whisker, quantile and outliers (dots) are shown.

Specimens examined, urediniospore descriptions and taxonomic novelties

Comparative data of the main morphological spore characters are listed in Table 4.

Comparative overview of morphological features of urediniospores and host range in Milesina.

Species Host plant genus (family) Frequent spine length [µm] Smooth spine-free areas Frequent wall thickness [µm] Frequent germ pore number Ø germ pore diam. [µm] Germ pore distri-bution Frequent spore size [µm] Other
Milesina blechni Struthiopteris spicant (Blechnaceae) 1.5–2.0 no 0.8–1.0 10–11 2.4 scattered 30.0–37.5 × 15.0–19.0 distance between spines mostly 1.5–4.0 µm, spines typically perpendicular to the wall
Milesina carpatica Dryopteris filix-mas (Dryopteridaceae) 1.0–1.8 no 0.5–1.2 5–7 2.2 scattered 20.0–30.0 × 12.5–19.0 distance between spines mostly 0.5–3.0 µm, spines typically erect
Milesina exigua Polystichum aculeatum, P. braunii, (Dryopteridaceae) no spines no spines 0.5–0.8 4–6 2.7 bizonate 22.5–30.0 × 12.5–17.5 Germ pores concentrated apically or nearly bizonate
Milesina feurichii Asplenium septentrionale (Aspleniaceae) ±2.0 yes 0.5–1.0 6–7 2.4 scattered 30.0–37.5 × 20.0–22.5 distance between spines mostly 1.0–5.0 µm, spines typically erect
Milesina kriegeriana Dryopteris borreri, D. carthusiana, D. dilatata, D. filix-mas (Dryopteridaceae) ±2.0 no 0.8–1.0 10–11 2.3 scattered 27.5–37.5 × 15.0–20.0 distance between spines mostly 1.0–4.0 µm, spines typically erect
Milesina magnusiana Asplenium adiantum-nigrum (Aspleniaceae) ±2.0–2.2 yes 1.0–1.5 5–6 2.9 scattered 30.0–35.0 × 17.5–20.0 distance between spines mostly 3.0–5.5 µm
Milesina murariae Asplenium ruta-muraria (Aspleniaceae) ±2.0 yes 2.0 5–6 2.4 scattered 27.5–35.0 × 17.5–22.5 distance between spines 2.0–3.5 µm, spines typically erect, curved near base
Milesina polypodii Polypodium interjectum, P. × mantoniae, P. vulgare (Polypodiaceae) ±2.0 yes 0.5–1.0 5–6 2.3 scattered 30.0–40.0 × 17.5–22.5 distance between spines 1.0–4.0 µm, spines typically erect
Milesina scolopendrii Asplenium scolopendrium (Aspleniaceae) ±2.0 yes 0.5–1.2 6–7 2.4 scattered 27.5-42.5 × 17.5-22.5 distance between spines 2.0-5.0 µm, spines typically erect
Milesina vogesiaca Polystichum aculeatum, P. lonchites (Dryopteridaceae) no spines no spines 0.5-0.8 5-6 2.8 ± bizonate 30.0-40.0 × 17.5-20.0 spores with very inconspicuous flat verrucae (visibly with SEM only)
Milesina whitei Polystichum aculeatum, P. setiferum (Dryopteridaceae) 1.8-2.5 no 0.8-1.0 9-13 2.3 scattered 27.5-37.5 × 17.5-22.5 distance between spines mostly around 2.0 µm, spines typically perpendicular to the wall
Milesina woodwardiana sp. nov. Woodwardia radicans (Blechnaceae) ±3.0 no 0.5-1.0 10-14 2.4 scattered 30.0-37.5 × 17.5-22.5 distance between spines mostly 2.0-4.0 µm, spines irregularly directed

Milesina blechni (Syd. & P. Syd.) Syd. & P. Syd., Annales Mycologici 8(5): 491 (1910)

Figure 6a, b

Struthiopteris spicant (L.) Weiss (Blechnum spicant (L.) Sm.), Czech Republic, Mähren: Hochgesenke, Großer Kessel (Velká kotlina), 19 Mar 1923, F. Petrak, II (W, 1970-25718); Hochgesenke, Großer Kessel (Velká kotlina), 3 Sep 1923, F. Petrak, II (W, 1992-14461); Denmark: 26 Nov 1926, J. Lind, II (W, 1975-19656); 26 Nov 1926, J. Lind, II (W, 1931-7888); France, Alsace: Frankental, Hohneck, 16 Jul 1910, H. Sydow, II (Sydow, Mycoth. Germ. 877; W, 1910-6976, 1973-30378; S, F310830); Germany, Bayern: Aschau, 25 Aug 1934, E. Eichhorn & H. Poeverlein, II (W, 1975-15534); Dreisessel, 12 Oct 1940, E. Eichhorn, II (Sydow, Mycoth. germ. 3449; W, 1942-2122m 1972-17207); Baden-Württemberg, Schwarzwald, St. Georgen, Aug 1913, P. Sydow (Sydow, Uredineen 2739; GLM, GLM-53029; W, 1916-4273; S, F310826); Schwarzwald, path between Bad Wildbad and Kaltenbronn, 13 Aug 1910, P. Sydow, II (S, F310827); Freudenstadt, Baiersbronn, NSG “Wilder See- Hornisgrinde”, coniferous wood, 1 Mar 2014, M. Scholler, II (KR, KR-M-0038516); Schwarzwald, Ortenau, Durbach, Tiefenspring, Großer Langenbach, 15 Sep 2017, R. Buchheit (KR, KR-M-0049039); Schwarzwald, Ortenau, Seebach, coniferous forest, 1 Mar 2014, M. Scholler (KR, KR-M-0038517); Schwarzwald, Rastatt, Forbach, Herrenwieser See, wayside, 15 May 2014, M. Scholler (KR, KR-M-0038519); Schwarzwald, Rastatt, Forbach, Herrenwies, spruce-fir forest, 15 May 2014, M. Scholler, II (KR, KR-M-0038523); Hamburg: Harburg, Klecker Wald, 12 May 1915, O. Jaap (Jaap, Fungi sel. exs. 774; W, 1916-4246); Niedersachsen: Harz, Rehberger Graben, between Oderteich and St. Andreasberg, 24 Aug 1904, P. Sydow, II (Sydow, Mycoth. Germ. 311; S, F310828; W, 1905-4478); Sachsen: Schmilka, Großer Winterberg, 28 Aug 1903, H. and P. Sydow, II (Sydow, Uredineen 1841; B, B 700016503; S, F29283, F310855; W, 1904-006026, type); Schmilka, 28 Aug 1903, H. & P. Sydow, II (H. & P. Sydow, Mycoth. Germ. 61; W, 1903-0013406; S, F29284, type); Schmilka, Großer Winterberg, 28 Aug 1903, P. Sydow, II (S, F29285, type); Thüringen, Stützerbach near Ilmenau, 20 Jul 1911, O. Jaap, II (W, 1911-7479); Eichsfeld, Fretterode Schierbachtal, spruce forest, 14 Nov 2013, H. Thiel, II (KR, KR-M-0043148); Nordrhein-Westfalen, Lennestadt, Forsthaus Einsiedelei, forest, 5 Sep 1919, A. Ludwig, II (W, 1975-12517); Nordrhein-Westfalen: Lennestadt, Forsthaus Einsiedelei, forest, 31 Aug 1921, A. Ludwig, II (W, 1973-16286); Olpe, Forsthaus Einsiedelei, forest, 31 Aug 1921, A. Ludwig, II (W, 1926-23840); Olpe, Silberg, 12 Aug 1931, A. Ludwig, II (W, 1973-17007); Olpe, Silberg, 6 Sep 1940, A. Ludwig, II (W, 1975-20448); Poland, Riesengebirge (Karkonosze): Karpacz (formerly Krummhübel), 29 Aug 1908, H. Sydow, II (S, F310856); Karpacz (formerly Krummhübel), Hoserweg, 29 Aug 1908, H. Sydow, II (S, F310829); Romania: Brasov, mountain chain Fagaras, Valea Sâmbetei, northern Cabana Valea Sâmbetei, Piceetum, 17 Aug 1983, G. Negrean, II (W, 1997-00694); Switzerland, Berner Oberland: Längenbalm, Hasleberg, 3 Sep 1906, E. Fischer, II (B, B 700016504, W, 1907-17136); Bern, Wälde, northern side of the Schwendelberg, next to Guggisberg, 27 Aug 1923, E. Fischer, II (W, 1971-30213).

Description

Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–42.5 × 15.0–20.0 µm, mostly 30.0–37.5 × 15.0–19.0 µm; wall 0.5–1.5 µm, mostly 0.8–1.0 µm thick; echinulate without spine-free areas, spines 1.2–2.2 µm, mostly 1.5–2.0 µm long, irregularly distributed, sometimes also in rows, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–5.0 µm, mostly 1.5–4.0 µm, spine base 0.7–1.3 µm, mostly 0.9–1.1 µm diam.; germ pores scattered, 6–13, mostly 10–11, 2.0–3.0 µm diam., Ø 2.4 µm diam.

Comment

Urediniospore features are very similar to those of M. kriegeriana. Average urediniospore length measurements are somewhat higher (30.0–37.5 vs. 27.5–35.0 in M. kriegeriana).

Figure 6. 

Urediniospores of 11 Milesina species. a Milesina blechni on Struthiopteris spicant (KR-M-0049039, SEM) b Milesina blechni on Struthiopteris spicant, cracked spore with released plasma, germ pores scattered (KR-M-0038523, LM phase contrast) c Milesina carpatica on Dryopteris filix-mas (KR-M-0043192, SEM) d Milesina exigua on Polystichum braunii, smooth surface (M, M-020547, SEM) e Milesina exigua on Polystichum braunii, smooth surface, plasma-free spore, germ pores bipolar (M, M-0205472, LM, phase contrast) f Milesina feurichii on Asplenium septentrionale with smooth areas on surface (KR-M-0043159, SEM) g Milesina feurichii on Asplenium septentrionale, cracked plasma-free spore, germ pores scattered (KR-M-0043159, LM, phase contrast) h Milesina kriegeriana on Dryopteris carthusiana (KR-M-0048085, SEM) i Milesina magnusiana on Asplenium adiantum-nigrum with smooth areas on surface (M, M-0205474, SEM) j Milesina magnusiana on Asplenium adiantum-nigrum, spore plasma-free, germ pores scattered (M, M-0205474, LM, phase contrast) k Milesina murariae on Asplenium ruta-muraria with smooth areas on surface (KR-M-0035461, SEM) l Milesina murariae on Asplenium ruta-muraria, cracked spore with released plasma, germ pores scattered (KR-M-0043154, LM, phase contrast) m Milesina polypodii on Polypodium vulgare with smooth areas on surface (KR-M-0043173, SEM) n Milesina scolopendrii on Asplenium scolopendrium with smooth areas on surface (KR-M-0049049, SEM) o Milesina vogesiaca on Polystichum aculeatum, surface with very flat warts at the tip of the spore (arrow) (KR-M-0043160, SEM) p Milesina vogesiaca on Polystichum aculeatum, surface smooth (no warts visible at the tip), germ pores bipolar (KR-M-0043175, LM, phase contrast) q Milesina whitei on Polystichum sp. (KR-M-0039378, SEM) r Milesina whitei on Polystichum setiferum, cracked spore with released plasma, germ pores scattered (KR-M-0049177, LM, phase contrast).

Milesina carpatica Wróbl., Sprawozdanie Komisji Fizjograficznej 47(II): 166 (1913)

Figure 6c

Dryopteris filix-mas (L.) Schott. Austria Steiermark: Graz, basilica Maria Trost, Rettenbachklamm, 11 Jun 1991, J. Poelt, II (GZU, GZU 000335631, GZU 000335632,); Koralpe, Wildbachgraben, ravine forest, 25 Apr 1988, J. Poelt, (M, M-0205477, M-0205478); Koralpe, Wildbachgraben, WNW Wildbach, NW Deutschlandberg, ravine forest, 25 Apr 1988, J. Poelt, II (GZU, GZU 000335634, GZU 000335635); Sausal-Gebirge, rift between Mitteregg and Voregg respectively Annaberg, 12 Apr 1981, J. Poelt, II (GZU, GZU 000335633); Germany, Bayern: Oberbayern, Murnau, Staffelsee, mixed forest, 15 Sep 2017, M. Scholler, II (KR, KR-M-0048589); Niedersachsen: Osterode, Bad Lauterberg, Barbis, forest, scarp, 30 Mar 2014, H. Thiel, II, III (KR, KR-M-0043192); Ukraine, Kolomyja: Knyazhdvir (formerly Galicia, Kniazdwor-Bania, Kolomea), Aug 1913, A. Wróblewski, II (M, M-0290298, type).

Description

Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 16.5–32.5 × 10.0–20.0 µm, mostly 20.0–30.0 × 12.5–19.0 µm; wall 0.5–1.8 µm, mostly 0.5–1.0 µm thick; soft (in microscopic mounts they often crack without pressure), very densely echinulate without spine-free areas, spines 1.0–2.0 µm, mostly 1.0–1.8 µm long, irregularly distributed, spines typically straight and perpendicular to the wall, distance between spine bases 0.5–4.0 µm, mostly 0.5–3.0 µm, spine base 0.4–0.7 µm, mostly 0.5–0.6 µm; germ pores scattered, 4–10, mostly 5–7, 1.3–2.5 µm, mostly 1.3–2.5 µm diam., Ø 2.2 µm diam.

Comment

Germ pores are more difficult to visualise and need more time to evaluate.

Milesina exigua Faull, Contributions from the Arnold Arboretum of Harvard University 12: 218‒219 (1931)

Figure 6d, e

Polystichum aculeatum (L.) Roth (P. lobatum L., Aspidium lobatum Sw.). Ukraine, Kolomyja: Knyazhdvir, Aug 1913, A. Wróblewski (as M. vogesiaca: Sydow, Uredineen 2742; GLM, GLM-53030; W, 1916-4289); Knyazhdvir, Sep 1913, A. Wróblewski (as M. vogesiaca: W, 1975-18645).

Polystichum braunii (Spenn.) Fée. Austria, Steiermark: Buchgraben NE Oberschöckl, canyon slope, 26 Apr 1983, J. Poelt, (GZU, GZU 000313869; M, M-0205472); Deutschlandsberg, Freiland, Wildbachklamm, south of the stream, scarp, 31 Jul 2018, M. Scholler & C. Scheuer (KR, KR-M-0050247); Höllgraben, ravine forest, 29 Sep 1988, J. Poelt & P. Zwetko (M, M-0205473). Koralpe, Mausegger-Graben next Sauerbrunn, NW Stainz, district Deutschlandsberg, ravine forest, silicate rock, 17 Apr 1995, J. Poelt (GZU, GZU 000313870); NW Stainz, Höllgraben WNW Marhof, ravine forest, 29 Sep 1988, J. Poelt & P. Zwetko (GZU, GZU 000313867).

Description

Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 22.5–32.5 × 12.5–17.5 µm, mostly 22.5–30.0 × 12.5–17.5 µm; wall 0.5–0.8 µm; spores smooth, germ pores low in number, probably around 4–6, 2.0–3.8 µm, mostly 2.0–3.0 µm diam., Ø 2.7 µm diam.; germ pores mostly apically, or both, basally and apically (bizonate).

Comment

Klenke and Scholler (2015: 649) list this species (as M. neoexigua Berndt) on Polystichum braunii for Germany (Baden-Württemberg), based on a specimen from the Black Forest, SW Germany (KR-M-0019138). P. braunii is a rare member of the southern Black Forest flora. We revised host and fungus and found that it is M. vogesiaca on P. aculeatum. Thus, the presence of M. exigua in Germany has not been confirmed. Germ pores are more difficult to visualise and need more time to evaluate.

Milesina feurichii (Magnus) Grove, Journal of Botany 59: 311 (1921)

Figure 6f, g

Asplenium septentrionale (L.) Hoffm. Germany, Hessen: Werra-Meißner, Eschwege, Albungen, rock, 13 Apr 2013, H. Thiel, II (KR, KR-M-0043159); Sachsen: Vogtland, NNW Jocketa, NSG Steinicht, 9 May 1999, H. Jage & F. Klenke, II (GLM, GLM-F103536); Switzerland, Ticino: Locarno, Sciarana, Cugnasco, vineyard, dry stone wall, 9 Dec 2017, L. Beenken (KR, KR-M-0044955).

Description

Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 27.5–42.5 × 17.5–25.0 µm, mostly 30.0–37.5 × 20.0–22.5 µm; wall 0.5–1.8 µm, mostly 0.5–1.0 µm thick; spores densely echinulate with 1–2, mostly 1 round to ovoidal smooth area, typically located centrally, smooth area 7.5–17.5 × 6.5–10.0 µm, mostly 10.0–15.0 × 7.5–10.0 µm, spines 1.5–2.5 µm, mostly 1.8-2.2 µm long, irregularly distributed, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–9.0 µm, mostly 1.0–5.0 µm, spine base mostly around 1 µm; germ pores scattered, 5–11, mostly 6–7, 1.3–3.0 µm, mostly 2.0–2.5 µm diam., Ø 2.4 µm diam.

Milesina kriegeriana (Magnus) Magnus, Bulletin de l’Institute et de jardin botanique de L’Université de Beograd 27: 325 (1909)

Figure 6h

Dryopteris borreri (Newman) Oberholzer & Tavel. Germany, Thüringen: Eichsfeld, Hundeshagen, forest stream canyon, 20 May 2014, H. Thiel (KR, KR-M-0043164).

D. carthusiana (Vill.) H.P. Fuchs. (= Aspidium spinulosum Sw.). Germany, Sachsen: Bad Schandau, Schrammsteine, Sep 1893, Wegener, II (B, B 700016500); Sächsische Schweiz, 2 Nov 1901, W. Krieger, II (B, B 700016501); Uttewalder Grund, Oct and Nov 1901, W. Krieger (Krieger, Fungi Sax. Exs. 1711; HBG, 1/2338, 2/2338, 3/2338, type); Uttewalder Grund, Nov 1901, P. Magnus (B, B 700016499); Uttewalder Grund, Nov 1901, W. Krieger, II (B, B 700016498); Polenzthal (Polenztal), Königstein (Elbe), Sep 1901, W. Krieger, II (B, B 700016497); Sachsen-Anhalt: Burgenland, Wischroda, Braunsroda, 8 Okt 2013, H. Jage, II (KR, KR-M-0048086); Stendal, Gollensdorf, pine forest, 19 Oct 2014, H. Zimmermann (KR, KR-M-0048085); Wittenberg, Kemberg, Graditz, pine forest, 22 Feb 2014, H. Jage, II (KR, KR-M-0048087); Lüchow-Dannenberg, Dannenberg (Elbe), pine forest, 18 Mar 2014, H. Thiel (KR, KR-M-0043170).

D. dilatata (Hoffm.) A. Gray. Germany, Baden-Württemberg: Schwarzwald, Seebach, wayside, 4 Apr 2017, M. Scholler & M. Wieners (KR, KR-M-0048477); Ortenau, Seebach, NSG “Wilder See-Hornisgrinde”, spruce-fir forest, wayside, 4 Apr 2017, M. Scholler & M. Wieners (KR, KR-M-0048480); Hessen, Werra-Meißner, Lichtenau Hoher Meißner, broadleaved forest, 13 Mar 2014, H. Thiel (KR, KR-M-0043162); Mecklenburg-Vorpommern, Rügen, Putbus, Vilm, forest, 20 Aug 2014, H. Thiel (KR, KR-M-0039321); Rügen, Putbus, Vilm, 20 Aug 2014, S. Hoeflich, H. Jage, II (KR, KR-M-0048357); Niedersachsen, Göttingen, Landolfshausen, Potzwenden, douglas fir-spruce forest, 18 Jan 2014, H. Thiel (KR, KR-M-0043182); Lüchow-Dannenberg, Küsten, Sallahn, pine forest, 10 Nov 2013, H. Thiel (KR, KR-M-0043151); Northeim, Hardegsen, Ertinghausen Meinheitsberg, spruce forest, 21 Jun 2014, H. Thiel (KR, KR-M-0043165); Harz, Osterode, Herzberg, Lonau, spruce forest, 9 Aug 2012, H. Thiel (KR, KR-M-0043184); Sachsen-Anhalt, Wittenberg, Schköna, pine forest, 27 Feb 2014, H. Jage, II (KR, KR-M-0048088).

D. filix-mas (L.) Schott. Germany, Niedersachsen: Northeim, beech forest, 16 Jan 2014, H. Thiel (KR, KR-M-0043178); Sachsen (?): Bad Schandau?, 1895, G. Wagner, II (HBG, 4/2338).

Description

Urediniospores hyaline, ellipsoidal, obovoidal to oval, clavate, 25.0–47.5 × 12.5–25.0 µm, mostly 27.5–37.5 × 15.0–20.0 µm; wall 0.5–1.2 µm, mostly 0.8–1.0 µm thick; spores echinulate without spine-free areas, spines 1.2–3.0 µm, mostly 1.8–2.2 µm long, irregularly distributed, sometimes in rows, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–6.0 µm, mostly 1.0–4.0 µm, mostly around 1 µm; germ pores scattered, 6–14, mostly 10–11, 1.3–3.0 µm, mostly 2.0–2.5 µm, Ø 2.3 µm diam.

Comment

See annotation under M. blechni.

Milesina magnusiana Jaap, Verhandlungen des Botanischen Vereins für die Provinz Brandenburg 57: 16 (1915)

Figure 6i, j

Asplenium adiantum-nigrum L. France, La Corse: Ajaccio, 5 Mar 1933, O. Jaap, II (M, M-0290299, type); Ireland: Kerry, Dingle peninsula, drywall, 30 Aug 1964, Leuze & Doppelbaur (M, M-0205474).

Description

Urediniospores hyaline, ellipsoidal to obovoidal, 21.3–38.8 × 15.0–22.5 µm, mostly 30.0–35.0 × 17.5–20.0 µm; wall 1.0–2.0 µm, mostly 1.0–1.5 µm thick; spores echinulate with 1–2 ovoidal smooth areas, typically located centrally, smooth area 11.5–17.5 × 6,3–10.0 µm, mostly 15.0–17.5 × 7.5–10.0 µm, spines 1.2–2.8 µm, mostly 2.0–2.2 µm long, irregularly distributed, spines often erect, distance between spines 0.5–9.0 µm, mostly 3.0–5.5 µm; germ pores scattered, 4–9, mostly 5–6, 2.0–4.5 µm, mostly 2.5–3.0 µm diam., Ø 2.9 µm diam.

Milesina murariae (Magnus) Grove, Journal of Botany, London 59: 311 (1921)

Figure 6k, l

Asplenium ruta-muraria L. Austria, Tirol: Landeck, 22 Feb 1900, O. Jaap, II (HBG, 7/2338); Bad Ratzen, 23 Aug 1908, P. Magnus, II (HBG, 13/2338); Innsbruck, near Klausen, 21 Aug 1902, P. Magnus, II (HBG, 14/2338); Vorarlberg: Bludenz, 21 Aug 1909, P. Magnus, II (HBG, 8/2338); Salzburg: Zell am See, 1 Sep 1890, P. Magnus, II (HBG, 6/2338); France, Alsace: Forbach, Melponte, 12 Jul 1912, A. Ludwig, II (GLM, GLM-53031); Germany, Baden-Württemberg: Freiburg/Breisgau, St. Peter, wall of monastery, 22 Aug 1999, H. Jage (KR, KR-M-0025191); Bodensee, Konstanz, Stockach, “Am Stadtwall”, wall, 29 Aug 2000, H. Jage (KR, KR-M-0025185); Bodensee, Konstanz, Stockach, Oberstadt “Am Stadtwall”, wall, 27 Aug 2001, H. Jage (KR, KR-M-0025768); Tübingen, downtown, wall, 3 Jul 2008, H. Jage (KR, KR-M-0036224); Tübingen, Bebenhausen monastery, 2 Jul 2008, H. Jage (KR, KR-M-0036225); Sigmaringen, Beuron, monastery wall, 29 Jul 2000, H. Jage (KR, KR-M-0025184); Niedersachsen: Hildesheim, town wall, W women’s prison, 1 Mar 2013, H. Thiel (KR, KR-M-0043149); Osterode, Bad Grund, chalk rocks, 16 Jan 2014, H. Thiel (KR, KR-M-0043154); Sachsen: Erzgebirge, Zschopautal, Apr 1902, G. Wagner, (HBG, 5/2338); Sachsen-Anhalt: Spielberg, Burgenlandkreis, Benndorf, wall of churchyard, 2 Jun 2014, H. Jage (KR, KR-M-0048134); Wittenberg, Kemberg, city wall, 13 Jul 2014, H. Jage (KR, KR-M-0048133); Thüringen: Saale-Holzland, Dornburg/Saale, cemetery wall, 21 Oct 2012, H. Jage & G. Vogel (KR, KR-M-0035461); Weimarer Land, Apolda, wall, 9 Oct 2013, H. Jage & G. Vogel, (KR, KR-M-0048132); Sachsen: Wehlen, 12 May 1911, W. Krieger (HBG, 21/2338); Italy, Alto Adige: Voldertal, next to Kreuz Häusle, 8 Sep 1910, P. Magnus, II (HBG, 9/2338); Bolcano, vineyard wall, 4 Sep 1890, P. Magnus, II (HBG, 10/2338); Bolcano, Waidbruck between Tergolerbrücke and Kollmann, 15 Jul 1907, A. Heimerl (HBG, 12/2338); Bolcano, Seis am Schlern, 20 Aug 1908, P. Magnus, II (HBG, 16/2338); Seis am Schlern, 26 Aug 1908, P. Magnus, II (HBG, 18/2338); garden wall in Vahrn, 6 Jul 1905, A. Heimerl, II (HBG, 15/2338 Merano, 14 Sep 1890, P. Magnus, II (HBG, 11/2338); Intra, Lago Maggiore, 18 Sep 1892, P. Magnus, II (HBG, 19/2338); Trentino: St. Cristoforo, Val Lugano, 27 Aug 1910, P. Magnus, II (HBG, 17/2338); Switzerland, Bern: Twann, at Bielersee, 12 Mai 1909, E. Fischer, II (HBG, 20/2338).

Description

Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 25.0–42.5 × 15.0–22.5 µm, mostly 27.5–35.0 × 17.5–22.5 µm; wall 1.2–2.2 µm, mostly around 2.0 µm thick; spores echinulate with 1–2, mostly 2 ovoidal smooth areas, typically located centrally, smooth area 11.5–20.0 × 7.5–12.5 µm, mostly 12.5–15.0 × 7.5–10.0 µm, spines 1.5–2.5 µm, mostly 1.8–2.2 µm long, erect, spines curved toward base, denser toward both spore poles, distance between spine bases 0.5–7.0 µm, mostly 2.0–3.5 µm, spine base 0.7–1.4 µm, mostly around 1 µm; germ pores scattered, 3–9, mostly 5–6, 2.0–3.8 µm, mostly 2.0–2.5 µm diam., Ø 2.4 µm diam.

Milesina polypodii (F.B. White) Aime & Rossman, in Aime, Castlebury, Abbasi, Begerow, Berndt, Kirschner, Marvanova, Ono, Padamsee, Scholler, Thines & Rossman, IMA Fungus 9(1): 83 (2018)

Figure 6m

Polypodium interjectum Shivas. France, Alsace: Wasselnheim, Wangenberg, 23 Oct 1914, A. Ludwig, II (W, 1916-3467); way Fischboedle to Hohneck, 3 Jul 1910, H. Sydow, II (S, F310825); Potigny (Calvados), Bréche-au-Diable, 14 Apr 1911, R. Maire, II (W, 1912-3055; B, B 700016502); Germany, Nordrhein-Westfalen: Märkischer Kreis, Balve, Volkringhausen, moist forest, 16 Aug 2012, H. Thiel, II (KR, KR-M-0043189).

P. × mantoniae Rothm. & U. Schneid. (P. vulgare L. × P. interjectum Shivas). Germany, Niedersachsen: Northeim, SO Vorwerk Levershausen, Langfast Kopf, broadleaved forest, sandstone, 16 Jan 2014, H. Thiel, II (KR, KR-M-0043177).

P. vulgare L. Germany, Baden-Württemberg: Schwarzwald, Ortenau, Lautenbach, Lautenfelsen, 5 Jun 2017, M. Scholler & A. Rubner, II (KR, KR-M-0048694); Schwarzwald, Ortenau, Ottenhöfen, slope near creek, next to Abies alba, 13 Nov 2017, M. Scholler & R. Buchheit (KR, KR-M-0049181); Schwarzwald, Ortenau, Ottenhöfen, scarp near stream, coniferous forest next to Abies alba, 13 Nov 2017, M. Scholler & R. Buchheit (KR, KR-M-0049179); Hessen: Hessisch Lichtenau, Hoher Meißner, border area of an open “Basaltblockhalde”, 13 Mar 2014, H. Thiel (KR, KR-M-0043161); Niedersachsen: Ammerland, Bad Zwischenahn, Ofen, mixed forest, 11 Apr 2017, R. Jarling, II (KR, KR-M-0048818); Lüchow-Dannenberg, Höbeck, beech-oak forest, 22 Dec 2013, H. Thiel, II (KR, KR-M-0043146); Rheinland-Pfalz: Bad Kreuznach, Hochstetten-Dhaun, Simmerbachtal near Dhaun castle of Dhaun, 30 Oct 2013, H. Thiel (KR, KR-M-0043152); Schleswig-Holstein: Nordfriesland, Nebel, pine forest, 15 Oct 2014, H. Thiel (KR, KR-M-0043173); Sachsen: Schmilka, Großer Winterberg, 26 Aug 1903, H. & P. Sydow (Sydow & Sydow, Mycoth. germ. 62; W, 1903-13407; S, F29305, type); Schmilka, Großer Winterberg, Aug 1903, H. & P. Sydow (S, F29306, F29307, type); Sachsen-Anhalt, Quedlinburg, Thale, unteres Bodetal, beneath Hexenplatz, 17 Jul 2014, H. Thiel (KR, KR-M-0043157); Thüringen, Eisenach, SSW Wartburg, NNW Eisenacher Burg, 25 May 2012, H. Thiel (KR, KR-M-0043190); Great Britain, Wales: Harlech, 4 Jan 1927, P.G.M. Rhodes (W, 1975-15143, 1973-22169, 1973-22320); Romania, Vîlcea: Muntele Cozia, Omu, 1 Jul 1976, G. Negrean, II (W, 1980-00055); Switzerland, Neuenburg: Gorgier, Creux du Van, 19 Oct 1913, E. Mayor, II (W, 1914-9288); Neuchâtel, Bois, Tête-Plumée, 5 Nov 1909, E. Mayor, (Vestergren, Micromyc. rar. sel. praec. Scand. 1702, W, 1914-9287, 1973-17308,); Neuchâtel, Tête-Plumée, 20 Oct 1913, E. Mayor, II (W, 1915-5830).

Description

Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 26.5–42.5 × 15.0–25.0 µm, mostly 30.0–40.0 × 17.5–22.5 µm; wall 0.5–2.5 µm, mostly 0.5–1.0 µm thick; spores echinulate with 1–2, mostly 1 ovoidal smooth area, typically located centrally, smooth area 15.0–22.5 × 6.3–11.3 µm, mostly 15.0–17.5 × 7.5–10.0 µm, spines 1.8–2.8 µm, mostly 1.8–2.2 µm long, irregularly distributed, erect, spines denser toward spore base, distances 0.5–7.0 µm, mostly 1.0–4.0 µm, spine base 0.7–1.6 µm, mostly 0.9–1.2 µm diam.; germ pores scattered, 4–10, mostly 5–6, 1.3–3.8 µm, mostly 2.0–2.5 µm diam., Ø 2.3 µm diam.

Milesina scolopendrii (Fuckel) Jaap, Fungi selecti exsiccati no. 571 (1912)

Figure 6n

Asplenium scolopendrium L. (Phyllitis scolopendrium (L.) Newman). Germany, Baden-Württemberg: Bodensee, Konstanz, N Langenrain, Überlinger-See, NW part of Blisenhalde, 9 May 1999, H. Jage (KR, KR-M-0025400); Reutlingen, Bad Urach, 12 Sep 2017, M. Scholler & R. Buchheit (KR, KR-M-0049049, KR-M-0049050); Reutlingen, Bad Urach, Gütersteiner Wasserfall, 18 Sep 2017, R. Buchheit (KR, KR-M-0049066); Reutlingen, Bad Urach, Uracher Wasserfälle, 12 Sep 2017, M. Scholler & R. Buchheit (KR, KR-M-0049037, KR-M-0049051); Nordrhein-Westfalen, Märkischer Kreis, Balve, Volkringhausen, moist forest, limestone rocks, 16 Aug 2012, H. Thiel (KR, KR-M-0043186); Rheinland-Pfalz, Bad Kreuznach, Hochstetten-Dhaun, forested slope below Dhaun castle, 30 Oct 2013, H. Thiel, II (KR, KR-M-0043153); Switzerland, Graubünden: 1871-1873, L. Fuckel (G, G 00550757, type).

Description

Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–49.0 × 17.5–25.0 µm, mostly 27.5–42.5 × 17.5–22.5 µm; wall 0.5–1.8 µm, mostly 0.5–1.2 µm thick; spores echinulate with 1 mostly ovoidal smooth area, located centrally to apically, smooth area 12.5–20.0 × 7.5–11.3 µm, mostly 15.0–17.5 × 7.5/10.0 µm, spines 1.5–2.8 long, irregularly distributed, erect, distances between spine bases 1.0–9.0 µm, mostly 2.0–5.0 µm, sometimes denser toward spore base, spine base 0.8–1.6 µm, mostly 0.9–1.2 µm diam.; germ pores scattered, 4–9, mostly 6–7, 1.25–3.0 µm, mostly 2.0–3.0 µm diam., Ø 2.4 µm diam.

Milesina vogesiaca Syd. & P. Syd., Annales Mycologici 8(5): 491 (1910)

Figure 6o, p

Polystichum aculeatum (L.) Roth. (P. lobatum L, Aspidium lobatum Sw.). Austria, Kärnten: Hermagor, between upper and lower Valentin Alpe next to Mauthen, 26 Aug 1940, H. Poeverlein (W, 1973-28256); Tirol: Alps, western Elbigenalp, Bernhardstal toward Bernhardseck, ravine forest, 28 Aug 1992, H. Jage, II (GLM, GLM-50893); France, Alsace: Lützelhausen, 5 Dec 1914, A. Ludwig, II (GLM, GLM-53028; W, 1916-4290); between Fischboedle and Kerbholz, Hohneck, 12 Jul 1910, H. Sydow (Sydow & Sydow, Mycoth. germ. 878; W, 1973-30304, 1910-006973; S, F29337, F29338, 29339, type); Vosges, between Fischboedle and Kerbholz, Hohneck, 16 Jul 1910, H. Sydow (Sydow, Uredineen 2345; B, B 700016496; W, 1973-07263, 1911-3905, type); between Fischboedle and Kerbholz, Hohneck, 16 Jul 1910, H. Sydow (S, F310782; B, B 700016495, type); Germany, Baden-Württemberg: Todtmoos, Au, Wehratal, Hagenmattgraben, 23 Aug 2001, H. Jage (sub M. neoexigua), corr. M. Scholler (KR, KR-M-0019138); Bayern: Oberallgäu, Oberjoch, Iseler, spruce-fir forest, 24 Jun 2008, M. Scholler (KR, KR-M-0003907); Hessen: Werra-Meißner, Eschwege, Albungen, Trenkgraben, broadleaved forest, 13 Apr 2013, H. Thiel (KR, KR-M-0043160); Niedersachsen, Osterode, Herzberg, Scharzfeld, Rottsteine, beech forest, limestone rocks, 29 Mar 2014, H. Thiel (KR, KR-M-0043175); Nordrhein-Westfalen: Märkischer Kreis, Balve, Volkringhausen, moist forest, 16 Aug 2012, H. Thiel, II (KR, KR-M-0043187).

P. lonchitis (L.) Roth. Austria, Tirol: Alps, Lechtal, south east Holzgau, Sulzltal, 1 km south of Ronig-Alm, “Hochstaudenbergflur” 17 Aug 1991, H. Jage, II (GLM, GLM-50866).

Description

Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–45.0 × 15.0–25.0 µm, mostly 30.0–40.0 × 17.5–20.0 µm; wall 0.5–1.0 µm, mostly 0.5–0.8 µm thick; spores with flat verrucae verrucae 0.3–0.6 µm, mostly 0.4–0.5 µm in diam., mainly at the upper part of the spore (visible with SEM only); germ pores often bizonate, sometimes scattered, 3–8 mostly 5–6, 2.0–4.5 µm, mostly 2.5–3.0 µm diam., Ø2.8 µm diam.

Comment

See commentary under M. exigua.

Milesina whitei (Faull) Hirats., Memoirs of the Tottori Agricultural College 4: 123 (1936)

Figure 6q, r

Polystichum aculeatum (L.) Roth (syn. P. lobatum L, Aspidium lobatum Sw.). Croatia, Dalmatia: Castelnuovo, 25 Apr 1914, O. Jaap (FH, FH 01146298, type).

Polystichum setiferum (Forsk.) Moore ex Woynar., Austria, Steiermark: Deutschlandberg, Klause, Laßnitz, northern bank of the river, rock, 31 Jul 2018, M. Scholler & C. Scheuer (KR, KR-M-0050248); Switzerland, Ticino: Locarno, Cugnasco, Valle di Cugnasco, ravine, 9 Dec 2017, L. Beenken (KR, KR-M-0044953); Vaud, Montreux, Gorges du Chadron, 30 Apr 2011, T. Brodtbeck, II (KR, KR-M-0049177).

Polystichum sp. Austria, Steiermark: Possruck, ravine, 19 Nov 1972, J. Poelt (KR, KR-M-0039378).

Description

Urediniospores hyaline, ellipsoidal, obovoidal to oval, 27.5–40.0 × 16.5–25.0 µm, mostly 27.5–37.5 × 17.5–22.5 µm; wall 0.5–1.0 µm, mostly 0.8–1.0 µm thick; echinulate without spine-free areas, spines 1.8–2.8 µm, mostly around 1.8–2.5 µm long, irregularly distributed, straight and perpendicular to the wall, distance between spine bases 1.0–8.0 µm, mostly 1.5–5.0 µm, spine base 0.5–1.2 µm, mostly 0.8–1.1 µm diam.; germ pores scattered, 8–15 (17), mostly 9–13, 1.3–3.0 µm, mostly 2.0–2.5 µm diam., Ø2.3 µm diam.

Comment

The North American Milesina polystichi (Wineland) Grove (= Milesia polystichi Wineland) on Polystichum munitum (Kaufl.) Presl. is considered conspecific with M. whitei by several authors (e.g. Gäumann 1959). We were able to study isotype material (USA, Oregon, Granite Pass, 5 Sep 1916, leg. R.J. Weir, PUR 004047) and found urediniospores with mostly 5 to 6 germ pores, i.e. many fewer than in M. whitei. Due to this striking difference, they are possibly different species.

Milesina woodwardiana Buchheit & M. Scholler, sp. nov.

MycoBank No: 829596
Figure 7a–f

Holotype

Woodwardia radicans (L.) Sm., Spain, Islas Canarias, La Palma, Cubo de la Galga, ca. 2.5 km SW parking place at coastal highway W San Bartolomé, wayside in Laurosilva, 11 Aug 2017, V. Kummer (KR-M-0049033).

Further specimens examined (paratypes)Spain, Islas Canarias: La Palma, Cubo de la Galga, ca. 1.2 km SW of parking lot at coastal highway W San Bartolomé, wayside in Laurosilva, 16 Aug 2015, V. Kummer, II (KR, KR-M-0048787); La Palma, Cubo de la Galga, ca. 1.2 km SW parking lot at coastal highway W San Bartolomé, near waypoint 6, wayside in Laurosilva, 11 Aug 2017, V. Kummer, II (KR, KR-M-0049036); La Palma, Cubo de la Galga, ca. 1.25 km SW parking lot at coastal highway W San Bartolomé, between waypoint 6 and 7, wayside in Laurosilva, 11 Aug 2017, V. Kummer, II (KR, KR-M-0049034).

Description

Spermogonia (0), aecia (I), telia (III) and basidia (IV) unknown. Uredinia hypophyllous, subepidermal, statistically distributed; sori round, wart-like elevations, 0.1–0.3 mm in diam., covered by brownish or yellow-brownish epidermis, on dark necrotic plant tissue margined by nerves, never on nerves directly, sori opening pore-like; peridium hemispheric, peridial cells colourless, about 7.5–25.0 × 7.5–10 µm, upper peridial cells more or less isodiametrical and lateral peridial cells elongated; urediniospores hyaline, ellipsoidal to obovoidal, sometimes subglobose to irregular, 25.5–46.5 × 15.0–25.0 µm, mostly 30.0–37.5 × 17.5–22.5 µm; cell wall thin, 0.5–1.2 µm, mostly 0.5–1.0 µm thick, densely echinulate without spine-free areas, densest at spore base, spines 2.0–3.2 µm long, mostly 3.0 µm long, slightly irregularly distributed, spines orientated in different directions, dense basal spines typically directed toward spore pedicel, distance between spines bases 0.5–5.0 µm, mostly 2.0–4.0 µm, spine base 0.6–1.3 µm, mostly around 1 µm; spore pedicel often laterally or semilaterally inserted, short and wide, 5.5–14 × 12.5–15.5 µm; germ pores scattered, 8–19 (21), mostly 10–14, 1.3–3.0 µm, mostly 2.0–3.0 µm diam., Ø 2.4 µm diam.; germ tubes septate, may develop simultaneously in one spore.

Figure 7. 

Spore morphology and symptoms on fern fronds of Milesina woodwardiana sp. nov. a Fronds of the host Woodwardia radicans at the collection site in La Palma. Dark spots indicate areas where sori are formed on the underside (La Palma, Cubo de la Galga, ca. 1.2 km SW of parking lot W San Bartolomé, 11 Aug 2017) b Host leaf with uredinia. Sori (arrows) are restricted to areas between leaf veins (KR-M-0048787, dissecting microscope) c Transverse section of uredinium E=epidermis, P=peridial cells, U=urediniospore, M=mesophyll of host plant (KR-M-0048787, LM, interference contrast) d Urediniospores with long echinulae (KR-M-0049036, paratype, SEM) e Urediniospores, cracked, without plasma, germ pores scattered (KR-M-0049033, paratype; LM, phase contrast) f Germinating urediniospores, arrows point to germ tubes (KR-M-0049033, paratype, LM, phase contrast).

Distribution

The species is only known north-eastern La Palma, Islas Canarias, Spain.

Etymology

Referring to the English botanist Thomas Jenkinson Woodward (1745 – 1820) and the host plant Woodwardia radicans named after him.

Comment

This species differs from M. blechni by the telial host plant genus (Woodwardia), by a higher number of germ pores/spore, longer spines and irregular spine orientation. Milesina woodwardiana is the first Milesina species known on Woodwardia (Berndt 2008; Faull 1932). The absence of potential aecial hosts (Abies spp.) in La Palma and all other Canary Islands (Hohenester and Welss 1993, Ginovés et al. 2009) and the non-formation of telia indicate that the species is not host-alternating in La Palma. The Woodwardia radicans area (Hohenester and Welss 1993), however, overlaps with those of Abies × borisii-regis, A. cephalonica and A. pinsapo in south-western Europe (Liu 1971). If the rust is present in this area, it may be possible to observe the spore stages 0 and I on Abies spp. Woodwardia radicans is the only species of Woodwardia in Europe. There are numerous other species in SE Asia and N America (Li et al. 2016). These areas may also coincide with the distribution area of M. woodwardiana.

Milesina spp.

Abies alba Mill. Austria, Steiermark: Trog, Mausegg, Höllental, Klamm, N river bank, 31 Jul 2018, M. Scholler & C. Scheuer, 0, I (KR, KR-M-0050303); Germany, Baden-Württemberg: Esslingen, Kirchheim unter Teck, NW Owen, 18 Sep 2017, R. Buchheit, I (KR, KR-M-0049065); Freudenstadt, Baiersbronn, NSG “Wilder See-Hornisgrinde”, Karwand, mixed spruce-fir forest, 12 Sep 2015, M. Scholler, I (KR, KR-M-0043687); Ortenaukreis, Friesenheim, E Oberweier near Schnaiggraben, mixed forest, 17 Aug 2005, M. Scholler (KR, KR-M-0018587); Ortenaukreis, SSW Oppenau, “Ibacher Holzplatz“ mixed spruce-fir forest, 18 Aug 2005, M. Scholler (KR, KR-M-0018624); Ottenhöfen, “Edelfrauengrab Wasserfälle”, creek bank, 26 Jun 2017, M. Scholler (KR, KR-M-0048773); Rastatt, Gernsbach, Lauterbach, NSG “Lautenfelsen“, eastern crosscut, beyond “Aussichtfelsen”, 11 Sep 2014, M. Scholler (KR, KR-M-0042052); Rastatt, Loffenau, “Großes Loch“ near Loffenau, 15 Sep 2017, R. Buchheit (KR, KR-M-0049038); Reutlingen, W Bad Urach, “Tannenverjüngung“, 18 Sep 2017, R. Buchheit, I (KR, KR-M-0049068); Bayern: Garmisch-Partenkirchen, Grainau, S Eibsee, spruce-fir forest, 8 Aug 2017, M. Scholler (KR, KR-M-0049063); Miesbach, Schliersee, S Spitzingsee, E Roßkopf, spruce-fir forest close to Struthiopteris spicant, 8 Aug 2017, M. Scholler (KR, KR-M-0049062).

Comment

In this study, Milesina spp. on Abies alba were only sequenced but not morphologically analysed.

Subgeneric classification

Four morphological groups can be distinguished within Milesina with respect to germ pore number, germ pore size, germ pore position and distribution of spines on the spore surface (Figures 6a–r, 7d–f, Table. 4). The morphological differentiation corresponds with the differentiation in four clades found by molecular data (Figure. 1, right panel).

Milesina sect. Milesina

Type species

M. kriegeriana (Magnus) Magnus 1909.

This type section is characterised by urediniospores having numerous scattered germ pores and an echinulate wall without smooth areas. Milesina blechni, M. whitei and M. woodwardiana are additional members of this section.

Milesina sect. Vogesiacae M. Scholler & Bubner, sect. nov.

MycoBank No: 829594

Type species

M. vogesiaca Syd. & P. Syd. 1912.

This section is characterised by urediniospores having few bipolarly distributed germ pores and a smooth or almost smooth wall. Milesina exigua is included in this section. Urediniospore features of European Uredinopsis spp. resemble those of Vogesiacae species. However, Uredinopsis spores have a terminal mucro.

Milesina sect. Scolopendriorum M. Scholler & Bubner, sect. nov.

MycoBank No: 829597

Type species

M. scolopendrii (Fuckel) Jaap 1912.

This section is characterised by urediniospores having few scattered germ pores and an echinulate wall with smooth areas. Milesina feurichii, M. polypodii, M. magnusiana and M. murariae are in this section. M. magnusiana agrees well with the other species with respect to morphology. Therefore, we placed it in section Scolopendriorum, although no ITS data are available.

Milesina sect. Carpaticae M. Scholler & Bubner, sect. nov.

MycoBank No: 829595

Type species

M. carpatica Wróbl. 1913

This section is characterised by urediniospores having few scattered germ pores and an echinulate wall without smooth areas. It is similar to section Milesina in having an echinulate cell wall, but the number of germ pores is lower (only 5-7). The ITS sequences of the two sections are separated by a large genetic distance. So far, this section is represented only by the type species. Possibly, the North American M. polystichi belongs to this section as well (see commentary to M. whitei).

Key to European Milesina species

The following key to European Milesina sections and species is based on urediniospore (abbreviated Us) features listed in Table 4. It requires light-microscopical equipment and methods described in the Methods section. The lengths of the urediniospores refer to the main values.

1 Us with terminal mucro Uredinopsis
Us without terminal mucro (Milesina) 2
2 Surface of Us smooth or almost smooth, germ pores often formed apically (sect. Vogesiacae) 3
Surface of Us echinulate, sometimes with particularly smooth areas, germ pores scattered 4
3 Us mostly 30.0–40.0 × 17.5–20.0 µm, germ pores up to 4.5 µm diam. (Polystichum aculeatum) M. vogesiaca
Us smaller, mostly 22.5–30.0 × 12.5–17.5 µm, germ pores smaller, up to 3.8 µm diam. (germ pores are often not visible, check numerous Us) (Polystichum braunii, P. aculeatum) M. exigua
4 Surface of Us with smooth spine-free areas, germ pores ± 6 (Sect. Scolopendriorum) 5
Surface of Us without smooth spine-free areas, germ pores either ± 6 (M. carpatica, sect. Carpaticae) or ± 11 (species of sect. Milesina) 9
5 Us mostly 27.5–35.0 µm long, wall mostly 2.0 µm thick (Asplenium ruta-muraria) M. murariae
Us mostly more than 30.0 µm long, wall mostly thinner (< 2 µm) 6
6 Us mostly 30.0–40.0 µm long (Polypodium spp.) M. polypodii
Us shorter, mostly 30.0‒37.5 µm 7
7 Spine distance mostly 1.0‒4.0 µm (Asplenium septentrionale) M. feurichii
Spine distance 2.0‒5.5 µm 7
8 Spine distance mostly 3.0‒5.5 µm, Us 30.0–35.0 × 17.5‒20.0 µm, germ pore 2.9 µm diam. (Asplenium adiantum-nigrum) M. magnusiana
Spine distance 2.0‒5.0 µm, Us 27.5–42.5 × 17.5–22.5 µm, germ pore < 2.5 diam. (Asplenium scolopendrium) M. scolopendrii
9 Us mostly 20.0‒30.0 × 12.5‒19.0 µm, wall 0.5‒1.0 µm thick, spines mostly 1.0‒1.8 µm long, germ pores usually 6, mostly 1.3‒2.0 µm diam., pores hardly visible (check numerous Us) (Dryopteris filix-mas) (sect. Carpaticae) M. carpatica
Us larger, mostly 27.0 ‒ 37.5 × 17.5 ‒ 22.5 µm, germ pores ± 11 9
10 Spines ± 3.0 µm long, orientated in different directions, Us mostly 30.0‒37.5 × 17.5‒22.5 µm (Woodwardia radicans) M. woodwardiana
Spines shorter, < 3.0 µm long, typically perpendicular to the wall 11
11 Us mostly ≥ 17.5 µm wide, 27.5‒40.0 × 16.5–25.0 µm, spines erect (Polystichum aculeatum, P. setiferum) M. whitei
Us ± 17.5 µm wide, sometimes spines arranged in rows, typically erect (the following two species are morphologically barely distinguishable) 12
12 Us mostly 27.5–37.5 µm long (Dryopteris borreri, D. carthusiana, D. dilatata, D. filix-mas M. kriegeriana
Very similar, Us somewhat longer on average, mostly 30.0–37.5 µm (Struthiopteris spicant) M. blechni

Discussion

Species resolution by urediniospore features

In previous studies of the genus Milesina (e.g. Wróblewski 1913; Faull 1932; Kuprevič and Tranzschel 1957; Berndt 2008), size and shape of urediniospores, wall thickness, spine length and density were the main features used to characterise their morphology. In this study, additional morphological features and criteria are provided to distinguish species (Figure 5, Table 4).

The number, position and size of germ pores have not been documented even in more recent studies of Milesina (Berndt 2008). Additionally, in Chrysomyxa, another genus of Pucciniastraceae (Cao et al. 2017), no germ pores were shown. Germ pores in Milesina are documented in Cummins and Hiratsuka (2003). The authors report “bizonate, obscure” germ pores for species of the genus. We found this character only in the two species of the section Vogesiacae. A further observation of germ pores is reported for two North American species Milesina polypodophila (Bell) Faull and Milesina marginalis Faull & Watson (Moss 1926) where germ pores showed a scattered distribution. With our light microscopic method, detection of germ pores was easy and could be realised within short time. In two species, M. carpatica and M. exigua, germ pores were more difficult to visualise and need more time to evaluate. In general, however, this method is suitable to document an important morphological and taxonomically relevant feature. It may also help to characterise other genera in the Pucciniastraceae. Another feature, smooth areas on the surface of urediniospores has not been documented so far. It is a special character of species of section Scolopendriorum. All of these features in combination allow identification of Milesina species in Europe by urediniospore features alone, using a light microscope even without knowledge of the host plant species. Only one pair of species, the common M. blechni and M. kriegeriana, is difficult to distinguish morphologically. We only found differences in spore length measurements.

In general, identification using only the host is unreliable, since the range of telial hosts in Milesina has been only scarcely studied. This holds true even for common species like M. kriegeriana, a species which has obviously a much wider host range with species in different host families (Berndt 2008) than listed in European compilatory literature (e.g. Gäumann 1959; Majewski 1977; Klenke and Scholler 2015). Polystichum aculeatum is known for hosting M. carpatica and M. vogesiaca (e.g. Gäumann 1959; Majewski 1977; Klenke and Scholler 2015). In the present study, M. exigua was also found on P. aculeatum, demonstrating again that the host range may be wider for several Milesina species and that host identification is not sufficient to identify Milesina spp.

Species resolution by barcoding

We were able to classify four sections by phylogenetic analysis of ITS sequences (Fig. 1) but we were only able to differentiate 4 of 11 species. This low differentiation is in contrast to another genus in the suborder Melampsorineae sensu Aime (2006). In the genus Chrysomyxa, almost all species could be resolved on the basis of ITS barcodes (Cao et al. 2017). Still, amongst the three tested barcodes ITS, nad6 and 28S in the present study, ITS showed the highest species resolution because it could resolve the pairs M. whitei/kriegeriana and M. blechni/woodwardiana.

The alternative barcode nad6 has been tested on different rust species (Vialle et al. 2009, Feau et al. 2011, Vialle et al. 2013). It was chosen for the present study because, in a study on Melampsora spp., it was the only barcode amongst six tested barcodes (ITS, 28S; CO1, nad6, MS277, MS208) that could distinguish the species Melampsora laricis-tremulae and Melampsora pinitorqua (Vialle et al. 2013) on the basis of a Single Nucleotide Polymorphism. As seen from the branch lengths in Figure 1 and Figure 2 (compare also the scale bars), nad6 sequences show the lowest variation between the sections Milesina, Scolopendriorum, and Vogesiacae as compared to the other two markers. Within the sections Milesina and Scolopendriorum, the sequences were completely identical amongst the species. This low variation makes this marker more suitable for studies on infrafamiliar level than for species distinction on the infrageneric level.

The fungal barcode 28S rDNA is the second most widely used, following ITS (Schoch et al. 2012). It it used for phylogenetic analysis of rusts on the infrafamiliar or higher taxonomic level (Maier et al. 2003, Aime et al. 2006, Yun et al. 2011), but also the identification of closely related species (V, Beenken 2014, Maier et al. 2016, Beenken et al. 2017, Demers et al. 2017, Zhao et al. 2017). In the studies that directly compare ITS with 28S data, species resolution of ITS and 28S are comparable (Ali et al 2016, Beenken et al. 2012, Beenken et al. 2017, Feau et al. 2011) or ITS (namely the sub region ITS2) shows a slightly better resolution (Kenaley et al 2018, McTaggart and Aime 2018). However, when species could not be distinguished with ITS data, distinction was also not possible with 28S data. For instance, European specimens of Coleosporium species C. euphrasiae (Schumach.) G. Winter, C. campanulae (Pers.) Lév. and C. senecionis (Pers.) Fr., each occurring on telial hosts in different plant families, could neither be distinguished by ITS nor by 28S sequences. This is also clearly the case in the present study for the Milesina species in the sections Milesina and Scolopendriorum that colonise different fern species, but have almost identical ITS and 28S sequences.

One possible solution to lacking species resolution is to declare all specimens with the same ITS sequence data as one species, which was the original concept of ITS barcoding (Schoch et al. 2012). However, it is not only the telial host that differs between the Milesina species in the section Scolopendriorum, but also the features of the urediniospores (see identification key and Table 4). In the case of contradicting results, it is not advisable to weight the ITS data as more reliable than the morphological/host data. In the ascomycete genus Fusarium, several species complexes could not be resolved by ITS data, but with newly developed barcodes TOPI (Topoisomerase I) and PGK (phosphoglycerate kinase, Al-Hatmi et al. 2016). It is also possible that, for the rust fungi, new barcodes can be developed on the basis of genomic data (Aime et al. 2018b) that finally allow morphologically determined species to be resolved.

Success of sequencing

Not all specimens studied morphologically were used for sequencing (i.e. old specimens, type specimens, specimens with little spore material) and not all of those specimens, where DNA was extracted, were successfully sequenced. The rate of successful ITS sequencing (63%) is relatively low. In a previous study on Melampsora rust fungi on Salix, the rate of ITS sequencing success (93%) was much higher (Bubner et al. 2014). The Melampsora study comprised exclusively freshly collected specimens not older than half a year, whereas we also analysed herbarium material that was several years old. However, freshly collected specimens (from 2017) also failed, while the two oldest successful specimens are from 1999. Therefore, it is not only the age of the samples that explains the low success of sequencing. It is possible that the small and fragile sori of Milesina species (in comparison, for instance, to Melampsora sori on Salix) are more prone to DNA decay on the herbarium specimens.

Even more surprising is the low success rate for the 28S sequencing. The 28S sequencing was performed only on samples with successful ITS sequencing. Template DNA should be present because both loci belong to the same multicopy rDNA region on the nuclear DNA. Despite this linkage, 28S is reported to have a PCR success rate of only 80% as compared to ITS in a large scale study on Basidiomycota including Pucciniomycotina (Schoch et al. 2012). Nevertheless, in recent phylogenetic studies on rusts, often concatenated alignments of ITS and 28S are used (e.g. Beenken 2017, Demers et al. 2017, McTaggart and Aime 2018, Vialle et al. 2013) which requires that both ITS and 28S can be sequenced. Although phylogenetic studies rarely report a success rate, it can be assumed that routine sequencing of both loci is possible. The low sequencing success in Milesina could be a genus-specific problem. We used 28S primers (ITS4BRF, LR5) which Vialle et al. (2013) successfully used for sequencing Melampsora spp. on poplars for Milesina spp., however, with much less success. Possibly 28S rDNA of Milesina is more difficult to sequence than in other rust genera. Other primer combinations for sequencing 28S rDNA are available and could be tested. The requirements of further testing demonstrate that, in the genus Milesina, species identification by barcode sequencing is still far from being routine.

Section Vogesiacae

The support values for section Vogesiacae are smaller than for the other three Milesina sections when M. exigua is included. Interestingly, the support values are 100/1/100 for an ITS tree with Puccinia graminis as outgroup. The decision to place both M. vogesiaca and M. exigua into one section is more strongly supported by morphological than by molecular data. Milesina vogesiaca and M. exigua are the only two species that have urediniospores without ornamentation and a bizonate position of germ pores. Further support for a molecularly and morphologically defined clade is given through Uredinopsis filicina. In the ITS phylogram, it groups behind a node with high support values that includes both M. vogesiaca and M. exigua. The inclusion of U. filicina within a clade, that comprises all Milesina species (also M. carpatica), indicates that the genus Milesina is paraphyletic. The paraphyly is also indicated in the nad6 and 28S phylograms. Furthermore, M. vogesiaca, M. exigua and U. filicina form a group with high support values in 28S phylogram.

By morphology of urediniospores, U. filicina (the type species of Uredinopsis) is similar to the two Milesina species in the section Vogesiacae because it also has smooth urediniospores (Gäumann 1959). Germ pores have not been analysed so far. Germ pores are reported for two North American species, U. osmundae Magnus and U. atkinsonii Magnus (Moss 1926). Urediniospores are smooth and show the same bizonate position of germ pores as documented for M. vogesiaca and M. exigua. A recent study on molecular age estimates in Pucciniales presents 28S data of Melampsorineae that also comprises a limited selection of Uredinopsis and Milesina specimens (Figure 3 in Aime et al. 2018a). The species U. osmundae, U. filicina and M. vogesiaca group together, while M. scolopendrii and an undetermined Milesina species form a sister clade. This confirms the topology of the trees in the present study. The molecular and the morphological data indicate that at least U. filicina is actually a Milesina species in the clade Vogesiaceae. To place U. filicina (and possible other species of Uredinopis) in the genus Milesina, however, requires a more comprehensive sampling of Uredinopsis species and sequencing of both ITS and 28S rDNA (study in preparation).

Host alternation in section Milesina

Amongst the 11 sequences of specimens found on the aecial host Abies alba, nine could be assigned to the section Milesina. Although this section contains four species, the question which species is able to form aeciospores on Abies alba can be narrowed down to three species. Only telial hosts of M. blechni, M. kriegeriana and M. whitei grow in the distribution area of Abies alba in Europe. Therefore, M. woodwardiana can be excluded, because the host Woodwardia radicans is restricted to Macaronesia and the Mediterranean (Hohenester and Welss 1993, Li et al. 2016) from where no Milesina sequences from the aecial host (Abies spp.) are available. In addition, M. woodwardiana obviously does not form telia and, consequently, no basidia and basidiospores. Basidiospores, however, are necessary to infect Abies.

The answer to the question which of the two species M. whitei / M. kriegeriana has an alternate host needs further field observation and experimental studies (inoculation experiments). Our specimens most probably belong to M. kriegeriana, because they were all collected in the Black Forest area (SW Germany) where we found M. kriegeriana many times on the telial host but not M. carpatica. Inoculation experiments should not only include the hosts of M. whitei (Polystichum spp.) and M. kriegeriana (Dryopteris spp.), but also Struthiopteris spicant, the host of M. blechni. This would further help to answer the question whether M. blechni and M. kriegeriana are distinct species or not. Despite the SNP at position 381, both species are very similar in urediniospore morphology. Inoculation experiments would provide further arguments to clarify the status of the two species. Another approach to analyse both host alternation and species distinction in the section Milesina would be to measure gene flow between the aecial (Abies) and the different telial hosts (ferns) by population genetics. Gene flow measurements in rust fungi have been applied to Melampsora larici-populina (Barres et al. 2012; Elefsen et al. 2014).

Conclusion

Both morphological features of the urediniospores and ITS sequences provide data to distinguish subgeneric groups (sections) in the genus Milesina. Apart from the two related species, M. blechni and M. kriegeriana in the section Milesina, morphological characteristics of urediniospores are sufficient to distinguish all European species in the genus Milesina. In contrast, ITS, nad6 and 28S barcodes worked only for the sections Carpaticae and Vogesiacae and failed to resolve species in the sections Milesina and Scolopendriorum. Therefore, morphology of urediniospores, in conjunction with host determination, is still a more secure and faster tool to identify species in Milesina on the telial host. Other markers have to be developed for quicker and more secure identification with barcodes.

Acknowledgements

Curators of the herbaria B, FH, G, GLM, HBG, KR, M, PUR, S and W provided loans for Milesina specimens. Numerous collectors provided additional specimens: Ludwig Beenken, Thomas Brodtbeck, Horst Jage, René Jarling, Christian Scheuer and Hjalmar Thiel. Uwe Braun delivered taxonomic expertise, Matthias Lutz and Larry Dunkle reviewed earlier drafts of the manuscript and Wolfgang Mayer provided literature on Milesina. Special thanks are due to Sascha Hentschel and Petra Knauer for technical assistance and Max Wieners, student assistant, who managed the database input and part of the herbarium preparation work. Barcoding and field studies were supported by the German Federal Ministry of Education and Research (BMBF FKZ 01LI1501l) (grant to B. Bubner, M. Scholler). Field studies in the Black Forest National Park were supported by institutions (Regierungspräsidium Karlsruhe, Black Forest National Park) of the state of Baden-Württemberg, Germany (project “Pilzflora Wilder See”, grant to M. Scholler).

References

  • Abbasi M, Goodwin SB, Scholler M (2005) Taxonomy, phylogeny, and distribution of Puccinia graminis, the black stem rust: new insights based on rDNA sequence data. Mycoscience 46: 241–247. https://doi.org/10.1007/s10267-005-0244-x
  • Aime MC, Matheny PB, Henk DA, Frieders EM, Nilsson RH, Piepenbring M, McLaughlin DJ, Szabo LJ, Begerow D, Sampaio JP, Bauer R, Weiss M, Oberwinkler F, Hibbett D (2006) An overview of the higher level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia 98: 896–905. https://doi.org/10.3852/mycologia.98.6.896
  • Aime MC, Castlebury LM, Abbasi M, Begerow D, Berndt R, Kirschner R, Marvanova L, Ono Y, Padarnsee M, Scholler M, Thines M, Rossmann A (2018b) Competing sexual and asexual generic names in Pucciniomycotina and Ustilaginomycotina (Basidiomycota) and recommendations for use. IMA Fungus 9: 75–90.
  • Al-Hatmi AMS, Van Den Ende AHGG, Stielow JB, Van Diepeningen AD, Seifert KA, McCormick W, Assabgui R, Graefenhan T, De Hoog GS, Levesque CA (2016) Evaluation of two novel barcodes for species recognition of opportunistic pathogens in Fusarium. Fungal Biology 120: 231–245. https://doi.org/10.1016/j.funbio.2015.08.006
  • Ali B, Sohail Y, Toome-Heller M, Mumtaz AS (2016) Melampsora pakistanica sp. nov., a new rust fungus on Euphorbia helioscopia (Sun spurge) from Pakistan. Mycological Progress 15: 1285–1292. https://doi.org/10.1007/s11557-016-1244-2
  • Barres B, Dutech C, Andrieux A, Halkett F, Frey P (2012) Exploring the role of asexual multiplication in poplar rust epidemics: impact on diversity and genetic structure. Molecular Ecology 21: 4996–5008. https://doi.org/10.1111/mec.12008
  • Beenken L (2017) Austropuccinia: a new genus name for the myrtle rust Puccinia psidii placed within the redefined family Sphaerophragmiaceae (Pucciniales). Phytotaxa 297: 53–61. https://doi.org/10.11646/phytotaxa.297.1.5
  • Beenken L, Lutz M, Scholler M (2017) DNA barcoding and phylogenetic analyses of the genus Coleosporium (Pucciniales) reveal that the North American goldenrod rust C. solidaginis is a neomycete on introduced and native Solidago species in Europe. Mycological Progress 16: 1073–1085. https://doi.org/10.1007/s11557-017-1357-2
  • Beenken L, Zoller S, Berndt R (2012) Rust fungi on Annonaceae II: the genus Dasyspora Berk. and M.A. Curtis. Mycologia 104: 659–681. https://doi.org/10.3852/11-068
  • Bubner B, Wunder S, Zaspel I, Zander M, Gloger J, Fehrenz S, Ulrichs C (2014) Melampsora rust species on biomass willows in central and northeastern Germany. Fungal Biology 118: 910–923.
  • Cao J, Tian C-M, Liang Y-M, You C-J (2017) Two new Chrysomyxa rust species on the endemic plant, Picea asperata in western China, and expanded description of C. succinea. Phytotaxa 292: 218–230. https://doi.org/10.11646/phytotaxa.292.3.2
  • Cummins JB, Hiratsuka Y (2003) Illustrated genera of rust fungi. Third edition. American Phytopathological Society, APS Press, Minnesota, 225 pp.
  • Elefsen SE, Frey P, Sverrisson H, Hallsson JH (2014) Microsatellite analysis of Icelandic populations of the poplar fungal pathogen Melampsora larici-populina shows evidence of repeated colonization events. European Journal of Plant Pathology 139: 597–608. https://doi.org/10.1007/s10658-014-0416-7
  • Feau N, Vialle A, Allaire M, Maier W, Hamelin RC (2011) DNA barcoding in the rust genus Chrysomyxa and its implications for the phylogeny of the genus. Mycologia 103: 1250–1266. https://doi.org/10.3852/10-426
  • Gäumann E (1959) Die Rostpilze Mitteleuropas. Beiträge zur Kryptogamenflora der Schweiz 12. Büchler & Co, Bern, 1407 pp.
  • Geiger MF, Astrin JJ, Borsch T, Burkhardt U, Grobe P, Hand R, Hausmann A, Hohberg K, Krogmann L, Lutz M, Monje C, Misof B, Moriniere J, Mueller K, Pietsch S, Quandt D, Rulik B, Scholler M, Traunspurger W, Haszprunar G, Waegele W (2016) How to tackle the molecular species inventory for an industrialized nation-lessons from the first phase of the German Barcode of Life initiative GBOL (2012–2015). Genome 59: 661–670. https://doi.org/10.1139/gen-2015-0185
  • Ginovés JRA, León Arencibia MC, Navarro MLR, del Arco Aguilar M, Gallo AG, Pérez de Paz PL, Delgado OR, Osorio VEM, Wildpret de la Torre W (2009) Pteridophyta, Spermatophyta. In: Arechavaleta M, Rodríguez S, Zurita N, García A (Eds) Lista de especies silvestres de Canarias. Hongos, plantas y animales terrestres – 2009. Gobierno de Canarias, 119–172.
  • Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Hietala AM, Solheim H, Fossdal CG (2008) Real-time PCR-based monitoring of DNA pools in the tri-trophic interaction between Norway spruce, the rust Thekopsora areolata, and an opportunistic ascomycetous Phomopsis sp. Phytopathology 98: 51–58. https://doi.org/10.1094/phyto-98-1-0051
  • Hohenester A, Welss W (1993) Exkursionsflora für die Kanarischen Inseln. Mit Ausblicken auf ganz Makaronesien. Eugen Ulmer, Stuttgart, 374 pp.
  • Holmgren PK, Holmgren NH, Barnett C (1990) Index Herbariorum. Part 1, The Herbaria of the World (8th edn). New York Botanical Garden, New York, 693 pp.
  • Hunter LM (1935) A preliminary note on life history studies of European species of Milesia. Journal of the Arnold Arboretum 16: 143–143.
  • Hunter LM (1936) The life histories of Milesia scolopendrii, M. polypodii, M. vogesiaca and M. kriegeriana. Journal of the Arnold Arboretum 17: 26–37.
  • Kamei S (1940) Studies on the cultural experiments of the fern rusts of Abies in Japan. II. Journal of the Faculty of Agriculture, Hokkaido Imperial University 47: 93–191.
  • Kenaley SC, Quan M, Aime MC, Bergstrom GC (2018) New insight into the species diversity and life cycles of rust fungi (Pucciniales) affecting bioenergy switchgrass (Panicum virgatum) in the Eastern and Central United States. Mycological Progress 17: 1251–1267. https://doi.org/10.1007/s11557-018-1434-1
  • Kirk PM, Cannon PF, David JC, Stalper JA (2001) Dictionary of the Fungi (9th edn). CABI Bioscience, Wallingford, 655 pp.
  • Klebahn H (1916) Kulturversuche mit Rostpilzen XVI. Zeitschrift für Pflanzenkrankheiten 26: 257–277.
  • Kuprevič VF, Tranzschel VA (1957) Sem. Melampsorovye (4) Flora sporovych rastenij SSSR Akademija Nauk. SSSR, Moscow, 419 pp.
  • Liu TS (1971) A Monograph of the Genus Abies. Department of Forestry, National Taiwan University, Taipeh, 608 pp.
  • Maier W, Begerow D, Weiss M, Oberwinkler F (2003) Phylogeny of the rust fungi: an approach using nuclear large subunit ribosomal DNA sequences. Canadian Journal of Botany-Revue Canadienne De Botanique 81: 12–23. https://doi.org/10.1139/b02-113
  • Maier W, McTaggart AR, Roux J, Wingfield MJ (2016) Phakopsora myrtacearum sp. nov., a newly described rust (Pucciniales) on eucalypts in eastern and southern Africa. Plant Pathology 65: 189–195. https://doi.org/10.1111/ppa.12406
  • Majewski T (1977) Flora Polska. Grzyby (Mycota): 9 Basidiomycetes, Uredinales I. Warszawa, Kraków, 396 pp.
  • Mayor E (1944) Mélanges mycologiques. Bulletin de la Société Botanique Suisse 54: 5–18.
  • Mulvey RL, Hansen EM (2011) Castilleja and Pedicularis confirmed as telial hosts for Cronartium ribicola in whitebark pine ecosystems of Oregon and Washington. Forest Pathology 41: 453–463. https://doi.org/10.1111/j.1439-0329.2010.00702.x
  • O´Donnell K (1993) Fusarium and its near relatives. In: Reynold DR, Taylor JW (Eds) The Fungal Holomorph: Mitotic, Meiotic and Pleomorphic Speciation in Fungal Systematics. CAB International, Washington, 225–233.
  • Pfunder M, Schurch S, Roy BA (2001) Sequence variation and geographic distribution of pseudoflower-forming rust fungi (Uromyces pisi s. lat.) on Euphorbia cyparissias. Mycological Research 105: 57–66. https://doi.org/10.1017/s0953756200003208
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the United States of America 109: 6241–6246. https://doi.org/10.1073/pnas.1117018109
  • Scholler M, Abbasi M, Friedrich F (2014) Tranzschelia in the Americas revisited: two new species and notes on the Tranzschelia thalictri complex. Mycologia 106: 448–455. https://doi.org/10.3852/12-260
  • Sinclair WA, Lyon HH (2005) Diseases of Trees and Shrubs (2nd edn). Cornell University Press, Ithaca, 680 pp.
  • Vialle A, Feau N, Frey P, Bernier L, Hamelin RC (2013) Phylogenetic species recognition reveals host-specific lineages among poplar rust fungi. Molecular Phylogenetics and Evolution 66: 628–644. https://doi.org/10.1016/j.ympev.2012.10.021
  • Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
  • Vogler DR, Maloney PE, Burt T, Snelling J (2017) First Report of the White Pine Blister Rust Fungus, Cronartium ribicola, infecting Pinus flexilis on Pine Mountain, Humboldt National Forest, Elko County, Northeastern Nevada. Plant Disease 101: 839. https://doi.org/10.1094/PDIS-10-16-1502-PDN
  • Wróblewski A (1913) Przyczynek do znajomosci grzybów Pokucia. Czesc I. [Contribution à la connaissance des champignons de Pokucie. Premiére partie]. Sprawozdanie Komisji Fizjograficznej Akademia Umijętności Krakowie 47: 147–178.
  • Yun HY, Minnis AM, Kim YH, Castlebury LA, Aime MC (2011) The rust genus Frommeella revisited: a later synonym of Phragmidium after all. Mycologia 103: 1451–1463. https://doi.org/10.3852/11-120