Research Article |
Corresponding author: Leho Tedersoo ( leho.tedersoo@ut.ee ) Academic editor: Thorsten Lumbsch
© 2015 Leho Tedersoo, Sten Anslan, Mohammad Bahram, Sergei Põlme, Taavi Riit, Ingrid Liiv, Urmas Kõljalg, Veljo Kisand, Henrik Nilsson, Falk Hildebrand, Peer Bork, Kessy Abarenkov.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Tedersoo L, Anslan S, Bahram M, Põlme S, Riit T, Liiv I, Kõljalg U, Kisand V, Nilsson RH, Hildebrand F, Bork P, Abarenkov K (2015) Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys 10: 1-43. https://doi.org/10.3897/mycokeys.10.4852
|
Rapid development of high-throughput (HTS) molecular identification methods has revolutionized our knowledge about taxonomic diversity and ecology of fungi. However, PCR-based methods exhibit multiple technical shortcomings that may bias our understanding of the fungal kingdom. This study was initiated to quantify potential biases in fungal community ecology by comparing the relative performance of amplicon-free shotgun metagenomics and amplicons of nine primer pairs over seven nuclear ribosomal DNA (rDNA) regions often used in metabarcoding analyses. The internal transcribed spacer (ITS) barcodes ITS1 and ITS2 provided greater taxonomic and functional resolution and richness of operational taxonomic units (OTUs) at the 97% similarity threshold compared to barcodes located within the ribosomal small subunit (SSU) and large subunit (LSU) genes. All barcode-primer pair combinations provided consistent results in ranking taxonomic richness and recovering the importance of floristic variables in driving fungal community composition in soils of Papua New Guinea. The choice of forward primer explained up to 2.0% of the variation in OTU-level analysis of the ITS1 and ITS2 barcode data sets. Across the whole data set, barcode-primer pair combination explained 37.6–38.1% of the variation, which surpassed any environmental signal. Overall, the metagenomics data set recovered a similar taxonomic overview, but resulted in much lower fungal rDNA sequencing depth, inability to infer OTUs, and high uncertainty in identification. We recommend the use of ITS2 or the whole ITS region for metabarcoding and we advocate careful choice of primer pairs in consideration of the relative proportion of fungal DNA and expected dominant groups.
High-throughput sequencing, internal transcribed spacer (ITS), nuclear large subunit (LSU), nuclear small subunit (SSU), Illumina MiSeq sequencing, shotgun metagenomics, primer bias, taxonomic coverage, identification bias
Fungi are one of the most diverse kingdoms of life on Earth (
The internal transcribed spacer (ITS) region of the nuclear ribosomal DNA (rDNA) is the formal barcode for molecular identification of fungi (
Discussion related to potential taxonomic biases in relation to the class Archaeorhizomycetes due to the choice of primers in our global soil analysis (
Between 5 and 30 November 2011, 34 composite soil samples were collected from woody plant-dominated ecosystems in Papua New Guinea (PNG) following a standard protocol (
To address barcode and primer biases, we selected seven barcodes in SSU (variable domains V4 and V5), ITS (ITS1 and ITS2), and LSU (variable domains D1, D2, and D3) of the nuclear rDNA (Figure
A reverse or forward primer for each barcode was supplemented with one of the sixteen 10-base identifier tags (Table
Primers and identifier tags used for Illumina MiSeq sequencing in this study.
Primer name | Features | Primer sequence | barcode | Reference |
---|---|---|---|---|
SSU515Fngs | Fwd, tagged | GCCAGCAGCCGCGGTAA | SSU V4 | This study |
Euk742R | Rev | AAATCCAAGAATTTCACCTCT | SSU V4 | This study |
SSU817F | Fwd | TTAGCATGGAATAATRRAATAGGA | SSU V5 |
|
S1196Rngs | Rev, tagged | TCTGGACCTGGTGAGTTT | SSU V5 | This study |
ITS1Fngs | Fwd, tagged | GGTCATTTAGAGGAAGTAA | ITS1 (combination 1) | This study |
ITS1ngs | Fwd, tagged | TCCGTAGGTGAACCTGC | ITS1 (combination 2) | This study |
ITS2 | Rev | GCTGCGTTCTTCATCGATGC | ITS1 (combinations 1,2) |
|
ITS3tagmix1 |
Fwd | CTAGACTCGTCATCGATGAAGAACGCAG | ITS2 (combination 1) |
|
ITS3tagmix2 |
Fwd | CTAGACTCGTCAACGATGAAGAACGCAG | ITS2 (combination 1) |
|
ITS3tagmix3 |
Fwd | CTAGACTCGTCACCGATGAAGAACGCAG | ITS2 (combination 1) |
|
ITS3tagmix4 |
Fwd | CTAGACTCGTCATCGATGAAGAACGTAG | ITS2 (combination 1) |
|
ITS3tagmix5 |
Fwd | CTAGACTCGTCATCGATGAAGAACGTGG | ITS2 (combination 1) |
|
gITS7 | Fwd | GTGARTCATCGARTCTTTG | ITS2 (combination 2) |
|
ITS4ngs | Rev, tagged | TTCCTSCGCTTATTGATATGC | ITS2 (combinations 1,2) |
|
LR0Rngs | Fwd, tagged | ACSCGCTGAACTTAAGC | LSU D1 | This study |
LF402 | Rev | TTCCCTTTYARCAATTTCAC | LSU D1 | This study |
LF402Fmix1 | Fwd | GTGAAATTGYTRAAAGGGAA | LSU D2 | This study |
LF402Fmix3 | Fwd | GTGAAATTGTCAAAAGGGAA | LSU D2 | This study |
TW13 | Rev, tagged | GGTCCGTGTTTCAAGACG | LSU D2 | T.J. White unpublished |
LR3R | Fwd | GTCTTGAAACACGGACC | LSU D3 |
|
LR5 | Rev, tagged | TCCTGAGGGAAACTTCG | LSU D3 |
|
Tag 001 | Tag | ACGAGTGCGT | All |
|
Tag 002 | Tag | ACGCTCGACA | All |
|
Tag 003 | Tag | AGACGCACTC | All |
|
Tag 026 | Tag | ACATACGCGT | All |
|
Tag 028 | Tag | ACTACTATGT | All |
|
Tag 029 | Tag | ACTGTACAGT | All |
|
Tag 030 | Tag | AGACTATACT | All |
|
Tag 032 | Tag | AGTACGCTAT | All |
|
Tag 033 | Tag | ATAGAGTACT | All |
|
Tag 049 | Tag | ACGCGATCGA | All |
|
Tag 050 | Tag | ACTAGCAGTA | All |
|
Tag 052 | Tag | AGTATACATA | All |
|
Tag 053 | Tag | AGTCGAGAGA | All |
|
Tag 054 | Tag | AGTGCTACGA | All |
|
Tag 077 | Tag | ACGACAGCTC | All |
|
Tag 078 | Tag | ACGTCTCATC | All |
|
Selected soil samples (Suppl. material
We amplified DNA from two soil samples (G2655 and G2658 that were spiked with A. finlayi and A. borealis DNA) using the ITSOF and LR7 primers (
Paired-end sequencing (2×300 bp) in the Illumina MiSeq sequencer resulted in 12,771,565 reads. LSU and SSU amplicons were paired, quality filtered, and demultiplexed using the LOTUS pipeline (
The ITS reads were quality filtered using MOTHUR 1.33.3 (
Following exclusion of singletons from all HTS data sets (cf.
Because of differential taxonomic resolution among the barcodes, we used the taxonomic assignments of both NBC and BLASTn searches to complement each other as both methods alone provided no assignment for ca 40% of OTUs due to poor representation of fungal data in SILVA, obvious misidentifications in INSDc, and great abundance of taxonomically unassigned sequence data (resulting in poor resolution using NBC). To optimize classification, we therefore combined and verified results of different methods and determined approximate E-value and sequence similarity thresholds for robust identification to phylum or class level for each barcode. For the SSU barcodes, we determined that sequences with a BLASTn E-value <e-80 and >90% similarity to verified fungal sequences could be reliably assigned to the fungal kingdom. Sequence similarities at or greater than 95% served to provide class-level assignments. Taxa with short introns in the SSU V5 barcode (primers pair SSU817F-SSU1196Rngs) such as some members of Pezizomycotina and Agaricomycetes exhibited more variation, and these groups were therefore manually evaluated for class-level affinity. For ITS1, ITS2, and LSU D2 (primers LF402Fmix-TW13), we determined that BLASTn E-values <e-50 and sequence similarity >75% over >70% sequence length allowed robust assignment to the fungal kingdom. For individual classes, we relied on an 80% sequence similarity threshold, except the early diverging lineages, Archaeorhizomycetes, and Cantharellales, where we used 75% sequence similarity. For the LSU D1 barcode (LR0Rngs-LF402 primers), BLASTn E-values <e-80 and sequence similarity above 80% were sufficient to consider sequences to be fungal, whereas similarity >85% was indicative of class-level affiliation. For the D3 barcode of LSU (LR3R-LR5 primer pair), BLASTn E-value <e-100 and sequence similarity >85% to fungi was strongly suggestive of fungal origin, and sequence similarity >90% allowed placement to classes. Many Leotiomycetes and Eurotiomycetes possessed introns close to the LR5 primer site, which allowed identification of these groups at >80% similarity level. For all barcodes, phylogenetic placement of BLASTn matches and NBC were highly concordant, except several instances in Glomeromycota, Microbotryomycetes, and Tremellomycetes. For these groups, we relied on the 10 best BLASTn matches.
We followed the taxonomy of INSDc, except raising several early diverging lineages to phylum rank (cf.
For the shotgun metagenome data, samples were demultiplexed, and LSU and SSU regions of all organisms were extracted using SORTMERNA (
To understand potential amplification biases related to sequence length in the ITS1 and ITS2 barcodes, we downloaded all ITS sequences of the 16 most common fungal classes (based on our amplicon data) from UNITE 7.0beta data set. Ribosomal RNA genes flanking the ITS1 and ITS2 barcodes were trimmed using ITSx 1.0.9. Average and median values and standard deviations were calculated for each group.
For OTU-based statistical analyses, we removed all non-fungal sequences and rarefied all amplicon samples to a depth of 8609 sequences using MOTHUR. This depth represents the median number of sequences of the ITS1 (ITS1ngs-ITS2 primers) barcode that was the second lowest among all markers (Table
Number of sequences recovered using different barcode-primer pair combinations.
Primer pair | Raw sequences | Quality-filtered sequences | Fungal sequences | % fungal sequences | Data set connectance |
---|---|---|---|---|---|
SSU515Fngs-Euk742R | 2156146 | 1751042 | 1177111 | 67.2 | 0.264 |
SSU817F-SSU1196Rngs | 1583096 | 1431850 | 1382433 | 96.5 | 0.340 |
ITS1Fngs-ITS2 | 1104540 | 697900 | 634098 | 90.9 | 0.128 |
ITS1ngs-ITS2 | 1025094 | 451500 | 327397 | 72.5 | 0.128 |
ITS3tagmix-ITS4ngs | 2665289 | 1943355 | 1706010 | 87.8 | 0.065 |
gITS7-ITS4ngs | 1293599 | 1005751 | 923170 | 91.8 | 0.062 |
LR0Rngs-LF402 | 1001017 | 743637 | 742973 | 99.9 | 0.201 |
LF402Fmix-TW13 | 101161 | 84282 | 64661 | 76.7 | nd |
LR3R-LR5 | 761164 | 567222 | 384357 | 67.8 | 0.359 |
OTU accumulation curves and their 95% confidence intervals were computed for ITS1 and ITS2 barcodes using ESTIMATES 9.1.0 (
Differences in OTU richness among samples and barcode-primer combinations were evaluated based on two-way main-effect ANOVAs supplemented with Unequal n HSD tests for multi-level comparisons. To address the relative performance of the eight barcode-primer pair combinations in recovering the role of spatial, edaphic, floristic, and climatic predictors on fungal community composition, we performed multivariate permutational ANOVAs as implemented in the ADONIS routine of the vegan package of R (R Core Development Team 2013). Geographical coordinates were translated into Principal Coordinates of Neighbouring Matrices (PCNM) vectors with soil element concentrations being logarithm-transformed prior to analyses. All four categories of variables were included in separate matrices for these analyses following
To further test changes in phylogenetic community structure among samples and barcode-primer combinations, we assigned the OTUs to fungal classes. Sequence number-based proportions of classes were log-ratio transformed in relation to the proportion of non-Agaricomycetes and unassigned fungi to ensure statistical independence of these groups. The proportion of EcM and arbuscular mycorrhizal (AM) to non-mycorrhizal sequences was similarly log-ratio transformed but only analyzed for the four ITS data sets. Using the Hellinger distance and Bray-Curtis distance, the effects of barcode-primer pair combination were analyzed using ADONIS. Global Nonmetric Multidimensional Scaling (GNMDS) graphs were drawn in parallel using the same options. 95% confidence ellipses were calculated using ORDISURF routine in the Vegan package of R.
Potential analytical biases in the recovery of fungal classes by ribosomal DNA region (SSU, ITS, and LSU) and analysis method (metagenomics and amplicon) were addressed based on the average values of 14 shared samples using two-way main-effect ANOVAs neglecting interactions. rDNA region-based biases in amplicon and metagenomics data sets were further tested using two-way ANOVAs including the samples and regions as fixed factors.
To understand possible amplification biases related to sequence length in the ITS1 and ITS2 barcodes, we downloaded all ITS sequences of the 16 most common fungal classes from UNITE 7.0beta. Ribosomal RNA genes flanking the ITS1 and ITS2 barcodes were trimmed using ITSx 1.0.9. Average and median values and standard deviations were calculated for each group for illustrative purpose.
Although combinations of samples and primer pairs were normalized separately, sequences assigned to each primer pair were differentially represented in the raw and final data sets (Table
Barcodes generated by the universal primer pairs SSU515Fngs-Euk742R (SSU V4) and LR3R-LR5 (LSU D3) exhibited the distinctly lowest proportion of fungal sequences (67–68%), suggesting that fungi account for roughly two thirds of eukaryote ribosomal DNA in the studied soils on average. The proportion of fungal sequences was the greatest for the primer pair LR0Rngs-LF402, reaching 99.9% of all sequences. Classifications based on both BLASTn searches and NBC individually assigned >90% of the reads to fungi, indicating that this primer pair could indeed be the most fungus-specific of those tested. Of fungal classes, Agaricomycetes was the dominant group in all data sets.
The barcode-primer combinations exhibited five-fold differences in the number of fungal OTUs recovered in total and on the basis of samples rarefied to 8906 sequences (Figure
Correlation matrix of eight barcode-primer combinations in recovering OTUs per sample rarefied to 8609 sequences. Values denote Pearson correlation coefficients. Values <0.44 are statistically not significant at 95% confidence level.
Median | SSU515Fngs-Euk742R | SSU817F-SSU1196Rngs | ITS1Fngs-ITS2 | ITS1ngs-ITS2 | ITS3tagmix-ITS4ngs | gITS7-ITS4ngs | LR0Rngs-LF402 | |
SSU515Fngs-Euk742R | 0.82 | |||||||
SSU817F-SSU1196Rngs | 0.81 | 0.88 | ||||||
ITS1Fngs-ITS2 | 0.75 | 0.41 | 0.43 | |||||
ITS1ngs-ITS2 | 0.81 | 0.41 | 0.49 | 0.83 | ||||
ITS3tagmix-ITS4ngs | 0.85 | 0.71 | 0.69 | 0.69 | 0.67 | |||
gITS7-ITS4ngs | 0.82 | 0.66 | 0.69 | 0.70 | 0.63 | 0.96 | ||
LR0Rngs-LF402 | 0.90 | 0.93 | 0.87 | 0.48 | 0.50 | 0.81 | 0.77 | |
LR3R-LR5 | 0.82 | 0.84 | 0.81 | 0.44 | 0.55 | 0.71 | 0.64 | 0.85 |
Across all samples, barcode-primer pair correlations were strongly correlated in recovering the relative abundance of fungal classes (Table
Pearson correlations among barcode-primer pair combinations and the soil metagenome in recovering the relative abundance of fungal classes. All correlations are statistically highly significant (P<0.001).
SSU515Fngs-Euk742r | SSU817F-SSU1196Rngs | ITS1Fngs-ITS2 | ITS1ngs-ITS2 | ITS3tagmix-ITS4ngs | gITS7-ITS4ngs | LR0Rngs-LF402 | LF402F-TW13 | LR3R-LR5 | Median amplicon | |
---|---|---|---|---|---|---|---|---|---|---|
SSU817F-SSU1196Rngs | 0.82 | |||||||||
ITS1Fngs-ITS2 | 0.89 | 0.80 | ||||||||
ITS1Fngs-ITS2 | 0.89 | 0.74 | 0.97 | |||||||
ITS3tagmix-ITS4ngs | 0.88 | 0.76 | 0.92 | 0.90 | ||||||
gITS7-ITS4ngs | 0.87 | 0.74 | 0.92 | 0.91 | 0.98 | |||||
LR0Rngs-LF402 | 0.87 | 0.75 | 0.90 | 0.89 | 0.91 | 0.90 | ||||
LF402F-TW13 | 0.87 | 0.72 | 0.88 | 0.88 | 0.85 | 0.84 | 0.89 | |||
LR3R-LR5 | 0.82 | 0.79 | 0.79 | 0.75 | 0.72 | 0.71 | 0.79 | 0.79 | ||
Median amplicon | 0.92 | 0.80 | 0.96 | 0.95 | 0.98 | 0.97 | 0.95 | 0.91 | 0.79 | |
Metagenome | 0.83 | 0.77 | 0.85 | 0.84 | 0.82 | 0.80 | 0.86 | 0.85 | 0.76 | 0.87 |
Ecological analyses using all barcodes consistently revealed that vegetation structure was the strongest predictor of fungal communities (Table
Relationship between connectance and adjusted coefficient of determination (R2adj) for floristic variables across different barcode-primer pair combinations based on (a) Bray-Curtis distance and (b) Hellinger distance. Pointed line indicates correlation in the ITS1Fngs-ITS2 data set (filled circles), covering eight connectance classes (C<0.45). Open circles, other ITS1 and ITS2 primer pairs; triangles, SSU barcodes; rectangles, LSU barcodes.
Effects of environmental parameters on community composition of fungi as revealed by eight rDNA barcode-primer pair combinations and two distance measures.
Bray-Curtis dissimilarity | Hellinger distance | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
DF | Sum of Squares | F-value | R2adj | P-value | DF | Sum of Squares | F-value | R2adj | P-value | |
SSU515Fngs-Euk742R | ||||||||||
Vegetation | 6 | 2.401 | 1.659 | 0.145 | 0.003 | 6 | 2.049 | 2.131 | 0.197 | 0.001 |
Climate | 3 | 1.011 | 1.397 | 0.028 | 0.079 | 3 | 0.592 | 1.231 | -0.015 | 0.127 |
Soil | 5 | 1.071 | 0.888 | -0.068 | 0.714 | 5 | 0.995 | 1.241 | -0.026 | 0.075 |
Spatial vectors | 1 | 0.104 | 0.430 | -0.029 | 0.988 | 1 | 0.122 | 0.761 | -0.020 | 0.811 |
Residuals | 8 | 1.930 | 0.296 | 8 | 1.282 | 0.254 | ||||
SSU817F-SSU1196Rngs | ||||||||||
Vegetation | 6 | 2.139 | 2.161 | 0.245 | 0.001 | 6 | 1.369 | 2.666 | 0.264 | 0.001 |
Climate | 3 | 0.737 | 1.490 | 0.025 | 0.115 | 3 | 0.355 | 1.383 | -0.014 | 0.085 |
Soil | 5 | 0.605 | 0.733 | -0.118 | 0.837 | 5 | 0.507 | 1.184 | -0.062 | 0.212 |
Spatial vectors | 1 | 0.039 | 0.234 | -0.037 | 0.991 | 0 | n.a. | n.a. | n.a. | n.a. |
Residuals | 8 | 1.320 | 0.273 | 9 | 0.771 | 0.257 | ||||
ITS1Fngs-ITS2 | ||||||||||
Vegetation | 6 | 3.682 | 1.596 | 0.113 | 0.002 | 6 | 3.796 | 2.087 | 0.177 | 0.001 |
Soil | 5 | 2.139 | 1.113 | -0.017 | 0.146 | 5 | 1.870 | 1.234 | -0.025 | 0.038 |
Climate | 3 | 1.283 | 1.112 | -0.009 | 0.201 | 3 | 1.155 | 1.269 | -0.010 | 0.055 |
Spatial vectors | 2 | 0.810 | 1.053 | -0.011 | 0.349 | 2 | 0.670 | 1.105 | -0.017 | 0.247 |
Residuals | 8 | 3.153 | 0.285 | 8 | 2.425 | 0.245 | ||||
ITS1ngs-ITS2 | ||||||||||
Vegetation | 6 | 3.682 | 1.549 | 0.113 | 0.001 | 6 | 3.998 | 2.069 | 0.187 | 0.001 |
Soil | 5 | 2.139 | 1.080 | -0.017 | 0.241 | 5 | 1.919 | 1.192 | -0.027 | 0.086 |
Climate | 3 | 1.283 | 1.079 | -0.009 | 0.286 | 3 | 1.166 | 1.207 | -0.013 | 0.104 |
Spatial vectors | 3 | 1.112 | 0.935 | -0.027 | 0.731 | 3 | 0.917 | 0.949 | -0.041 | 0.612 |
Residuals | 7 | 2.773 | 0.252 | 7 | 2.254 | 0.220 | ||||
ITS3tagmix-ITS4ngs | ||||||||||
Vegetation | 6 | 3.7079 | 1.723 | 0.129 | 0.001 | 6 | 3.743 | 2.069 | 0.179 | 0.001 |
Soil | 5 | 2.0253 | 1.129 | -0.024 | 0.102 | 5 | 1.820 | 1.207 | -0.027 | 0.058 |
Climate | 3 | 1.3506 | 1.255 | 0.001 | 0.023 | 3 | 1.166 | 1.289 | -0.006 | 0.027 |
Spatial vectors | 3 | 1.1044 | 1.026 | -0.025 | 0.398 | 3 | 0.895 | 0.989 | -0.038 | 0.498 |
Residuals | 7 | 2.5107 | 0.235 | 7 | 2.111 | 0.217 | ||||
gITS7-ITS4ngs | ||||||||||
Vegetation | 6 | 3.806 | 1.726 | 0.136 | 0.001 | 6 | 3.921 | 2.178 | 0.192 | 0.001 |
Soil | 5 | 2.0525 | 1.117 | -0.023 | 0.154 | 5 | 1.864 | 1.243 | -0.027 | 0.037 |
Climate | 3 | 1.3146 | 1.193 | -0.004 | 0.088 | 3 | 1.185 | 1.316 | -0.007 | 0.037 |
Spatial vectors | 1 | 0.3236 | 0.881 | -0.012 | 0.721 | 1 | 0.282 | 0.940 | -0.014 | 0.545 |
Residuals | 9 | 3.3071 | 0.306 | 9 | 2.701 | 0.271 | ||||
LR0Rngs-LF402 | ||||||||||
Vegetation | 6 | 3.254 | 1.897 | 0.160 | 0.001 | 6 | 2.869 | 2.259 | 0.212 | 0.001 |
Soil | 5 | 1.792 | 1.253 | -0.006 | 0.049 | 5 | 1.357 | 1.282 | -0.019 | 0.034 |
Climate | 3 | 0.983 | 1.146 | -0.015 | 0.198 | 3 | 0.730 | 1.150 | -0.024 | 0.208 |
Spatial vectors | 3 | 0.768 | 0.895 | -0.043 | 0.741 | 3 | 0.578 | 0.911 | -0.049 | 0.704 |
Residuals | 7 | 2.001 | 0.227 | 7 | 1.482 | 0.211 | ||||
LR3R-LR5 | ||||||||||
Vegetation | 6 | 2.328 | 2.309 | 0.231 | 0.001 | 6 | 1.408 | 2.339 | 0.214 | 0.001 |
Soil | 5 | 0.821 | 0.977 | -0.083 | 0.529 | 5 | 0.618 | 1.232 | -0.043 | 0.1 |
Climate | 3 | 0.582 | 1.154 | -0.026 | 0.248 | 3 | 0.359 | 1.194 | -0.027 | 0.171 |
Spatial vectors | 1 | 0.316 | 1.878 | 0.016 | 0.035 | 1 | 0.175 | 1.743 | 0.009 | 0.027 |
Residuals | 8 | 1.345 | 0.249 | 8 | 0.802 | 0.239 |
In the ITS1 barcode data set, the choice of primers (ITS1Fngs vs. ITS1ngs) explained 2.0% and 1.8% of the community variation based on Hellinger distance (partial analysis: F1,33=3.12; P<0.001) and Bray-Curtis dissimilarity (F1,33=3.12; P<0.001), respectively. This amount of variation was marginal compared to the effects of vegetation (16.0–20.0%) and edaphic parameters (5.5–6.4%) but comparable to climatic effects (2.8–3.8%). In the ITS2 barcode data set, the primer pair (ITS3tagmix vs gITS7) accounted for <1% variation in fungal community composition based on both distance measures (P<0.001); this was negligible compared to the effects of vegetation (19.6–22.2%), spatial vectors (5.5–6.9%), soil variables (5.6–5.8%), and climatic predictors (3.3–3.4%). The class-level analysis of all nine barcode-primer pair combinations revealed that primer pair was the strongest overall predictor, explaining 38.1% of the community variation (partial analysis: F8,182=38.3; P<0.001; Figure
Global Nonmetric Multidimensional Scaling (NMDS) graph demonstrating the relative placement of samples (lower case letters, encoded in Suppl. material
Of the 290,779,313 high-quality metagenome sequences from the PNG soil samples, 1,309,342 (0.45%) were assigned to ribosomal DNA of prokaryotic and eukaryotic organisms. Bacterial sequences and eukaryote sequences unassigned to any kingdom dominated the rDNA subset. Only 16,833 (1.29%) of these sequences were determined to represent fungal nuclear rDNA. Across all samples and regions, Agaricomycetes (41.4%), Eurotiomycetes (10.4%), and Dothideomycetes (5.5%) dominated, whereas 13.2% sequences could not be assigned to any fungal class (Suppl. material
Within the soil metagenome, there were substantial differences in the recovery of fungal classes based on SSU, ITS, and LSU (Figure
Relative abundance of fungal classes in the amplicon and metagenomics data sets divided into SSU, ITS, and LSU subsets averaged over different barcodes (amplicon data) and 14 shared samples. Asterisks in the margins indicate significant differences in recovery of classes among SSU, ITS, and LSU of metagenomics (right) and amplicon (left) data sets. Asterisks in the center indicate significant differences between the metagenomics and amplicon-bases approaches.
Metagenomic analysis of the mock community enabled us to estimate class-level biases in identification of fungi. While other groups were roughly evenly represented, Archaeorhizomyces spp. accounted for 17.0%, 5.1%, and 10.1% of metagenomics sequences in the SSU, ITS, and LSU data subsets, respectively, which is consistent with trends in the metagenomics and amplicon data sets of soil samples. Across all three markers, 6.2% and 2.4% of sequences respectively belonged to the unknown category or were affiliated with classes that were not included in the mock community (Suppl. material
In-depth analysis of primer mismatches to fungal templates revealed potential systematic biases inherent to different primer pairs (Appendix
Fungal taxa differed roughly three-fold in the length of the ITS1 and ITS2 barcodes (Figure
Differences in sequence length in the ITS1 and ITS2 barcodes of 16 most abundant fungal classes as revealed based on amplicon libraries in this study. Columns, asterisks, and error bars represent mean and median values and standard deviation, respectively. Numbers inside bars indicate the number of sequences analyzed (n). Taxa are ordered by average length of the ITS1 region.
Our analyses of seven barcodes indicate that markers differ substantially in their ability to recover OTUs at the 97% sequence similarity threshold, a threshold value that is almost universally used in HTS studies. Consistent with the lower species-level discrimination power of SSU and LSU compared with ITS (
In spite of the low taxonomic resolution of SSU and LSU, these barcodes were relatively more efficient in recovering trends in community composition in terms of greater proportion of variance explained. There are two alternative and perhaps additive explanations to this observation. First, phylogenetic niche conservatism among fungi may reinforce this pattern (
Although all barcode-primer pair combinations revealed that floristic variables account for the strongest effects in fungal community composition, there were statistically significant primer biases that were not reported in previous studies (
Currently, the Illumina HiSeq technology enables generation of 4×108 DNA sequences per run. In our soil samples, fungal nuclear rDNA represented ca. 0.005% of all DNA molecules, resulting in an average sequencing depth of approx. 1000 sequences per sample (n=16). In spite of relatively even representation of all metagenomics sequences across samples, the coefficient of variation for the number of fungal sequences was roughly three times higher for metagenome samples compared with amplicons. Such uneven sequencing depth further complicates downstream statistical analyses.
PCR and primer biases in the amplicon data sets are well addressed, but there are also certain biases inherent to metagenomics approaches that are related to base composition and replication of DNA fragments (Gomez-Alvarez et al. 2009). Because the metagenomics sequences exhibit very low overlap across the rDNA, it is impossible to assign these sequences to OTUs and recover taxonomic richness (cf.
Except for some minor but statistically significant taxonomic biases, the metagenomics data set covering SSU, ITS, and LSU provided highly comparable results to that of all barcodes taken together but especially to the results from ITS1 and ITS2. The metagenomics analyses confirmed that the Agaricomycetes, Eurotiomycetes, and Sordariomycetes are the key players in tropical soils of PNG. Furthermore, the ITS data set of both amplicons and metagenome exhibited a similar proportion of mycorrhizal fungi (
Given the low and uneven recovery of fungal rDNA sequences and difficulties in correct taxonomic assignment (see below), metagenomics with the sole purpose of metabarcoding is clearly a waste of financial and computational resources. Enrichment of targeted molecules such as mitochondrial DNA may improve the problems associated with insufficient sequencing depth (
Our in silico analysis of primer mismatches extends the results of
The technical biases of sample preparation steps are poorly understood and these may be largely specific to platforms, models, and chemistry. Nonetheless, depending on the base composition and size of DNA fragments, unequal competition for adaptors may occur (
In addition to PCR and primer biases inherent to amplicon-based analyses, a bias related to incompleteness of reference database and uncertainty of taxonomic assignment is common to both amplicon and metagenomics data sets. A part of this so-called “identification bias” results from differential quality and abundance of reference data that may affect the probability of identification of particular taxa (
Differential representation of taxa in the reference data sets certainly plays a much greater role in metagenomics data sets targeting all genes (
This study demonstrates that PCR-free metagenomics and amplicon-based approaches perform in a comparable fashion in recovering major fungal classes in spite of certain statistical differences. Within the amplicon data set, barcode-primer pair combinations differed strongly in recovering relative abundance of fungal classes and OTU richness (see also
We acknowledge C.W. Schadt and A. Rosling for raising communication about primer biases regarding Archaeorhizomycetes in HTS data sets. We thank A. Rosling for providing cultures of Archaeorhizomyces borealis and A. finlayi. We are grateful to T.M. Porter and H.T. Lumbsch for constructive editorial comments. This study received funding from Estonian Science Foundation (grants 9286, PUT0171, IUT20-30), EMP265, and FIBIR. We thank P.A. Kivistik for Illumina MiSeq and HiSeq analyses in the Estonian Genome Center.
Sequences of widely used ITS primers, their mismatches to fungal taxa, and recommendations for metabarcoding studies.
Primers and taxa | Sequences and mismatches |
---|---|
I. ITS primers | |
ITS1F (original: |
CTTGGTCATTTAGAGGAAGTAA |
ITSOF-T ( |
AACTTGGTCATTTAGAGGAAGT |
ITSOF ( |
ACTTGGTCATTTAGAGGAAGT |
ITS1Fngs (this study) | GGTCATTTAGAGGAAGTAA |
Tulasnellaceae p.parte | ****C**C***************C |
Cantharellus p.parte | ****G***T*************** |
Eurotiomycetes, Dothideomycetes, Sordariomycetes p.parte | ****C******************* |
Trichocomaceae p.parte | ***CC******************* |
Dothideomycetes p.parte | *******************T**** |
Dothioraceae | ****CC****************** |
Botryosphaeriaceae | ****AC****************** |
Psoraceae | **********C************* |
Valsaceae, Entomophthoromycotina | ******A***************** |
Chytridiomycota, Magnaporthales, Suillus, Paraglomerales, Mucorales, Rhizinaceae p.parte | *********G************** |
Chytridiomycota p.parte, Saccharomycetes | ********************C*** |
Mucorales | ****A**CT*************** |
Viridiplantae | *****TA**************G*G |
Metazoa | ****K*A***************W* |
ITS5 (original: |
GGAAGTAAAAGTCGTAACAAGG |
Tulasnella p.parte | ******WC************** |
Tremellomycetes, Ustilaginomycetes p.parte | *******M*****A******** |
Dothideaceae | ***T****************** |
Saccharomycetales, Chytridiomycota p.parte | ****C***************** |
Microsporidia, Entomophthoromycotina, Chytridiomycota p.parte | *******C************** |
Metazoa | ******W*************** |
Viridiplantae | *****G*G************** |
ITS1 (original: |
TCCGTAGGTGAACCTGCGG |
ITS1ngs (this study) | TCCGTAGGTGAACCTGC |
Sordariomycetes | *****T********A**** |
Microsporidia | G*W*****W********M* |
Viridiplantae, Metazoa | ******************* |
gITS7 ( |
GTGARTCATCGARTCTTTG |
fITS7 ( |
GTGARTCATCGAATCTTTG |
ITS86F ( |
GTGAATCATCGAATCTTTGAA |
Cantharellus | *C**********G******** |
Tulasnellaceae, Microsporidia | no match |
Antherospora | *********T****T****** |
Pucciniales p.parte | *********TC**GT****** |
Ophiostoma | *C**RY*************** |
Eurotiales p.parte | ************G******** |
Cordyceps | **A**CT***********A** |
Dipodascus | **********-********** |
Leptosphaeria | **************T****** |
Pichia | ************G*TC***** |
Candida | *********T-***T****** |
Neocallismatigales | **********A******C*** |
Lobulomycetales | *********TA********** |
Acaulospora, Glomus intraradices | **********A********** |
Gigaspora | **********A***T****** |
Cokeromyces, Rhizopus | ************G******** |
Entomophthorales | ************G*T****** |
Angiospermae | *Y***Y******G******** |
Gymnospermae | ************G*T****** |
Metazoa p.parte | A*T*A***CA*********** |
Metazoa p.parte | ****A*TGCA*G*CACA*K** |
Straminipila | ****R*****R*RWY****** |
ITS3 (original: |
GCATCGATGAAGAACGCAGC |
58A1F ( |
GCATCGATGAAGAACGC |
58A2F ( |
ATCGATGAAGAACGCAG |
ITS3-Kyo1 ( |
AHCGATGAAGAACRYAG |
ITS3-Kyo3 ( |
GATGAAGAACGYAGYRAA |
ITS3mix ( |
CANCGATGAAGAACGYRG |
Cantharellus | *******************Y*W* |
Tulasnellaceae | no match |
Mycenaceae | CY********************* |
Amanita p.parte, Antrodia | ***************R******* |
Gomphales | ************R****C***** |
Sebacinales p.parte | ***C******************* |
Tremellales, Yarrowia | A********************** |
Pucciniomycetes p.parte | AY*************A***T*** |
Puccinia | R**C***********R******* |
Tilletiales | C********************** |
Ophiocordyceps | ****TA**A************** |
Onygenales | A********************** |
Dothideomycetes p.parte | ***A******************* |
Sordariomycetes p.parte | ***A******************* |
Sordariales p.parte | ******************G**** |
Pezizaceae p.parte | *******************T*** |
Saccharomycetales p.parte | *************G********* |
Candida p.parte | *T**************T****** |
Thecaphora, Thysanophora | *T********************* |
Glomeraceae p.parte | ****************T****** |
Glomeraceae p.parte | ********A************** |
Mucorales p.parte | *T********************* |
Mucorales p.parte, Waitea, Microbotryum | ****************T****** |
Chytridiomycota p.parte | ***A******************* |
Neocallimastigomycota | *A********************* |
Microsporidia | *TGA*********WY*TT** |
Nuclearida, Aphelidea | ***A**************** |
Viridiplantae | ****************Y**Y |
Amoebozoa p.parte | *TRA**************** |
Amoebozoa p.parte | AT*A*********G*AT*** |
Amoebozoa p.parte | AA***********C**T*** |
Amoebozoa p.parte | **T****Y*****G*****T |
Apusozoa p.parte | *Y*A**************** |
Apusozoa p.parte | A**A*********C**TG** |
Alveolata p.parte | A**A********GR****** |
Alveolata p.parte | ***C*TN*****GG****** |
Alveolata p.parte | AT*A************T*** |
Bacillariophyta | A**A**************** |
Bryophyta | ***A**************** |
Chlorophyta p.parte | ***A**************** |
Chlorophyta p.parte | *YG*******G*****T*** |
Chlorophyta p.parte | *Y*N**************** |
Euglenozoa p.parte | ATT**T************Y* |
Euglenozoa p.parte | CAG*********G****G** |
Eustigmatophyta | A**A**************** |
Haptophyta | ***A**************** |
Marchandiophyta | ***A**************** |
Platyhelminthes | *YG**********GW***** |
Nematoda p.parte | AGN***************** |
Nematoda p.parte | GGG********R*******T |
Nematoda p.parte | RGN********R****GG** |
Nematoda p.parte | *T*********A******** |
Nematoda p.parte | TGG********A****GT** |
Insecta p.parte | GGG****************T |
Insecta p.parte | *G*******G********** |
Insecta p.parte | GGR**********C****** |
Placozoa | *T**************T*** |
Annelida | *TG**********G****** |
Mollusca | GGG**********G****** |
Cnidaria | *Y**************Y*** |
Porifera | *T*C*********G****** |
Acari p.parte | TGG*************Y**T |
Acari p.parte | AA*********A***AT**T |
Acari p.parte | AA*G*******A***RT**T |
Acari p.parte | CA**************T*** |
Ichtyes p.parte | CGC***************** |
Oomycota p.parte | A**Y*********M***T** |
Oomycota p.parte | A****************T** |
Parabasalia | ****************AC*T |
Phaeophyta | A*WA**************** |
Rapidophyta | A**W**************** |
Rhizaria p.parte | R**A**************** |
Rhizaria p.parte | ***A*************GT* |
Rhizaria p.parte | *YR*************Y*T* |
Rhodophyta | RY*W************Y*** |
Synurophyta | AY*A**************** |
ITS4 (original: |
TCCTCCGCTTATTGATATGC |
ITS4ngs ( |
TCCTSCGCTTATTGATATGC |
Chaetothyriales | ****G*************** |
Archaeorhizomycetes | *****GC************* |
Tulasnellaceae p.parte | *********G*W*A****** |
Microsporidia | ****S*Y******M****** |
Viridiplantae, Amoebozoa, Rhizaria | ******************** |
Apusozoa | *************R****** |
Alveolata p.parte | ***K*******M*T****** |
Alveolata p.parte | **T***A****A*T****** |
Alveolata p.parte | **TG*******G*T****** |
Alveolata p.parte | ***********A*A****** |
Bacillariophyta p.parte | ***********A*T****** |
Chlorophyta p.parte | ***********A******** |
Euglenozoa | *********C*R*A****** |
Eustigmatophyta | ***********G*T****** |
Haptophyta | ***********G******** |
Marchandiophyta | ***********G******** |
Rotifera | ***********K*T****** |
Platyhelminthes | ***********K******** |
Nematoda p.parte | *********W*N******** |
Nematoda p.parte | ********C**G*A****** |
Insecta p.parte | ******C**C***A****** |
Ichtyes | ***********G*A****** |
Annelida | *************A****** |
Acari | ***********A*A****** |
Mollusca | ***********Y******** |
Crustacea | *************A****** |
Cnidaria p.parte | ****G*T****G*A****** |
Cnidaria p.parte | ***********K*A****** |
Cnidaria p.parte | ********C**G******** |
Oomycota | ******************** |
Parabasalia | ***********A***G**** |
Phaeophyta | ***********G*T****** |
Rapidophyta | ***********A*T****** |
Rhizaria p.parte | *****G*******A****** |
Rhodophyta | ***W*******R*W****** |
Synurophyta | ***********G*T****** |
Nucleariida | ***********C******** |
ITS4B ( |
CAGGAGACTTGTACACGGTCCAG |
Hygrophoraceae, Corticiales | **A******************** |
Schizophyllaceae | **********A************ |
Armillaria | **********************A |
Inocybaceae, Amanitaceae | ***************Y******* |
Psathyrellaceae | **********R*******K**GA |
Amylocorticiales | **********A**********GA |
Atheliales | ***A*****************GA |
Boletales | ******R*Y*R*******K**RK |
Suillineae | *****A****A************ |
Russulales | ************G********** |
Polyporales | **A***************G*TG* |
Tomentella, Thelephora | **A**R****K******R****R |
Pseudotomentella, Phellodon, Tomentellopsis | **A*G****************** |
Hydnellum | *CA******************** |
Hymenochaetales | **A*************R****RA |
Phallomycetidae | **RRR********R****Y**RR |
Clavulina, Sistotrema | *****A**********A****** |
Ceratobasidiaceae | **A************T******* |
Sebacinales p.parte | ****GA*T**A*GTGT*****GA |
Sebacinales p.parte | ****GA***************GA |
Tremellales p.parte | **A*G*****RG*********** |
Auriculariales | **A*G****************G* |
Puccinomycetes | **AC***T*************R* |
Ustilaginomycetes | **********AGG*WT*****GW |
Dacrymycetales, Cantharellus, Tulasnella | <40% identical |
Other fungal phyla, Plantae, Metazoa | <40% identical |
LB-w ( |
CTTTTCATCTTTCCCTCACGG |
Cantharellus | TA**************TG*** |
Sistotrema | *****************G*** |
Tulasnella | *******C*********G*** |
Coniophoraceae | *******C************* |
Ustilaginomycetes | **************A****T* |
Ascomycota | *************GA****TC |
Saccharomycetes | **************W****W* |
Glomeromycota, Mucoromycota, Chytridiomycota | ********************* |
Gigasporaceae | **************A****T* |
Viridiplantae | *****************G*** |
II. LSU primers | |
LR0R ( |
ACCCGCTGAACTTAAGC |
LR0Rngs (this study) | ACSCGCTGAACTTAAGC |
Tulasnellaceae | **G*C**NR*Y****** |
Chaetothyriales | **G************** |
Archaeorhizomycetes | ***GC************ |
Microsporidia | MMMKSY**R******** |
Viridiplantae | **********T****** |
LF402Fmix1 (this study; LF402 is a reverse complement) | GTGAAATTGYTRAAAGGGAA |
LF402Fmix3 (this study) | GTGAAATTGTCAAAAGGGAA |
Most fungi | *********TTG******** |
Cantharellus | ************CG**A*** |
Tulasnellaceae p.parte | **********Y*GTR***** |
Agaricaceae, Boletaceae | *********C********** |
Ceratobasidiaceae | ***************T**** |
Cystofilobasidiaceae, Corticiaceae | ***********A******** |
Ustilaginaceae | *********CCA******** |
Schizosaccharomycetaceae | *********C****R***** |
Glomerellaceae, Verticillium, Dothideomycetes | ********A*********** |
Candida p.parte | ********A****T*CW*** |
Falcocladium | *********C*A******** |
Mucoraceae p.parte | ***********A******** |
Neocallimastigales, Chytridiomycota | **********CR******** |
Viridiplantae | T*********C*GG****** |
TW13 (original: T.J. White, unpublished) | GGTCCGTGTTTCAAGACG |
LR3 (original: |
CCGTGTTTCAAGACGGG |
Saccharomycetales p.parte | *****A************** |
Microsporidia, Viridiplantae, Metazoa | ******************** |
Dictyostelids | RR**YR*R***T****TA** |
LR5-Fung ( |
CGATCGATTTGCACGTCAGA |
Tulasnellaceae | ********Y*********** |
Cordycipitaceae p.parte | *********C********** |
Straminipila, Metazoa | ******************** |
Viridiplantae, Alveolata, Rhizaria | ***A***************T |
LR5 (original: |
TCCTGAGGGAAACTTCG |
TW14 (T.J. White et al. unpublished) | GCTATCCTGAGGGAAACTTC |
Microsporidia, Metazoa, Viridiplantae | ********************* |
Candida p.parte | ***********A********* |
Apicomplexa p.parte | **G********A**TCT**** |
Straminipila | ****************Y**** |
III. SSU primers | |
SSU515F (original: |
GTGCCAGCANCCGCGGTAA |
SSU515Fngs (this study) | GCCAGCAGCCGCGGTAA |
Saccharomycetes, Pezizomycotina p.parte (I, intron site) | *I***************** |
Archaeorhizomycetes | *********C********* |
Microsporidia | *********T********* |
Viridiplantae, Metazoa | ******************* |
Euk742R (this study) | AAATCCAAGAATTTCACCTCT |
Many fungal groups | NR******************* |
Cantharellus | TGG**ACT*G********C** |
Tulasnellaceae | GGR**ANM*R********Y** |
Baeomycetales p.parte | *****************Y*** |
Eurotiales p.parte | NR***************Y*Y* |
Harpellales | TGG*T****T********A** |
Dothideomycetes p.parte | CG*******G********C** |
Lecanorales | RW**NMN*********Y**** |
Saccharomycetales, Hypocreales | NNR**Y*************** |
Chytridiomycota, Neocallimastigomycota, Blastocladiomycota | *****Y*************** |
SSU817F (original: |
TTAGCATGGAATAATRRAATAGGA |
Cantharellus | *********G****CSG*WWC*** |
Tulasnellaceae | *************RCWN*TKGACN |
Sebacinales p.parte | *********G************** |
Gomphales | **************C********* |
Phallales | *********************R** |
Agaricostilbales p.parte | AC********************** |
Dacrymycetales p.parte | **************K********* |
Ustilaginales p.parte | **************C********* |
Pucciniales p.parte | *******************C*A** |
Coryneliales p.parte | *********************A** |
Helotiales p.parte | ************R******N*N*M |
Microascales p.parte | W Y********************** |
Pleosporales p.parte | NY***W*****************R |
Saccharomycetales p.parte | NN*T********G*CAGG*CC*YT |
Saccharomycetales p.parte | NN************C***T*--** |
Saccharomycetales p.parte | W Y************N********* |
Urocystidales | **************N****Y**** |
Ramicandelaber, Falciformispora | *********G************** |
Zoopagomycota | **************C********* |
Mucorales p.parte | *********************N** |
Entomophthoromycota | *******************K*N*W |
Chytridiomycota | *Y************Y********* |
Microsporidia, Viridiplantae | no match |
SSU1196R (original: |
TCTGGACCTGGTGAGTTTCC |
SSU1196Rngs (this study) | TCTGGACCTGGTGAGTTT |
Cantharellus | **CT**************T* |
Tulasnellaceae | **CT*T***********GT* |
Tremellales p.parte, Chytridiomycota | ************A******* |
Saccharomycetes p.parte | ***************C*GT* |
Pezizales p.parte | ***************A**T* |
Sordariales p.parte | **C*****C*********** |
Glomeromycota p.parte | ************R*****T* |
Microsporidia | NNNNNR**N***R**R*KT* |
Viridiplantae | ************A******* |
IV. Primer recommendations | |
Recommended primer mixes for the ITS1F family | |
ITS1Fngs-Mix1 (Fungi) | GGTCATTTAGAGGAAGTAA |
ITS1Fngs-Mix2 (Tulasnellaceae) | GGCCATTTAGAGGAAGTAC |
ITS1Fngs-Mix3 (Saccharomycetes) | GGTCATTTAGAGGAACTAA |
ITS1Fngs-Mix4 (various groups) | GGTCGTTTAGAGGAAGTAA |
ITS1Fngs-Mix5 (Mucorales) | GGCTATTTAGAGGAAGTAA |
Recommended primer mixes for the ITS1 family | |
ITS1ngs-Mix1 (Most eukaryotes) | TCCGTAGGTGAACCTGC__ |
ITS1ngs-Mix2 (Sordariomycetes) | TCCGTTGGTGAACCAGC__ |
Recommended ITS1 and full ITS forward primer mixes for fungi | |
ITS1Fngs (except SSU 5’ intron containing groups) | GGTCATTTAGAGGAAGTAA |
ITS1ngs (except Sordariomycetes) | TCCGTAGGTGAACCTGC |
Recommended forward primer mixes for ITS2 barcode | |
ITS3-Mix1 (Fungi) | CATCGATGAAGAACGCAG_ |
ITS3-Mix2 (Chytridiomycota) | CAACGATGAAGAACGCAG_ |
ITS3-Mix3 (Sebacinales) | CACCGATGAAGAACGCAG_ |
ITS3-Mix4 (Glomeromycota) | CATCGATGAAGAACGTAG_ |
ITS3-Mix5 (Sordariales) | CATCGATGAAGAACGTGG_ |
Recommended reverse primers for ITS2 and full ITS | |
ITS4-Mix1 (Fungi) | TCCTCCGCTTATTGATATGC |
ITS4-Mix2 (Chaetothyriales) | TCCTGCGCTTATTGATATGC |
ITS4-Mix3 (Archaeorhizomycetes) | TCCTCGCCTTATTGATATGC |
ITS4-Mix4 (Tulasnellaceae) | TCCTCCGCTGAWTAATATGC |
ITS4-Euk (all eukaryotes) | TCCTSSGCTTANTDATATGC |
Recommended LF402 mixes for fungi | |
LF402f_mix1 (Fungi) | TTCCCTTTYARCAATTTCAC |
LF402f_mix2 (Ceratobasidiaceae) | TTCCATTTCAACAATTTCAC |
LF402f_mix3 (Chytridiomycota) | TTCCCTTTTGACAATTTCAC |
LF402f_mix4 (Tulasnellaceae) | TTCCCYACCRACAATTTCAC |
LF402f_mix5 (Cantharellus) | TTCTCCGTCAACAATTTCAC |
Table S1. Characteristics of soil samples.
Data type: measurement
Explanation note: Characteristics of soil samples used in this study.
Table S2. Taxonomic composition and clustering of the mock community sample.
Data type: measurement
Explanation note: Taxonomic composition and clustering of the mock community sample.
Table S3. Data set of the SSU V4 and V5 barcodes.
Data type: data set
Explanation note: Data set of the SSU V4 and V5 barcodes.
Table S4. Data set of the ITS1 barcode.
Data type: data set
Explanation note: Data set of the ITS1 barcode.
Table S5. Data set of the ITS2 barcode.
Data type: data set
Explanation note: Data set of the ITS2 barcode.
Table S6. Data set of the LSU D1, D2, and D3 barcodes.
Data type: data set
Explanation note: Data set of the LSU D1, D2, and D3 barcodes.
Table S7. Taxonomic classification of the rDNA of fungal.
Data type: taxonomic data
Explanation note: Taxonomic classification of the rDNA of fungal shotgun metagenome.