Research Article
Print
Research Article
Two new Botryosphaeria (Botryosphaeriales, Botryosphaeriaceae) species in China
expand article infoJing-E Sun‡, Chao-Rong Meng‡, Alan J. L. Phillips§, Yong Wang‡
‡ Guizhou University, Guiyang, China
§ University of Lisbon, Campo Grande, Portugal

Corresponding author: Yong Wang ( yongwangbis@aliyun.com )

Academic editor: Huzefa Raja
© 2022 Jing-E Sun, Chao-Rong Meng, Alan J. L. Phillips, Yong Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Sun J-E, Meng C-R, Phillips AJL, Wang Y (2022) Two new Botryosphaeria (Botryosphaeriales, Botryosphaeriaceae) species in China. MycoKeys 94: 1-16. https://doi.org/10.3897/mycokeys.94.91340
Open Access

Abstract

Five ascomycetous strains were isolated from dead branches and leaves of Salix (Salicaceae) and Osmanthus fragrans (Oleaceae), respectively. BLAST searches with ITS sequences in GenBank suggested a high degree of similarity to Botryosphaeria dothidea. To accurately identify these strains, we further analysed their morphological characteristics of asci, ascospores, all conidiophore cells and conidia. Phylogenetic relationships, based on ITS, rpb2, tef1 and tub2 gene sequences, confirmed our strains represented two novel species, which are introduced here as B. salicicola and B. osmanthuse spp. nov.

Keywords

Ascomycetes, molecular analyses, morphology, new species, new woody host

Introduction

The genus Botryosphaeria (Botryosphaeriales, Botryosphaeriaceae) was established by Cesati and Notaris (1863) and is widely distributed throughout many geographical and climatic regions of the world, with the exception of polar regions (Phillips et al. 2013). Species of Botryosphaeria are reported in many woody plants as endophytes, saprobes and pathogens (Crous et al. 2006; Liu et al. 2012; Phillips et al. 2013; Ariyawansa et al. 2016; Dissanayake et al. 2016; Slippers et al. 2017). Some species of Botryosphaeria are aggressive pathogens that pose a significant threat to agricultural and forest ecosystems (Slippers and Wingfield 2007). Botryosphaeria dothidea is known to cause serious diseases, such as Apple ring rot (Slippers and Wingfield 2007; Marsberg et al. 2017). Moreover, according to the database of the common names of plant diseases in Japan, 14 species of the genus Botryosphaeria cause diseases on 30 plant species (Yukako et al. 2021).

Botryosphaeria has been considered as one of the hot topics in fungal taxonomy for a long time, based on its universality, including areas and hosts (from 1863 to 2022) (Cesati and Notaris 1863; Shoemaker 1964; Pennycook and Samuels 1985; Slippers et al. 2004; Slippers and Wingfield 2007; Liu et al. 2012; Phillips et al. 2008, 2019; Xu et al. 2015; Ariyawansa et al. 2016; Zhou et al. 2016, 2017; Li et al. 2018, 2020; Vu et al. 2019; Chen et al. 2020; Chu et al. 2021; Yukako et al. 2021). More than 300 species epithets are listed in MycoBank (https://www.mycobank.org, 17 October 2022), but only about 7% of Botryosphaeria species currently have associated DNA sequences data. In the past, species in Botryosphaeria were defined, based on morphological characters alone or on host association, but studies have shown these are inadequate characters to identify species (Shoemaker 1964; Pennycook and Samuels 1985; Slippers et al. 2004). With the advent of DNA sequencing methods, the nomenclature and identification of Botryosphaeria species have significantly improved (Phillips et al. 2013).

Some species of Botryosphaeria are aggressive pathogens in China, mainly distributed in the southwest, such as B. fabicerciana, B. fujianensis, B. fusispora, B. kuwatsukai, B. dolichospermatii, B. pseudoramosa and B. wangensis as shown in Table 4. In this study, five strains were isolated during surveys of fungi on new woody hosts (Salicaceae and Oleaceae) in Guizhou and Guangxi Provinces, China. Combining morphology and phylogenetic analyses, these isolates represent two novel Botryosphaeria species, which are described and illustrated here. The discovery of new species within this genus is important to help researchers better understand the diversity and ecology of Botryosphaeria.

Materials and methods

Sampling, fungal isolation and morphological observation

Fungi were isolated from dry branches of Salix (Salicaceae) and diseased leaf pieces of Osmanthus fragrans (Oleaceae) collected in forest parks in Guizhou and Guangxi Provinces, China, respectively. Samples were placed in envelopes and returned to the laboratory as described by Senanayake et al. (2020). Fruiting bodies (including asci, ascospores, conidiophore cells and conidia) on natural substrates were observed using a Zeiss Scope 5 compound microscope Axioscope 5 (Carl Zeiss Microscopy GmbH, Jena, Germany) with the microscope techniques of differential interference contrast light (DIC) and photographed using an AxioCam 208 colour (Carl Zeiss Microscopy GmbH, Jena, Germany) camera and saved as JPG files. Approximately 30 measurements of new species were made of each feature using the ZEN 3.0 (blue edition) (Jena, Germany) software.

Pure cultures were obtained using a single spore isolation method as described in Senanayake et al. (2020). The germinated spores were transferred to fresh potato dextrose agar (PDA) plates and incubated at 25 °C for 14 days. Type specimens were deposited in the Herbarium of the Department of Plant Pathology, Agricultural College, Guizhou University (HGUP). Ex-type cultures were deposited in the Culture Collection at the Department of Plant Pathology, Agriculture College, Guizhou University, P.R. China (GUCC). Taxonomic information of the new species was submitted to MycoBank (www.mycobank.org).

DNA extraction, PCR and sequencing

Mycelium growing on PDA for seven days was scraped off with a sterile scalpel. Total DNA was extracted with a (Biomiga#GD2416, San Diego, California, USA) BIOMIGA Fungus Genomic DNA Extraction Kit (GD2416) following the manufacturer’s protocol. Four loci (ITS, rpb2, tef1 and tub2) were amplified with the respective forward and reverse primers (Table 1). PCR cycling conditions were followed according to Yukako et al. (2021). For ITS: initial denaturation (94 °C, 5 min), 40 cycles of amplification (denaturation 94 °C, 45 s; annealing 48 °C, 30 s; and extension 72 °C, 90 s) and final extension (72 °C, 2 min); for tef1: initial denaturation (94 °C, 5 min), 40 cycles of amplification (denaturation 94 °C, 30 s; annealing 52 °C, 30 s; and extension 72 °C, 45 s) and final extension (72 °C, 2 min); for tub2: initial denaturation (94 °C, 5 min), 40 cycles of amplification (denaturation 94 °C, 30 s; annealing 52 °C, 30 s; and extension 72 °C, 60 s) and final extension (72 °C, 2 min); and for rpb2: initial denaturation (95 °C, 5 min), touch-down amplification (5 cycles of 95 °C for 45 s, 60 °C for 45 s and 72 °C for 120 s; 5 cycles of 95 °C for 45 s, 58 °C for 45 s and 72 °C for 120 s; and 30 cycles of 95 °C for 45 s, 54 °C for 45 s and 72 °C for 120 s) and final elongation at 72 °C for 8 min. PCR products were sequenced by SinoGegoMax (Beijing, China).

Table 1.
Download as
CSV
XLSX

Primers used in this study.

Used genes Primer Direction Sequence (5’–3’) Reference
tef1 EF1-688 Forward CGGTCACTTGATCTACAAGTGC Alves et al. (2008)
EF1-1251 Reverse CCTCGAACTCACCAGTACCG
ITS ITS1 Forward TCCGTAGGTGAACCTGCGG White et al. (1990)
ITS4 Reverse TCCTCCGCTTATTGATATGC
tub2 BT-2a Forward GGTAACCAAATCGGTGCTGCTTTC Glass and Donaldson (1995)
BT-2b Reverse ACCCTCAGTGTAGTGACCCTTGGC
rpb2 fRPB2-5f2 Forward GATGATAGAGATCATTTTGG Liu et al. (1999)
fRPB2-7cR Reverse CCCATAGCTTGTTTACCCAT

Phylogenetic analyses

Newly-generated sequences were deposited in GenBank. All the taxa used in the phylogenetic analyses are provided in Table 2. These sequences were compared with the GenBank database using the Basic Local Alignment Search Tool (BLAST) and available sequences of species in the genus containing ex-type or representative isolates were downloaded from GenBank and previous publications (Li et al. 2018, 2020; Vu et al. 2019; Chen et al. 2020; Chu et al. 2021; Yukako et al. 2021). Alignments for the individual locus matrices were generated with the online version of MAFFT v. 7.307 (Katoh et al. 2019). Ambiguous sequences at the start and the end were deleted and the alignments edited with MEGA6 (Tamura et al. 2013) for maximum alignment and minimum gaps. Sequence matrix v. 1.7.8 was used to concatenate the aligned sequences (Vaidya et al. 2011). Neoscytalidium dimidiatum (CBS 145.78 and CBS 251.49) and Cophinforma atrovirens (MFLUCC 11-0425 and MFLUCC 11-0655) were used as outgroup. Maximum Likelihood (ML), Maximum Parsimony (MP) and Bayesian Inference (BI) were used to place the newly-discovered strains into a phylogenetic framework and estimate phylogenetic relationships with other Botryosphaeria spp.

Table 2.
Download as
CSV
XLSX

Taxa used for molecular phylogenetic analyses and their GenBank accession numbers. (T) = ex-type strains.

Species Strain Host Country GenBank accession numbers
ITS tef1 tub2 rpb2
Botryosphaeria agaves CBS 133992T Agave sp. Thailand JX646791 JX646856 JX646841 N/A
B. agaves MFLUCC 10-0051 Agave sp. Thailand JX646790 JX646855 JX646840 N/A
B. auasmontanum CMW 25413T Pinus sp. Namibia KF766167 N/A N/A N/A
B. corticis CBS 119047T Vaccinium corymbosum USA DQ299245 EU017539 EU673107 N/A
B. corticis ATCC 22927 Vaccinium sp. USA DQ299247 EU673291 EU673108 N/A
B. dothidea CBS 115476T Prunus sp. Switzerland AY236949 AY236898 AY236927 N/A
B. dothidea CBS 110302 Vitis vinifera Portugal AY259092 AY573218 EU673106 N/A
B. fabicerciana CBS 127193T Eucalyptus sp. China HQ332197 HQ332213 KF779068 N/A
B. fabicerciana CMW 27121 Eucalyptus sp. China HQ332198 HQ332214 KF779069 N/A
B. fujianensis CGMCC 3.19099T Vaccinium uliginosum China MH491973 MH491977 MH562330 N/A
B. fujianensis BJFUCC 180226-3 Vaccinium uliginosum China MW251380 MW251388 MW251379 N/A
B. fusispora MFLUCC 10-0098T Entada sp. Thailand JX646789 JX646854 JX646839 N/A
B. fusispora MFLUCC 11-0507 Caryota sp. Thailand JX646788 JX646853 JX646838 N/A
B. guttulata CGMCC3.20094T N/A China MT327839 MT331606 N/A N/A
B. guttulata GZCC 19-0188 N/A China MT327833 MT331601 N/A N/A
B. kuwatsukai CBS 135219T Malus domestica China KJ433388 KJ433410 N/A N/A
B. kuwatsukai LSP 5 Pyrus sp. China KJ433395 KJ433417 N/A N/A
B. dolichospermatii CGMCC 3.19096T Vaccinium uliginosum China MH491970 MH491974 MH562327 N/A
B. dolichospermatii CGMCC 3.19097 Vaccinium uliginosum China MH491971 MH491975 MH562328 N/A
B. minutispermatia GZCC 16-0013T Dead wood China KX447675 KX447678 N/A N/A
B. minutispermatia GZCC 16-0014 Dead wood China KX447676 KX447679 N/A N/A
B. osmanthuse GUCC 21433T GUCC 21433 China OL854215 OP650906 OP669376 OP650903
B. osmanthuse GUCC 21433.1 Osmanthus fragrans China OL854216 OP650907 OP669377 OP650904
B. osmanthuse GUCC 21433.2 Osmanthus fragrans China OL854217 OP650908 OP669378 OP650905
B. pseudoramosa CERC 2001T Eucalyptus hybrid China KX277989 KX278094 KX278198 MF410140
B. pseudoramosa CERC 2983 Melastoma sanguineum China KX277992 KX278097 KX278201 MF410143
B. puerensis CSF6052 T Eucalyptus urophylla China MT028569 MT028735 MT028901 MT029057
B. qingyuanensis CERC 2946T Eucalyptus hybrid China KX278000 KX278105 KX278209 MF410151
B. qingyuanensis CERC 2947 Eucalyptus hybrid China KX278001 KX278106 KX278210 MF410152
B. quercus MFLUCC:14-0459 T Quercus sp. Italy KU848199 N/A N/A N/A
B. ramosa CBS 122069T Eucalyptus camaldulensis Bell Australia EU144055 EU144070 KF766132 N/A
B. ramosa CGMCC 3.18004 Acacia sp. China KX197073 KX197093 KX197100 N/A
B. rosaceae CGMCC 3.18007T Malus sp. China KX197074 KX197094 KX197101 N/A
B. rosaceae CGMCC 3.18008 Amygdalus sp. China KX197075 KX197095 KX197102 N/A
B. salicicola GUCC 21230T Salix China OL854218 OP669379 OP750032 N/A
B. salicicola GUCC 21230.1 Salix China OL854219 OP669380 OP750033 N/A
B. scharifii CBS 124703T Mangifera indica Iran JQ772020 JQ772057 N/A N/A
B. sinensia CGMCC 3.17722T Populus sp. China KT343255 N/A N/A N/A
B. tenuispora MUCC 2900 Aucuba japonica Japan LC585276 LC585148 LC585172 N/A
B. tenuispora MUCC 237T Leucothoe fontanesiana Japan LC585278 LC585150 LC585174 LC585196
B. wangensis CERC 2298T Cunninghamina deodara China KX278002 KX278107 KX278211 MF410153
B. wangensis CERC 2299 Cunninghamina deodara China KX278003 KX278108 KX278212 MF410154
Cophinforma atrovirens MFLUCC 11-0425 T Eucalyptus sp. Thailand JX646800 JX646865 JX646848 N/A
C. atrovirens MFLUCC 11-0655 Eucalyptus sp. Thailand JX646801 JX646866 JX646849 N/A
Neoscytalidium dimidiatum CBS 145.78T Homo sapiens United Kingdom KF531816 KF531795 KF531796 N/A
N. dimidiatum CBS 251.49 Juglans regia USA KF531819 KF531797 KF531799 N/A

Note: Newly generated sequences are indicated in bold.

ML analysis was performed using IQ-TREE (Nguyen et al. 2015; Trifinopoulos et al. 2016) on the IQ-TREE web server (http://iqtree.cibiv.univie.ac.at, 17 October 2022). The MP analysis was implemented to test the discrepancy of the ITS, rpb2, tef1 and tub2 sequence datasets with PAUP v. 4.0b10 (Swofford 2002). Gaps were treated as missing data, which were interpreted as uncertainty of multistate taxa. Phylogenetic trees were generated using the heuristic search option with tree bisection re-connection (TBR) branch swapping. “Maxtrees” was set to 5000, the tree length (TL), consistency index (CI), homoplasy index (HI), retention index (RI) and rescaled consistency index (RC) were calculated. Bayesian Inference analysis was made with MrBayes 3.2.6 (Ronquist et al. 2012) based on a best substitution model for ITS: GTR+G, rpb2: K2P+I, tef1: HKY+G and tub2: HKY+G. BI was performed using six Markov Chain Monte Carlo runs for 5,000,000 generations, sampling every 1000 generations. The first 25% resulting trees were discarded as burn-in phase of each analysis.

MP, ML bootstrap support values greater than 70% and BI posterior probability values greater than 0.90 were denoted at the nodes and separated by “/”. Bootstrap values less than 70% and BI posterior probability values less than 0.90 were labelled with “_”.

Results

The MP, ML and Bayesian analyses resulted in trees with similar topologies and the MP tree is shown in Fig. 1. The combined data matrix of ITS–rpb2–tef1–tub2 consisted of 1805 characters (ITS: 466, rpb2: 716, tef1: 286 and tub2: 337), of which 1579 characters were constant and 13 variable characters were parsimony uninformative. Maximum Parsimony analysis of the remaining 213 parsimony informative characters produced a tree with the following parameters: TL = 291; CI = 0.862; HI = 0.137; RI = 0.931; and RC = 0.803.

Figure 1. 

Trees resulting from MP analysis of the combined ITS, rpb2, tef1 and tub2 sequence alignment for forty-three isolates in Botryosphaeria. RAxML and MP bootstrap support values (ML, MP ≥ 70%) and Bayesian posterior probability (PP ≥ 0.90) are denoted on the nodes (ML/MP/PP). The tree was rooted to Neoscytalidium dimidiatum (CBS 145.78 and CBS 251.49) and Cophinforma atrovirens (MFLUCC 11-0425 and MFLUCC 11-0655). The new species are highlighted in pale red. The scale bar indicates 8.0 expected changes per site.

In the phylogenetic tree (Fig. 1), the isolates from this study formed two distinct, well-supported clades and, thus, were considered to represent two previously unknown species. Botryosphaeria osmanthuse GUCC 21433, GUCC 21433.1 and GUCC 21433.2 without the DNA base differences in four loci amongst strains (ITS, rpb2, tef1 and tub2) form an independent branch with strong support (ML = 85, PP = 0.94) sister to B. puerensis. Botryosphaeria salicicola (GUCC 21230 and GUCC 21230.1) clustered sister to B. corticis, B. fabicerciana, B. fusispora, B. fujianensis, B. kuwatsukai and B. rosaceae, although with weak-supports (ML = 75). These two novel taxa were also supported by DNA base pair differences (Table 3).

Table 3.
Download as
CSV
XLSX

The DNA base differences in four loci between the two new species and closely-related species.

Species Strain number ITS (1–458 characters) tef1 (459–703 characters) tub2 (704–1039 characters) rpb2 (1040–1754 characters)
Botryosphaeria salicicola GUCC 21230 0 0 0 –
GUCC 21230.1 0 0 0 –
B. corticis CBS 119047 10 (gap: 2) 11 (gap: 6) 6 (gap: 0) –
ATCC 22927 10 (gap: 2) 11 (gap: 6) 6 (gap: 0) –
B. fabicerciana CBS 127193 4 (gap: 3) 8 (gap: 2) 3 (gap: 1) –
CMW 27121 4 (gap: 3) 8 (gap: 2) 3 (gap: 1) –
B. fujianensis CGMCC 3.19099 4 (gap: 3) 8 (gap: 2) 4 (gap: 1) –
BJFUCC 180226-3 4 (gap: 3) 8 (gap: 2) 4 (gap: 1) –
B. fusispora MFLUCC 10-0098 4 (gap: 3) 10 (gap: 3) 3 (gap: 1) –
MFLUCC 11-0507 4 (gap: 3) 10 (gap: 3) 3 (gap: 1) –
B. kuwatsukai CBS 135219 4 (gap: 4) 7 (gap: 2) – –
LSP 5 4 (gap: 4) 7 (gap: 2) – –
B. rosaceae CGMCC 3.18007 4 (gap: 4) 7 (gap: 2) 2 (gap: 0) –
CGMCC 3.18008 4 (gap: 4) 7 (gap: 2) 2 (gap: 0) –
B. dothidea CBS 115476 8 (gap: 2) 12 (gap: 4) 3 (gap: 1) –
CBS 110302 8 (gap: 2) 12 (gap: 4) 3 (gap: 1) –
Species Strain number ITS (1–456 characters) tef1 (471–702 characters) tub2 (703–1034 characters) rpb2 (1035–1750 characters)
Botryosphaeria osmanthuse GUCC 21443 0 0 0 0
GUCC 21443.1 0 0 0 0
GUCC 21443.2 0 0 0 0
B. puerensis CSF6052 1 (gap: 1) 13 (gap: 4) 8 (gap: 0) 8 (gap: 0)
B. dothidea CBS 115476 5 (gap: 1) 9 (gap: 2) 12 (gap: 0) –
CBS 110302 5 (gap: 1) 9 (gap: 2) 12 (gap: 0) –

Taxonomy

Botryosphaeria salicicola J. E. Sun, C. R. Meng & Yong Wang bis, sp. nov.

MycoBank No: 43685
Figs 2a–i

Etymology

In reference to the host from which the fungus was first isolated.

Diagnosis

Botryosphaeria salicicola is characterised by oval to broadly fusiform ascospores (25.2 × 10.8; L/W = 2.3 vs. 22.7× 7.8 µm, L/W = 2.9) and cylindrical to clavate asci (65–170 × 20–30 µm), with moderate growth rate.

Type

China, Guizhou Province, Guiyang City, 26°65'N, 106°63'E, from branches of Salix sp., 20 June 2020, C.R. Meng, HGUP 21230 (holotype), ex-type culture GUCC 21230.

Description

Saprobic on dead branches of Salix. Teleomorph: Ascomata superficial, becoming erumpent at maturity, aggregated, thick-walled, wall composed of dark brown, thick-walled textura angularis, becoming thinner-walled and hyaline towards the inner layers, 160 µm diam. Hamathecium comprising hyaline, septate, branched, 2–3.5 µm wide filamentous pseudoparaphyses. Asci 65–170 × 20–30 µm, 8-spored, bitunicate, cylindrical, to clavate, stipitate. Ascospores 22–26 × 9.0–13 µm (average = 25.2 × 10.8 µm, n = 20, L/W = 2.3), irregularly biseriate in the ascus, hyaline, guttulate, smooth with granular contents, aseptate, oval to broadly fusiform, widest in the middle or upper third of the ascospore, tapering to the obtuse base and apex. Anamorph: Not observed.

Culture characteristics

Ascospores germinate on PDA within 24 hours at room temperature (25 °C). Colonies with white fluffy mycelium on PDA (90 mm), after 7 days becomes grey-black at the bottom of centre, olivaceous-grey at the bottom of edge, white mycelium, raised, fluffy, dense filamentous.

Distribution

China, Guizhou Province, Guiyang City.

Other material examined

China, Guizhou Provice, Guiyang City, 26°65'N, 106°63'E, from dead branches of Salix, 20 June 2020, C.R. Meng, HGUP 21230, living culture GUCC 21230.1.

Notes

NCBI BLAST searches of ITS sequences from our strains suggested a high degree of similarity (99–100%) to Botryosphaeria dothidea. However, B. salicicola and B. dothidea show distant phylogenetic relationships in the phylogeny. Botryosphaeria salicicola has longer asci (65–170 × 20–30 µm vs. 63–125 × 16–20 µm) than B. dothidea and longer ascospores (25.2 × 10.8; L/W = 2.3 vs. 22.7× 7.8 µm, L/W = 2.9) (Slippers et al. 2004). The phylogenetic analyses indicate that Botryosphaeria salicicola forms an independent branch with respect to B. corticis, B. fabicerciana, B. fusispora, B. fujianensis, B. kuwatsukai and B. rosaceae. Comparing the morphological characteristics shows that B. corticis has longer ascospores than B. salicicola (29.3 × 11.6 µm vs. 25.2 × 10.8 μm) (Phillips et al. 2006); B. fusispora has shorter asci than B. salicicola (77.5–112.5 × 20–25 µm vs. 65–170 × 20–30 µm) (Liu et al. 2012); B. rosaceae has longer ascomata than B. salicicola (170–290 μm vs. 160 μm) (Zhou et al. 2017). The sexual morphs of B. fabicerciana (Chen et al. 2011), B. fujianensis (Chu et al. 2021) and B. kuwatsukai (Xu et al. 2015) are unknown.

Figure 2. 

Botryosphaeria salicicola (GUCC 21230, holotype) a–c ascomata on natural substrate d section through ascomata f mature asci g ascospores h colony on PDA (left: above, right: reverse). Scale bars: 400 µm (b); 200 µm (c); 50 µm (d); 40 µm (e); 20 µm (f, g); 15 mm (h).

Botryosphaeria osmanthuse J. E. Sun, C. R. Meng & Yong Wang bis, sp. nov.

MycoBank No: 843684
Figs 3a–i

Etymology

In reference to the host from which the fungus was first isolated.

Diagnosis

Botryosphaeria osmanthuse is characterised by aseptate narrowly fusiform conidia (16.0–20.5 × 5.0–6.0 µm (average = 17.0 × 5.3 µm, n = 45, L/W = 3.2) and short-length conidiogenous cells (8.5–10.5 × 2.3–2.8 µm), with moderate growth rate.

Type

China, Guangxi Province, Nanning City, 22°51'N, 108°19'E, from leaves of Osmanthus fragrans, 20 October 2017, C.R. Meng, HGUP 21433 (holotype), ex-type living culture GUCC 21433.

Description

Saprobic on living leaves of Osmanthus fragrans. Teleomorph: Not observed. Anamorph: Conidiomata up to 200 µm diam., covered with hyphae, black, globose, ostiolate, solitary, separate, uniloculate, immersed to semi-immersed. Conidiomatal wall composed of thick-walled, dark brown cells of textura angularis, becoming thin-walled and hyaline towards the inner region. Conidiophores reduced to conidiogenous cells. Conidiogenous cells 8.5–10.5 × 2.3–2.8 µm (average = 10 × 2.5 µm, n = 20), holoblastic, discrete, hyaline, cylindrical to lageniform, phialidic with periclinal thickening. Paraphyses not were seen. Conidia 16.0–20.5 × 5.0–6.0 µm (average = 17.0 × 5.3 µm, n = 45, L/W = 3.2), hyaline, thin-walled, smooth with granular contents, unicellular, aseptate narrowly fusiform, base subtruncate to bluntly rounded.

Culture characteristics

Conidia germinate on PDA within 24 hours at room temperature (25 °C) with germ tubes produced from both ends of the conidia. Colonies with white fluffy mycelium on PDA (90 mm), after 7 days becomes raised, fluffy, white mycelium, dense filamentous.

Figure 3. 

Botryosphaeria osmanthuse (GUCC 21433, holotype) a–c colonies on natural substrate d section through conidiomata e–g conidiophores and conidia h conidia i colony on PDA (left: above, right: reverse). Scale bars: 300 µm (b); 140 µm (c); 50 µm (d); 20 µm (e); 10 µm (f–h); 15 mm (i).

Distribution

China, Guangxi Province, Nanning City.

Other material examined

China, Guangxi Province, Nanning City, 22°51'N, 108°19'E, from living leaves of Osmanthus fragrans, 20 October 2017, C.R. Meng, HGUP 21433, living culture GUCC 21433.1 and GUCC 21433.2.

Notes

NCBI BLAST searches of ITS sequences from our strains suggest a high degree of similarity (99–100%) to Botryosphaeria dothidea. However, DNA bases in the two loci (tef1 and tub2) showed a high amount of difference between B. osmanthuse and B. dothidea. Botryosphaeria osmanthuse shows close phylogenetic affinity to B. puerensis (Fig. 1). Comparing the morphological characteristics, conidia of B. osmanthuse (av. 17.0 × 5.3; L/W = 3.2) are narrower and shorter than B. puerensis (av. 26.8 × 6.4; L/W = 4.2) (Li et al. 2020). Botryosphaeria osmanthuse was first isolated from Osmanthus fragrans (Oleaceae), while B. puerensis has been reported from Eucalyptus urophylla (Myrtaceae).

Discussion

Two new species of Botryosphaeria, B. salicicola and B. osmanthuse, are described and illustrated from southern China in this paper. Previously reported Botryosphaeria species in China are listed in Table 4. Thirteen Botryosphaeria species were described from nine different areas in southern China, covering three climatic zones (northern sub-tropical zone, central sub-tropical zone and warm temperate zone) along an altitudinal gradient (Hui 2021). Most species, such as B. fabicerciana, B. fujianensis, B. fusispora, B. kuwatsukai, B. dolichospermatii, B. minutispermatia, B. pseudoramosa, B. qingyuanensis and B. wangensis, often caused serious diseases on their hosts (Xu et al. 2015; Ariyawansa et al. 2016; Zhou et al. 2016, 2017; Li et al. 2018, 2020; Vu et al. 2019; Chen et al. 2020; Chu et al. 2021). Geographical and climatic regions have a large influence on the taxonomy, ecological distribution and pathogenicity of Botryosphaeria species (Phillips et al. 2013).

Table 4.
Download as
CSV
XLSX

List of Chinese Botryosphaeria strains.

Species Strain Host/ Natural substrate Regions Fungi References
Botryosphaeria fabicerciana CBS 127193 Eucalyptus sp. Fujian Pathogens Li et al. (2018)
CMW 27094 Eucalyptus sp. Fujian Pathogens Li et al. (2018)
CMW 27121 Eucalyptus sp. Fujian Pathogens Li et al. (2018)
CERC 2930 Eucalyptus sp. Yunnan Pathogens Li et al. (2018)
CERC 3446 Eucalyptus sp. Guangdong Pathogens Li et al. (2018)
CERC 2912 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2018)
CERC 2913 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2018)
B. fujianensis CGMCC 3.19099 Vaccinium uliginosum Fujian Pathogens Chu et al. (2021)
BJFUCC 180226-3 V. uliginosum Fujian Pathogens Chu et al. (2021)
BJFUCC 180226-4 V. uliginosum Fujian Pathogens Chu et al. (2021)
B. fusispora CSF6063 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2020)
CSF6178 E. globulus Yunnan Pathogens Li et al. (2020)
CSF5872 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2020)
CSF5950 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2020)
CSF6160 E. globulus Yunnan Pathogens Li et al. (2020)
CSF6056 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2020)
B. guttulata CGMCC3.20094 Decaying branch Guizhou Saprobes Chen et al. (2020)
GZCC 19-0186 Decaying branch Guizhou Saprobes Chen et al. (2020)
GZCC 19-0188 Decaying branch Guizhou Saprobes Chen et al. (2020)
B. kuwatsukai CBS 135219 Malus domestica Unknown Pathogens Xu et al. (2015)
LSP 5 Pyrus sp. Unknown Pathogens Xu et al. (2015)
B. dolichospermatii CGMCC 3.19096 V. uliginosum Fujian Pathogens Chu et al. (2021)
CGMCC 3.19097 V. uliginosum Fujian Pathogens Chu et al. (2021)
GZCC 16-0013 Dead wood Guizhou Saprobes Ariyawansa et al. (2016)
GZCC 16-0014 Dead wood Guizhou Saprobes Ariyawansa et al. (2016)
B. pseudoramosa CERC 2001 E. hybrid Guangxi Pathogens Li et al. (2018)
CERC 2982 Unknow Guangxi Pathogens Li et al. (2018)
CERC 2983 Melastoma sanguineum Guangxi Unsure Li et al. (2018)
CGMCC 3.18739 Eucalyptus sp. Guangxi Unsure Li et al. (2018)
CERC 3462 Eucalyptus sp. Guangxi Unsure Li et al. (2018)
CERC 2019 E. urophylla & E. grandis Guangxi Unsure Li et al. (2018)
CERC 2987 Me. sanguineum Guangxi Unsure Li et al. (2018)
CERC 3455 Eucalyptus sp. Guangxi Unsure Li et al. (2018)
CERC 2988 Me. sanguineum Guangxi Unsure Li et al. (2018)
B. qingyuanensis CERC 2946 E. hybrid Guangdong Pathogens Li et al. (2018)
CERC 2947 E. hybrid Guangdong Pathogens Li et al. (2018)
B. ramosa CGMCC 3.18004 Acacia sp. Hainan Unsure Vu et al. (2019)
CGMCC 3.18006 Myrtaceae Guangdong Unsure Vu et al. (2019)
B. rosaceae CGMCC 3.18007 Malus sp. Shandong Unsure Zhou et al. (2017)
CGMCC 3.18008 Amygdalus sp. Shandong Unsure Zhou et al. (2017)
CGMCC3.18009 Malus sp. Shandong Unsure Zhou et al. (2017)
CGMCC3.18010 Pyrus sp. Shandong Unsure Zhou et al. (2017)
CFCC 82350 Malus sp. Unknown Unsure Zhou et al. (2017)
CGMCC3.18011 Pyrus sp. Shandong Unsure Zhou et al. (2017)
B. sinensia CGMCC 3.17722 Populus sp. Henan Unsure Zhou et al. (2016)
CGMCC 3.17723 Morus sp. Henan Unsure Zhou et al. (2016)
CGMCC 3.17724 Juglans regia Henan Unsure Zhou et al. (2016)
CFCC 82346 J. regia Beijing Unsure Zhou et al. (2016)
CFCC 82255 Ma. pumila Beijing Unsure Zhou et al. (2016)
B. wangensis CERC 2298 C. deodara Henan Pathogens Li et al. (2018)
CERC 2299 C. deodara Henan Pathogens Li et al. (2018)
CGMCC 3.18744 C. deodara Henan Pathogens Li et al. (2018)
CERC 2300 C. deodara Henan Pathogens Li et al. (2018)
CSF5820 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2020)
CSF5733 Eucalyptus sp. Yunnan Pathogens Li et al. (2020)
CSF5944 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2020)
CSF5971 E. urophylla & E. grandis Yunnan Pathogens Li et al. (2020)
CSF5781 E. globulus Yunnan Pathogens Li et al. (2020)
CSF6174 E. globulus Yunnan Pathogens Li et al. (2020)
CSF5737 Eucalyptus sp. Yunnan Pathogens Li et al. (2020)
B. archontophoenicis HKU (M) 3539 Archontophoenix alexandrae Hong Kong Saprobes Index Fungorum and mycobank
B. brunneispora HKU (M) 3987 Trachycarpus fortune Hubei Unsure Index Fungorum and mycobank
B. cunninghamiae N/A Cunninghamia lanceolata China Saprobes Index Fungorum and mycobank
B. puerensis HMAS 255719 E. urophylla & E. grandis China Pathogens Index Fungorum and mycobank
B. qinlingensis BJFC S1576 Quercus aliena var. acuteserrata Shaanxi Unsure Index Fungorum and mycobank
B. yedoensis N/A Prunus yedoensis Taiwan Unsure Index Fungorum and mycobank

Botryosphaeria species have been known to exist in many woody plants (Crous et al. 2006; Liu et al. 2012; Phillips et al. 2013; Ariyawansa et al. 2016; Dissanayake et al. 2016; Slippers et al. 2017). Botryosphaeria dothidea, the type species of the genus (Slippers and Wingfield 2007), is known from numerous hosts (Phillips et al. 2013; Marsberg et al. 2017) and was isolated from an Asphondylia gall on Lamiaceae in Italy and Poland (Zimowska et al. 2020). Other species of Botryosphaeria have often been isolated from many wood plants (Table 2). Amongst them, B. fabicerciana, B. fusispora, B. kuwatsukai, B. pseudoramosa, B. rosaceae, B. wangensis and B. puerensis often exist in many economic plants, such as Eucalyptus sp., Pyrus sp., Malus sp., Citrus sp. and Vaccinium sp. (Phillips et al. 2006; Lazzizera et al. 2008; Zhou et al. 2017; Li et al. 2018, 2020; Chen et al. 2020). Our strains were isolated from the Salix (Salicaceae) and O. fragrans (Oleaceae) of woody plants. In contrast, the few hosts or natural substrates of the known species belong to the Salicaceae and Oleaceae.

Acknowledgements

This research is supported by the following projects: National Natural Science Foundation of China (No. 31972222, 31660011), Program of Introducing Talents of Discipline to Universities of China (111 Program, D20023), Talent project of Guizhou Science and Technology Cooperation Platform ([2017]5788-5, [2019]5641, [2019]13), Guizhou Science, Technology Department of International Cooperation Base project ([2018]5806), the project of Guizhou Provincial Education Department ([2020]001), and Guizhou Science and Technology Innovation Talent Team Project ([2020]5001). Alan JL Phillips acknowledges the support from UIDB/04046/2020 and UIDP/04046/2020 Centre grants from FCT, Portugal (to BioISI).

References

  • Ariyawansa HA, Hyde KD, Liu JK, Wu SP, Liu ZY (2016) Additions to Karst Fungi 1: Botryosphaeria minutispermatia sp. nov., from Guizhou Province, China. Phytotaxa 275(1): 35–44. https://doi.org/10.11646/phytotaxa.275.1.4
  • Alves A, Crous PW, Correia A, Phillips AJL (2008) Morphological and molecular data reveal cryptic species in Lasiodiplodia theobromae. Fungal Diversity 28: 1–13.
  • Cesati V, Notaris GD (1863) Schema diclassificazione degli sferiacei italici aschigeri piu’o meno appartenenti al genere Sphaerianell’antico significato attribuitoglide Persoon. Commentario della Società Crittogamologica Italiana 14: 177–240.
  • Chen SF, Pavlic D, Roux J, Slippers B, Xie YJ, Wingfield MJ, Zhou XD (2011) Characterization of Botryosphaeriaceae from plantation-grown Eucalyptus species in South China. Plant Pathology 60(4): 739–751. https://doi.org/10.1111/j.1365-3059.2011.02431.x
  • Chen YY, Dissanayake AJ, Liu ZY, Liu JK (2020) Additions to Karst Fungi 4: Botryosphaeria spp. associated with woody hosts in Guizhou province, China including B. guttulata sp. nov. Phytotaxa 454(3): 186–202. https://doi.org/10.11646/phytotaxa.454.3.2
  • Crous PW, Slippers B, Wingfield MJ, Rheeder J, Marasas WFO, Phillips AJL, Alves A, Burgess T, Barber P, Groenewald JZ (2006) Phylogenetic lineages in the Botryosphaeriaceae. Studies in Mycology 55: 235–253. https://doi.org/10.3114/sim.55.1.235
  • Hui QH (2021) Division of climatic zones during the peak of the Holocene Warm Period in China. Journal of Qinghai Normal University 3: 60–65. [Natural Science]
  • Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108
  • Lazzizera C, Frisullo S, Alves A, Phillips AJL (2008) Morphology, phylogeny and pathogenicity of Botryosphaeria and Neofusicoccum species associated with drupe rot of olives in southern Italy. Plant Pathology 57(5): 948–956. https://doi.org/10.1111/j.1365-3059.2008.01842.x
  • Li GQ, Slippers B, Wingfield MJ, Chen SF (2020) Variation in Botryosphaeriaceae from Eucalyptus plantations in Yunnan Province in southwestern China across a climatic gradient. IMA Fungus 11(1): 22. https://doi.org/10.1186/s43008-020-00043-x
  • Liu JK, Phookamsak R, Doilom M, Wikee S, Li YM, Ariyawansha H, Boonmee S, Chomnunti P, Dai DQ, Bhat JD, Romero AI, Zhuang WY, Monkai J, Gareth Jones EB, Chukeatirote E, Ko TWK, Zhao YC, Wang Y, Hyde KD (2012) Towards a natural classification of Botryosphaeriales. Fungal Diversity 57(1): 149–210. https://doi.org/10.1007/s13225-012-0207-4
  • Marsberg A, Kemler M, Jami F, Nagel JH, Smidt AP, Naidoo S, Wingfield MJ, Crous PW, Spatafora JW, Hesse CN, Robbertse B, Slippers AB (2017) Botryosphaeria dothidea: A latent pathogen of global importance to woody plant health. Molecular Plant Pathology 18(4): 477–488. https://doi.org/10.1111/mpp.12495
  • Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Pennycook SR, Samuels GJ (1985) Botryosphaeria and Fusicoccum species associated with ripe fruit rot of Actinidia deliciosa (kiwifruit) in New Zealand. Mycotaxon 24: 445–458.
  • Phillips AJL, Oudemans PV, Correia A, Alves A (2006) Characterisation and epitypification of Botryosphaeria corticis, the cause of blueberry cane canker. Fungal Diversity 21: 141–155.
  • Phillips AJL, Alves A, Pennycook SR, Johnston PR, Ramaley A, Akulov A, Crous PW (2008) Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia 21(1): 29–55. https://doi.org/10.3767/003158508X340742
  • Phillips AJL, Alves A, Abdollahzadeh J, Slippers B, Wingfield MJ, Groenewald JZ, Crous PW (2013) The Botryosphaeriaceae: Genera and species known from culture. Studies in Mycology 76: 51–167. https://doi.org/10.3114/sim0021
  • Phillips AJL, Hyde KD, Alves A, Liu JK (2019) Families in Botryosphaeriales: A phylogenetic, morphological, and evolutionary perspective. Fungal Diversity 94(1): 1–22. https://doi.org/10.1007/s13225-018-0416-6
  • Ronquist F, Teslenko M, Mark VD, Ayres P, Darling DL, Höhna A, Larget S, Liu B, Suchard LMA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Senanayake IC, Rathnayake AR, Marasinghe DS, Calabon MS, Gentekaki E, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS, Jayawardena RS, Wanasinghe DN, Jeewon R, Bhat DJ, Xiang MM (2020) Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere: Journal of Fungal Biology 11(1): 2678–2754. https://doi.org/10.5943/mycosphere/11/1/20
  • Shoemaker RA (1964) Conidial states of some Botryosphaeria species on Vitis and Quercus. Canadian Journal of Botany 42(9): 1297–1301. https://doi.org/10.1139/b64-122
  • Slippers B, Crous PW, Denman S, Coutinho T (2004) Combined Multiple Gene Genealogies and Phenotypic Characters Differentiate Several Species Previously Identified as Botryosphaeria dothidea. Mycologia 96: 83–101. https://doi.org/10.1080/15572536.2005.11833000
  • Slippers B, Wingfield MJ (2007) Botryosphaeriaceae as endophytes and latent pathogens of woody plants: Diversity, ecology and impact. Fungal Biology Reviews 21(2–3): 90–106. https://doi.org/10.1016/j.fbr.2007.06.002
  • Swofford DL (2002) PAUP*: Phylogenetic analysis using parsimony (and other methods), version 4.0 b10. MA: Sinauer Associates. Sunderland, UK.
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ (2016) W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44(W1): W232–W235. https://doi.org/10.1093/nar/gkw256
  • Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27(2): 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
  • Vu D, Groenewald M, Vries MD, Stielow B, Eberhardt U, Al-Hatmi A, Groenewald JZ, Cardinali G, Houbraken J, Boekhout T, Crous PW, Robert V, Verkley GJM (2019) Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation. Studies in Mycology 92(1): 135–154. https://doi.org/10.1016/j.simyco.2018.05.001
  • White TJ, Bruns T, Lee S, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innes MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Xu C, Wang C, Ju LL, Zhang R, Biggs AR, Tanaka E, Li B, Sun GY (2015) Multiple locus genealogies and phenotypic characters reappraise the causal agents of apple ring rot in China. Fungal Diversity 71(1): 215–231. https://doi.org/10.1007/s13225-014-0306-5
  • Zhou YP, Zhang M, Dou ZhP, Zhang Y (2017) Botryosphaeria rosaceae sp. nov. and B. ramosa, new botryosphaeriaceous taxa from China. Mycosphere: Journal of Fungal Biology 8(2): 162–171. https://doi.org/10.5943/mycosphere/8/2/2
  • Zimowska B, Okoń S, Becchimanzi A, Krol ED, Nicoletti R (2020) Phylogenetic characterization of Botryosphaeria strains associated with Asphondylia galls on species of Lamiaceae. Diversity (Basel) 12(2): 41. https://doi.org/10.3390/d12020041
login to comment