Anaerobic fungal cultures were enriched using a basal medium (Davies et al. 1993; Orpin 1977) supplemented with milled wheat straw. The basal medium was made up as follows: 150 ml salts solution 1 (3 g.L^-1 K₂HPO₄ in distilled water), 150 ml salts solution 2 (3 g KH₂PO₄, 6 g (NH₄)₂SO₄, 6 g NaCl, 0.6 g MgSO₄.7H₂O and 0.5 g CaCl₂; dissolved in 1 L distilled water, in that order), yeast extract (3 g; Oxoid, Basingstoke, UK), tryptone (10 g; Fisher Scientific Ltd., Loughborough, UK), resazurin (2 ml of 0.1% solution) and hemin (2 ml of 0.05% solution dissolved in 1:1 ethanol / 50 mM NaOH) were added and the volume made up to 850 ml with distilled water. After boiling (until light red in colour) and cooling, 150 ml centrifuged (clarified) rumen fluid, 6 g NaHCO₃ and 1 g L-cysteine-HCl were added (final volume 1 L). The resultant solution was then deoxygenated by gassing with CO₂ for 1 h. The medium was dispensed anaerobically in 9 ml aliquots into 15 ml Hungate tubes containing milled wheat straw (5 mg.ml^-1; 0.5% w/v; dry-sieved through 2 mm mesh). Tubes were then capped with a polypropylene bung held in place by a screw cap, and autoclaved (121 °C/15 min).

Freshly voided faecal samples (ca. 20 g) were collected and transported to the laboratory within 1 h. Aliquots (ca.10 g fresh matter) of these samples were then homogenised for 2 min with 90 ml of pre-warmed (39 °C) basal medium (without wheat straw, yeast extract or tryptone) in a pre-sterilised Stomacher 400 Circulator Bag (polythene; 177 × 305 mm) using a Seward Stomacher 400 Circulator Paddle Blender (Seward Ltd., Worthing, W. Sussex, UK). A 10-fold serial dilution of this faecal homogenate was then prepared in pre-warmed basal medium (1 ml transferred to 9 ml basal medium in 15 ml Hungate tube). The 10^–4, 10^–5 and 10^–6 dilutions were used to inoculate (1 ml) the tubes of basal medium (9 ml) supplemented with wheat straw. A mixed solution of penicillin, ampicillin and streptomycin sulphate in 50% (v/v) ethanol (5 mg.ml^-1 of each; 10 ml.L^-1 added to give a final medium concentration of 50 µg.ml^-1) was also added to tubes before they were recapped, in order to inhibit bacterial growth. Tubes were incubated in the dark at (39 °C), and routine subculture was conducted at 3–5 d intervals. Exposure of the samples to oxygen was prevented by undertaking the manipulations in a box flushed with CO₂. Cultures were also grown on basal medium containing cellobiose (5 mg.ml^-1) instead of wheat straw. Purity of the isolates was ensured by three cycles of cultivation in roll tubes (Joblin 1981), with well-separated colonies being excised for subculture with a mycological spear.

For cryopreservation of cultures, a method based on the procedures suggested by Sakurada et al. (1995) and Yarlett et al. (1986) was devised. A 5× cryopreservation solution was prepared by mixing 49.7 g ethylene glycol with 155 ml clarified rumen, 200 µl of 0.1% resazurin, 0.2 g L-cysteine and 1.2 g NaHCO₃ under anaerobic conditions (total volume 200 ml; 3.2 M ethylene glycol). This solution was bubbled with CO₂ for ca. 3 h, prior to anaerobically dispensing 10 ml aliquots into Hungate tubes which were autoclaved and stored at -20 °C until use. The 5× cryopreservation solution was added to 3–5 d old wheat straw cultures (2.5 ml per 10 ml culture) under anaerobic conditions in Hungate tubes. After mixing, tubes were chilled in ice water for 15 min and then anaerobically dispensed in 2 ml aliquots into sterile 2 ml cryovials. Cryovials were placed at -80 °C overnight, before being transferred to liquid nitrogen for longer-term storage. Storage of cryopreserved cultures at -80 °C is possible for up to a few months but for prolonged storage, liquid nitrogen was found to be much more reliable.

Microscopy was conducted on cultures, grown on either wheat straw or cellobiose, using an epifluorescence microscope (Olympus BX50) with images recorded using a Nikon Coolpix 995 digital camera. For visualisation of nuclei, DAPI (0.3 mg.ml^-1 in 50 mM Tris-HCl, pH 7.2) was added, and for enhanced definition of cell walls and septa, Calcofluor white M2R (100 µM; Day et al. 2002) was used (UV-W filters: 365 nm excitation/420 nm emission).

DNA extraction was carried out using the CTAB (hexadecyltrimethylammonium bromide) method of Doyle and Doyle (1987), with modifications as described by Griffith and Shaw (1998). Cultures were harvested after 3–6 d incubation, and the biomass washed three times with sterile distilled water before being freeze–dried and ground to a powder. Ground biomass (ca. 50 mg) was used for DNA extraction, and the purified DNA resuspended in 50 µl TE buffer (pH 8.0) before being stored at -20 °C.

For genetic analysis, the D1/D2 domain of large-subunit (LSU) ribosomal DNA and internal transcribed spacer 1 (spanning ITS1 and ITS2) were amplified, using the primer pairs NL1 (GCATATCAATAAGCGGAGGAAAAG) / NL4 (GGTCCGTGTTTCAAGACGG) (Dagar et al. 2011; Fliegerová et al. 2006) and GM1 (TGTACACACCGCCCGTC) / MN106 (CGTTGTAAAACACTCAWAACC) (Edwards et al. 2008), respectively. Sequence management was conducted within the Geneious (v6.1.6) bioinformatics package (Drummond et al. 2011), using MAFFT (Katoh et al. 2002) for sequence alignment (default settings).

Phylogenetic reconstruction was conducted using TOPALi (v2.5) (Milne et al. 2004). For LSU analysis, maximum likelihood analysis was conducted using PhyML (Guindon et al. 2010) and the TrN+gamma substitution model recommended by TOPALi. For analysis of the ITS, only the ITS1 region was used since the great majority of available sequences cover only this region (and not ITS2). To establish the phylogenetic position of isolate GE09, ITS1 sequences derived from five clones were aligned with environmental and isolate sequences belonging to the four closely related monoflagellate genera. The resulting MAFFT alignment was trimmed to include only 15 bp of the flanking 18S and 5.8S regions, and duplicate sequences were removed (retaining sequences relating to cultured fungi, if present). For ITS1 analysis, maximum likelihood analysis was conducted using PhyML (Guindon et al. 2010) and the GTR substitution model recommended by TOPALi. Both the ITS1 and LSU alignments have been submitted to TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S16672).

The isolate GE09 was originally isolated from the faeces of a domesticated Asian water buffalo (Bubalus bubalis) on 26^th Feb 2004 at Panthwylog Farm, Llanon, Ceredigion, Wales (N52.279; W-4.169). The buffalo was part of a herd kept outdoors, maintained on grass pasture supplemented with grass silage. More recently, three additional pure cultures (each from a different host species have been isolated), all identical in morphology and LSU DNA barcode to GE09. These isolates were obtained as follows: from cow (Bos taurus) faeces (isolate HoCal4.C3.3; Nant yr Arian, Ponterwyd, Ceredigion; 6^th Feb 2013; N52.416; W-3.891), sheep (Ovis aries) faeces (HoCal4.B3c, also Nant yr Arian, 6^th Feb 2013) and horse (Equus ferus caballus) faeces (isolate HoCal4.D1.2; Aberystwyth University Lluest livery yard; 6^th Feb 2013; N52.410; W-4.051).

Thalli of isolate GE09, when grown on wheat straw or cellobiose as a carbon source, were consistently monocentric, with rhizoids radiating from a single developing sporangium. Mature sporangia were spherical to ovoid 30 to 80 µm long and 20 to 60 µm wide (Fig. 1). No apical projections, as found in Anaeromyces mucronatus (Breton et al. 1990) or Piromyces mae (Li et al. 1990) (referred to as a mucro or papilla respectively by these authors), were observed.

Figure 1. 

Morphology of Buwchfawromyces eastonii. Sporangia are ovoid (A) to spherical (B), tending to be more elongate when growing on straw particles (C). Zoospores are uniformly monoflagellate (D). A distinct septum is visible where the sporangium is attached to the sporangiophore (A, E, G, H arrowed) and sporangiophores are often swollen (E–H). Nuclei were not observed in sporangiophores or rhizoids (F, H, I). Scalebar indicates 50 µm.

Zoospores (spherical; diameter 9–11 µm) were readily observed in 3–5 d old cultures grown on wheat straw and consistently bore a single flagellum (30–40 µm long; 3–4× longer than the length of the zoospore body). However, the process whereby zoospores were released from the sporangium was not observed. On a single occasion, a large (30 µm diameter) zoospore-like structure bearing numerous flagella, each emerging from a different point on the zoospore body, was detected (Suppl. material 1A). This is possibly the result of the agglomeration and fusion of numerous zoospores (hence the numerous flagella that are visible), similar to the structure previously observed by Orpin (1975) in N. frontalis (Orpin’s Fig. 2; Suppl. material 1B).

The most distinctive feature of the thalli of GE09 were the swollen sporangiophores (40–80 µm long and 15–50 µm wide), occasionally comparable in volume to the sporangium they supported (Fig. 1E–H). Also visible was a septum at the point where the sporangium joined the sporangiophore (Fig. 1A, E–I). The sporangiophore was contiguous with the rhizoids which tapered (from 20 µm to 5 µm) and branched (Fig. 1B). The proximal rhizoids (within 100 µm of the sporangium) were often contorted (Fig. 1B). DAPI staining was used to observe the location of nuclei within the thalli (Fig. 1F, H, I); these were abundant in sporangia but none were observed in the sporangiophores or rhizoids.

The swollen sporangiophores and twisted rhizoids observed here are very similar to those noted by Ho et al. (1993b) in Piromyces spiralis (Suppl. material 1C, D). Also similar are the swollen sporangiophores reported in P. mae (Li et al. 1990) (isolate PN11 from horse; Fig. 25). It is also noteworthy that Anaeromyces (formerly Piromyces) polycephalus (Suppl. material 1E) (Chen et al. 2002; Kirk 2012), whilst forming multiple rather than single sporangia, also forms a distinctly swollen sporangiophore. It is possible that such structures play some role in physical disruption of the substrate, as is the case for the bulbous holdfasts formed by Caecomyces and Cyllamyces spp.

Cultures of GE09 maintained viability, and could be subcultured, after incubation at 39 °C for periods of several weeks. This raised the possibility that these cultures may form long-term survival structures (McGranaghan et al. 1999; Struchtemeyer et al. 2014). Thick-walled and septate structures (3–4 septa; 30–40 µm long × 10–15 µm wide), very similar to those previously observed in Anaeromyces sp. EO2 (Brookman et al. 2000) were seen in wheat straw cultures incubated for 28 d (Suppl. material 1F, G) and never observed in younger (3–5 d old) cultures. However, detailed examination of the development of these putative resting structures was not undertaken.

Detailed examination of isolate GE09 was not undertaken when it was first isolated. However, it was used as a reference sample in a study of the colonisation of forage by anaerobic fungi (Edwards et al. 2008), in the course of which the ITS1/2 spacer regions were amplified and cloned. The sequences of the five clones were submitted to GenBank (EU414755–EU414759) under the generic name Anaeromyces, since these sequences clustered close to the Anaeromyces clade at that time. However, more detailed analysis has since suggested that this isolate is quite distinct from Anaeromyces (Kittelmann et al. 2012).

The sequence of the D1/D2 domains (ca. 750 bp) of the LSU of GE09 and the three other isolates were identical (submitted to GenBank as KP205570). These sequences were aligned with 36 other LSU sequences (from GenBank) covering all the known genera of Neocallimastigomycota (700 bp alignment; 188 phylogenetically informative sites), and including the outgroup taxon Gromochytrium mamkaevae (Chytridiomycota). Phylogenetic reconstruction consistently recovered Buwchfawromyces isolates as a distinct clade (85% bootstrap support). LSU sequences from Anaeromyces, Neocallimastix and Orpinomyces were also recovered as distinct clades with strong (≥80%) bootstrap support (Fig. 2). Neocallimastix and Orpinomyces were more closely related to each other than to other genera, consistent with the occurrence of polyflagellate flagella in these genera, a feature not found in other flagellate fungi (James et al. 2006). The genera forming bulbous holdfasts (Caecomyces, Cyllamyces) also formed a distinct clade, and Piromyces isolates occupied a basal position but without strong bootstrap support.

Figure 2. 

Maximum likelihood tree based on alignment of the D1/D2 region of the Large Ribosomal Subunit (700 bp alignment; 37 sequences; 188 phylogenetically informative sites; TrN+gamma model). Bootstrap values over 70% are shown (1000 replicates). Scale bar indicates number of substitutions per site.

Whilst analysis of the LSU proved informative to confirm the distinctiveness of the GE09 clade, there are relatively few LSU sequences available in GenBank for comparison. Therefore, phylogenetic analysis of the ITS1 internal transcribed spacer region, for which there are hundreds of published sequences, was conducted (357 bp alignment; 271 phylogenetically informative sites, 101 sequences) (Fig. 3). Since analysis of the LSU sequences had shown members of the genera Neocallimastix and Orpinomyces to be quite distinct, these were omitted from analyses of the ITS1 region in order to improve the quality of the alignments (fewer gaps). Additionally, ‘environmental’ sequences obtained from clone library studies, (mostly labelled as “uncultured Neocallimastigales”) were also included, as recommended by Nilsson et al. (2011).

Figure 3. 

Maximum likelihood tree based on alignment (357 bp) of the ITS1 region. Midpoint rooting was used to root the tree and bootstrap values over 70% are shown (1000 replicates). Scalebar shows the number of substitutions per site. Clades corresponding to the known genera, the new Buwchfawromyces clade and also the ‘polycephalus’ clade are labelled. Codes in brackets indicate the novel clades identified by Koetschan et al. (2014).

The Buwchfawromyces (GE09) clade was again recovered with high (92%) bootstrap support, as was the Anaeromyces clade. Five environmental sequences, all from New Zealand (from cow or red deer; Fig. 2 and listed in Suppl. material 4) also fall into the Buwchfawromyces clade. This clade was also identified (and denoted as clade SK2) in the recent study by Koetschan et al. (2014), who were able to create a reliable phylogeny by using predictors of ITS1 folding to decrease the effects of gaps in anaerobic fungal ITS1 alignments.

The largest survey of anaerobic fungi conducted to date is that of Liggenstoffer et al. (2010). They obtained ca. 250,000 ITS1 sequences, from the faeces of 30 herbivore species kept in Oklahoma zoos (Liggenstoffer et al. 2010), including three of the four herbivore species from which we cultured Buwchfawromyces. It was surprising that such a large dataset should yield no sequences falling into the Buwchfawromyces clade. However, examination of the primers used by Liggenstoffer et al. (2010) revealed the presence of mismatches between the forward primer (MN100modified; 5’-TCCTACCCTTTGTGAATTTG-3’) and the cognate sequences found in members of the Buwchfawromyces clade (TCCTACCCTTTGTGAATTGT or TCCTTACCCTTTGTGAACTGA) (Suppl. material 2). These mismatches would very likely have caused significant primer bias and thus poor amplification of any Buwchfawromyces spp. present.

Five cloned ITS1/2 PCR amplicons of GE09 were originally submitted to GenBank (EU414755–EU414759). These reveal an extremely high level of sequence divergence (<27 polymorphisms within the ca. 200bp ITS1 region; 87.1%–99.5% identity, (Suppl. material 3). High levels of intragenomic variation has also been found in other anaerobic fungi (Ozkose 2001), and also in some other fungal taxa, for instance phylum Glomeromycota (Pawlowska and Taylor 2004; Pringle et al. 2000). For GE09, the most divergent of these clones (EU414756) was more distantly related to the other GE09 clones than were sequences from New Zealand (Fig. 3). A cut-off level of 97% identity is often used to define species or OTUs (operational taxonomic units) in mycology (Nilsson et al. 2008; Yamamoto and Bibby 2014). However, such high levels of intragenomic variation, make it very difficult to generate reliable species hypotheses (Koljalg et al. 2013) for the Neocallimastigomycota based on ITS sequences alone, although the delineation of different genera is still possible.

We consider that isolate GE09 and the three other similar fungi also isolated in the Aberystwyth area represent a new genus Buwchfawromyces within the phylum Neocallimastigomycota. It is not possible for Buwchfawromyces to be placed within the related genus Anaeromyces, since it forms a monocentric thallus not consistent with the circumscription of this genus (Breton et al. 1990) which comprises species with polycentric thalli. Close to Buwchfawromyces and Anaeromyces, is the species currently known as Anaeromyces (formerly Piromyces) polycephalus. This species has a distinctive morphology (Suppl. material 1E), with multiple sporangia arising from a swollen sporangiophore, and with an anucleate rhizoidal system. It was originally isolated and described from buffalo in Taiwan (isolate W-33; (Chen et al. 2002)) and has since been reported from India (isolate CTS-47 from zebra faeces; GenBank EU330178); this clade was denoted DT1 (Fig. 3) by Koetschan et al. (2014). Given that ‘A. polycephalus’ is both morphologically and genetically distinct, this species should be renamed.

The unusually high level of intragenomic variation in ITS1 makes it difficult to nominate a single reference sequence, therefore two are presented (EU414755 and EU414756).