Data Paper
Print
Data Paper
Characterization of microsatellite markers in the cosmopolitan lichen-forming fungus Rhizoplaca melanophthalma (Lecanoraceae)
expand article infoHanna Lindgren, Steven D. Leavitt, Thorsten Lumbsch
‡ The Field Museum of Natural History, Chicago, United States of America
Open Access

Abstract

Rhizoplaca melanophthalma s.l. is a group of morphologically distinct and chemically diverse species that commonly occur in desert, steppe and montane habitats worldwide. In this study, we developed microsatellite markers to facilitate studies of genetic diversity, population structure, and gene flow in the nominal taxon of this group, Rhizoplaca melanophthalma. We characterized 10 microsatellite markers using a draft genome of R. melanophthalma s. str. assembled from Illumina reads. These loci were tested for 21 R. melanophthalma s. str. specimens and also with a subset of 18 specimens representing six additional species in the R. melanophthalma complex. The number of alleles per locus in R. melanophthalma s. str. ranged from 3 to 11 with an average of 6.7. Nei’s unbiased gene diversity ranged from 0.35 to 0.91. Amplifications of the microsatellite loci were largely successful in the other six species, although only three markers were found to be polymorphic. The new markers will provide an additional resource for studying genetic, population- and landscape-level processes in the cosmopolitan taxon Rhizoplaca melanophthalma s. str.

Key words

Ascomycetes , gene flow, landscape genetics, lichen-forming fungi, microsatellites, Rhizoplaca melanophthalma

Introduction

Rhizoplaca melanophthalma (DC.) Leuckert & Poelt s.l. represents a group of morphologically distinct and chemically diverse species of lichen-forming fungi with broad ecological and geographical distributions. Species in this group occur all over the world in disjunct populations in continental climates, although species in this complex are notably absent from Australia. Rhizoplaca melanophthalma s.l. commonly grows on siliceous or calcareous rock in arid climates, but can also be found in montane coniferous forests, alpine tundra habitats, and bi-polar populations in the Arctic and Antarctica (McCune 1987). Members of this group are commonly used in air-quality biomonitoring research, making it an important species for conservation (Aslan et al. 2004; Dillman 1996). The species complex belongs to the recently re-circumscribed monophyletic genus Rhizoplaca in Lecanoraceae (Zhao et al. 2016).

Previous multi-locus and phylogenomic studies support the circumscription of multiple species within R. melanophthalma s.l. (Leavitt et al. 2011, 2013, 2016b), many of which occur in sympatry in Western North America. In Western North America the distribution area of these species extends from the northern boreal zone to Mexico along the Rocky Mountains with a center of diversity in the Great Basin region (Leavitt et al. 2011). Rhizoplaca melanophthalma s. str. has the broadest ecological and geographic distribution of all known species within this complex, with populations occurring in desert, montane and steppe ecosystems in Antarctica, Central Asia, Europe, and North and South America (Leavitt et al. 2013).

The Rhizoplaca melanophthalma group provides an interesting system for assessing genetic diversity, population structure and gene flow in symbiotic fungal species with broad ecological and geographic distributions. To facilitate additional research into population- and landscape-level processes, 10 microsatellite markers were developed for R. melanophthalma s.str.

Materials and methods

A total of 42 specimens representing seven different species in the Rhizoplaca melanophthalma species complex were included in this study. Twenty-one of these represented R. melanophthalma s. str., three R. haydenii, four R. novomexicana, two R. parilis, four R. polymorpha, six R. porteri and two R. shushanii (Table 1). DNA was extracted from these specimens as described previously (Leavitt et al. 2011).

Table 1.

Voucher information for Rhizoplaca specimens used in this study. Herbaria codes are provided for each specimen in parentheses following voucher number.

Species DNA No. Voucher Locality
R. melanophthalma 8639c Leavitt 2013-CO-CP-8639C (F) USA, CO
R. melanophthalma 8639d Leavitt 2013-CO-CP-8639D (F) USA, CO
R. melanophthalma 8654a Leavitt 2013-CO-RM-8654A (F) USA, CO
R. melanophthalma 8654b Leavitt 2013-CO-RM-8654B (F) USA, CO
R. melanophthalma 8663B Leavitt 8663 (F) USA, UT
R. melanophthalma 8663j Leavitt-8663 (F) USA, UT
R. melanophthalma 8665b Leavitt-8665 (F) USA, NV
R. melanophthalma 8665e Leavitt-8665 (F) USA, NV
R. melanophthalma 8665i Leavitt-8665 (F) USA, NV
R. melanophthalma 8665M Leavitt-8665 (F) USA, NV
R. melanophthalma 8668b Leavitt-8668 (F) USA, NV
R. melanophthalma 8668f Leavitt-8668 (F) USA, NV
R. melanophthalma 8668q Leavitt-8668 (F) USA, NV
R. melanophthalma 8668s Leavitt-8668 (F) USA, NV
R. melanophthalma 8668w Leavitt-8668 (F) USA, NV
R. melanophthalma 6026 H9203303 (F) Kyrgyzstan, Ala-Buka
R. melanophthalma 6029 H9203135 (F) Kyrgyzstan, Panfilov District
R. melanophthalma 6030 H9203327 (F) Kyrgyzstan, Chatkal
R. melanophthalma 6435 Vondrak 9409 (PRA) Russia, Chelyabinsk
R. melanophthalma 6604 MAF-Lich 16805 (MAF) Spain, Teruel
R. melanophthalma 6605 MAF-Lich 16778 (MAF) Spain, Teruel
R. haydenii 8683 Leavitt 8683 (F) USA, ID
R. haydenii 8935p Leavitt 8935 (F) USA, ID
R. haydenii 8935s Leavitt 8935 (F) USA, ID
R. novomexicana 8684a Leavitt 8684A (F) USA, NM
R. novomexicana 8684b Leavitt 8684B (F) USA, NM
R. novomexicana 8684c Leavitt 8684C (F) USA, NM
R. novomexicana 8684d Leavitt 8684D (F) USA, NM
R. parilis 8665N Leavitt-8665 (F) USA, NV
R. parilis 8665u Leavitt-8665 (F) USA, NV
R. polymorpha 8668g Leavitt-8668 (F) USA, NV
R. polymorpha 8668l Leavitt-8668 (F) USA, NV
R. polymorpha 8668p Leavitt-8668 (F) USA, NV
R. polymorpha 8668r Leavitt-8668 (F) USA, NV
R. aff. porteri 8665x Leavitt-8665 (F) USA, NV
R. aff. porteri 8668j Leavitt-8668 (F) USA, NV
R. aff. porteri 8668m Leavitt-8668 (F) USA, NV
R. porteri 8665t Leavitt-8665 (F) USA, NV
R. porteri 8668e Leavitt-8668 (F) USA, NV
R. porteri 8668h Leavitt-8668 (F) USA, NV
R. shushanii 8664A Leavitt 13-TLM-001 (BRY-C) USA, UT
R. shushanii 8664B Leavitt 13-TLM-001 (BRY-C) USA, UT

A draft genome of an axenic culture of R. melanophthalma was obtained from a previous study (Leavitt et al. 2016a). The program MSATCOMMANDER 1.0.8 (Faircloth 2008) was used to search for di-, tri-, tetra-, penta-, and hexanucleotide microsatellite repeats in contigs >5 kb from the draft assembly. Only repeats with a minimum length of 8 bp for dinucleotide repeats and 6 bp for the rest were accepted. A total of 244 scaffolds contained microsatellite repeats (87 di-, 127 tri-, 11 tetra-, 5 penta-, and 14 hexanucleotides). For 25 of these repeats, primers were designed with Primer3 (Rozen and Skaletsky 2000) as implemented in MSATCOMMANDER. An M13 tag (5’-TGTAAAACGACGGCCAGT-3’) was appended to forward primers and 5’ ends of the reverse primers were tailed with 5’-GTGTCTT-3’ tag.

Singleplex PCR reactions were performed in 10 µl reaction volumes consisting of 5.89 µl H2O, 1 µl 10x buffer (Roche Diagnostics, Indianapolis, USA), 0.6 µl 8 mM dNTP, 1 µl BSA, 0.15 µl Taq (Roche Diagnostics, Indianapolis, USA), 0.16 µl 6-FAM labeled M13 primer, 0.04 µl 10 µM M13 tailed forward primer, 0.16 µl 10 µM reverse primer, and 1 µl of genomic DNA. DNA amplification was performed using a touchdown PCR with initial denaturation at 95 °C for 5 min; followed by first 11 cycles of 30 s at 95 °C, 30 s at 60–50 °C, 1 min. at 72 °C, and then 35 cycles of 30 s at 95 °C, 30 s at 50 °C, 1.5 min. at 72 °C, and a final extension of 10 min. at 72 °C.

Fragment analysis was performed on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, California, USA) using GeneScan-500 LIZ (Life Technologies, Warrington, UK) as an internal size standard. Genotyping was performed utilizing the microsatellite plugin in Geneious 9.1.2 (Biomatters Limited). Polymorphism within the microsatellites was tested in GenAlEx 6.5 (Peakall and Smouse 2012) by calculating Nei’s unbiased genetic diversity.

Results and discussion

Of the 25 microsatellites assessed, 18 amplified successfully and 10 were polymorphic in all 21 R. melanophthalma s. str. specimens (Table 2). The number of alleles per locus ranged from three to 11 with an average of 6.7. Nei’s unbiased genetic diversity varied between 0.353 and 0.919 with the average genetic diversity being 0.765 (Table 3). The same 18 microsatellites that amplified successfully with R. melanophthalma s. str. also amplified in R. haydenii, R. novomexicana, R. parilis, R. polymorpha, R. porteri, and R. shushanii, but only three loci were polymorphic in all these species. For these three loci (Rmel1, Rmel, 4, and Rmel8) the number of alleles ranged from 11 to 15 with the average of 13 and Nei’s unbiased genetic diversity varied between 0.892 and 0.905 with average of 0.900.

Table 2.

Microsatellite loci developed for Rhizoplaca melanophthalma s. str.

Locus Primer sequences (5’–3’) Repeat motif Allele size range (bp) GenBank accession no.
Rmel1 F: *GGCTGGGTGTTGTAGTGTTG
R: ATACCTGGCGCTCAAGAATG
(GTT)18 179–203 KX755412
Rmel2 F: *TGGTGGATCTGAGAGCGTAC
R: ACTTCAACCTTCACAACGCC
(CAGGCT)10 328–382 KX755413
Rmel3 F: *CAAAGGTCAGGAGAGGAGGG
R: TGGACGCGTGGCAATTTATC
(AC)10 380–412 KX755414
Rmel4 F: *ATCGAGACTTACTTCCCGCC
R: AATCGTATCTCCAGACCCGC
(GT)11 353–385 KX755415
Rmel5 F: *TTAGCCCGAGACCACATACG
R: TGGAGAGATGAAGCTGGCTC
(CT)12 311–321 KX755416
Rmel6 F: *ACACCAGATCTCACTCAGGC
R: CCGGGAGTAGGTGTAGATGC
(AC)10 184–192 KX755417
Rmel7 F: *TCCGGAACTGGCTTGATAGG
R: CTGAAGTCGATGTTGGGAGC
(CCTT)11 314–362 KX755418
Rmel8 F: *TTTGCCCGACGTGCAATATC
R: CTGCAGCACTCTAACCATGC
(AG)11 420–438 KX755419
Rmel9 F: *ATCTCCTGCATCTTCTCCGC
R: AACGTCACATTCGCAGTCAC
(AC)10 309–331 KX755420
Rmel10 F: *TCATCACACCAGACACAGGG
R: ACCTTAGGCCCAGACACATG
(AG)10 464–468 KX755421
Table 3.

Sample size, number of alleles (A) and Nei’s unbiased genetic diversity (He) of ten microsatellite loci developed for Rhizoplaca melanophthalma s. str.

Total
Locus n A H e
Rmel1 21 8 0.886
Rmel2 20 6 0.858
Rmel3 21 9 0.866
Rmel4 21 11 0.919
Rmel5 20 5 0.679
Rmel6 21 3 0.643
Rmel7 20 6 0.763
Rmel8 20 7 0.779
Rmel9 21 9 0.881
Rmel10 20 3 0.353
Average 6.7 0.765

The 10 polymorphic microsatellite markers for the lichen-forming fungus R. melanophthalma will help elucidate population processes that have led to the observed distribution patterns in this widespread species.

Acknowledgments

The authors would like to thank the Negaunee Foundation for providing funding for this study, and Kevin Feldheim (Pritzker Laboratory for Molecular Systematics) for assistance in the lab.

References

  • Aslan A, Budak G, Karabulut A (2004) The amounts Fe, Ba, Sr, K, Ca and Ti in some lichens growing in Erzurum province (Turkey). Journal of Quantitative Spectroscopy and Radiative Transfer 88: 423–431. doi: 10.1016/j.jqsrt.2004.04.015
  • Dillman KL (1996) Use of the lichen Rhizoplaca melanophthalma as a biomonitor in relation to phosphate refineries near Pocatello, Idaho. Environmental Pollution 92: 91–96. doi: 10.1016/0269-7491(95)00084-4
  • Faircloth BC (2008) MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Molecular Ecology Resources 8: 92–94. doi: 10.1111/j.1471-8286.2007.01884.x
  • Leavitt SD, Frankhauser JD, Leavitt DH, Porter LD, Johnson LA, St. Clair LL (2011) Complex patterns of speciation in cosmopolitan “rock posy” lichens – Discovering and delimiting cryptic fungal species in the lichen-forming Rhizoplaca melanophthalma species-complex (Lecanoraceae, Ascomycota). Molecular Phylogenetics and Evolution 59: 587–602. doi: 10.1016/j.ympev.2011.03.020
  • Leavitt SD, Fernández-Mendoza F, Pérez-Ortega S, Sohrabi M, Divakar PK, Vondrák J, Lumbsch HT, St. Clair LL (2013) Local representation of global diversity in a cosmopolitan lichen-forming fungal species complex (Rhizoplaca, Ascomycota). Journal of Biogeography 40: 1792–1806. doi: 10.1111/jbi.12118
  • Leavitt SD, Grewe F, Widhelm T, Muggia L, Wray B, Lumbsch HT (2016a) Resolving evolutionary relationships in lichen-forming fungi using diverse phylogenomic datasets and analytical approaches. Scientific Reports 6: 22262. doi: 10.1038/srep22262
  • Leavitt SD, Kraichak E, Vondrak J, Nelsen MP, Sohrabi M, Perez-Ortega S, St. Clair LL, Lumbsch HT (2016b) Cryptic diversity and symbiont interactions in rock posy lichens. Molecular Phylogenetics and Evolution 99: 261–274. doi: 10.1016/j.ympev.2016.03.030
  • McCune B (1987) Distribution of chemotypes of Rhizoplaca in North America. Bryologist 103: 6–14. doi: 10.2307/3243267
  • Peakall R, Smouse PE (2006) GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. doi: 10.1111/j.1471-8286.2005.01155.x
  • Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. In: Misener S, Krawetz SA (Eds) Methods in molecular biology, vol. 132: Bioinformatics methods and protocols. Humana Press, Totowa, New Jersey, 365–386.
  • Zhao X, Leavitt SD, Zhao ZT, Zhang LL, Arup U, Grube M, Perez-Ortega S, Printzen C, Sliwa L, Divakar PK, Crespo A, Lumbsch HT (2016) Towards a revised generic classification of lecanoroid lichens (Lecanoraceae, Ascomycota) based on molecular, morphological and chemical evidence. Fungal Diversity 78: 293–304. doi: 10.1007/s13225-015-0354-5