Research Article
Print
Research Article
Pleocatenata chiangraiensis gen. et. sp. nov. (Pleosporales, Dothideomycetes) from medicinal plants in northern Thailand
expand article infoYa-Ru Sun‡§, Ning-Guo Liu§|, Kevin D. Hyde§, Ruvishika S. Jayawardena§, Yong Wang‡
‡ Guizhou University, Guiyang, China
§ Mae Fah Luang University, Chiang Rai, Thailand
| University of Electronic Science and Technology of China, Chengdu, China
¶ Zhongkai University of Agriculture and Engineering, Guangzhou, China

Corresponding author: Yong Wang ( yongwangbis@aliyun.com )

Academic editor: Nalin Wijayawardene
© 2022 Ya-Ru Sun, Ning-Guo Liu, Kevin D. Hyde, Ruvishika S. Jayawardena, Yong Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Sun Y-R, Liu N-G, Hyde KD, Jayawardena RS, Wang Y (2022) Pleocatenata chiangraiensis gen. et. sp. nov. (Pleosporales, Dothideomycetes) from medicinal plants in northern Thailand. MycoKeys 87: 77-98. https://doi.org/10.3897/mycokeys.87.79433
Open Access

Abstract

Pleocatenata, a new genus, is introduced with its type species, Pleocatenata chiangraiensis, which was isolated from withered twigs of two medicinal plants, Clerodendrum quadriloculare (Blanco) Merr (Verbenaceae) and Tarenna stellulata (Hook.f.) Ridl (Rubiaceae) in northern Thailand. The genus is characterized by mononematous, septate, brown or dark brown conidiophores, monotretic conidiogenous cells and catenate, obclavate, olivaceous to blackish brown conidia. Phylogenetic analysis of combined LSU, SSU, tef1-α, rpb2 and ITS sequence data showed Pleocatenata forms a distinct phylogenetic lineage in Pleosporales, Dothideomycetes. Therefore, we treat Pleocatenata as Pleosporales genera incertae sedis based on morphology and phylogenetic analyses. Descriptions and illustrations of the new taxa are provided, and it is compared with morphologically similar genera.

Keywords

Genera incertae sedis, hyphomycetes, multi-gene phylogeny, taxonomy

Introduction

Medicinal plants are a rich source of natural products with biological and chemical properties. They are used in health care or treatment of human ailments and have been used since prehistoric times worldwide (Rasool-Hassan 2012). Many fungi have been found on medicinal plants and are members of Dothideomycetes and Sordariomycetes (Bhagat et al. 2012; Long et al. 2019; Ma et al. 2019; Hyde et al. 2020; Tennakoon et al. 2021). They form important associations with medicinal plants and as pathogens or saprobes (Long et al. 2019; Tennakoon et al. 2021), sources of medicines (Strobel et al. 1993; Huang et al. 2008; Hyde et al. 2019), involved in nutrient recycling (Bonnardeaux et al. 2007) and some are used in biological control (Hyde et al. 2019).

Pleosporales is the largest order in Dothideomycetes, which accounts for about a quarter of the class (Zhang et al. 2012; Hyde et al. 2013; Hongsanan et al. 2020a). They have a worldwide distribution with diverse lifestyles, including saprobes, pathogens of plants and humans, endophytes, epiphytes and hyperparasites (Ramesh 2003; Kirk et al. 2008; Zhang et al. 2012; Hyde et al. 2013; Sun et al. 2019; Ferdinandez et al. 2021). Many species in Alternaria Nees, Curvularia Boedijn and Corynespora Güssow, can invade medicinal plants and cause leaf spots and other diseases, as economically important plant pathogens (Mathiyazhagan et al. 2004; Abtahi and Nourani 2017; Zhang et al. 2020), and some also pose a threat to human health (Hyde et al. 2018; Iturrieta-González et al. 2020). Endophytes in Pleosporales also show important biocontrol value (Su et al. 2014; De Silva et al. 2019; Hyde et al. 2019), for example, an extract from Cochliobolus spicifer R.R. Nelson has mosquito-larvicidal activity (Abutaha et al. 2015).

The sexual morph of Pleosporales is characterized by uniloculate ascomata typically with papillae, ostioles and pseudoparaphyses, generally fissitunicate asci bearing mostly septate ascospores of different colours and shapes (Ramesh 2003; Kirk et al. 2008; Zhang et al. 2012; Hyde et al. 2013). Coelomycetes and hyphomycetes are the asexual morphs of pleosporalean taxa (Zhang et al. 2012; Hongsanan et al. 2020a). Recent comprehensive studies on Dothideomycetes treated 91 families in Pleosporales (Hongsanan et al. 2020a). More than 40 genera are recognized as genera incertae sedis in Pleosporales (Hongsanan et al. 2020a; Wijayawardene et al. 2020, 2021). This uncertainty in genetic placement occurs for the following reasons: 1) some genera lack sufficient collections even though molecular data is available, they are not included in any families in phylogenetic analyses, eg. Aegeanispora E.B.G. Jones & Abdel-Wahab, Antealophiotrema A. Hashim. & Kaz. Tanaka and Perthomyces Crous (Li et al. 2016; Abdel-Wahab et al. 2017; Crous et al. 2017); 2) due to the diverse morphology of hyphomycetous asexual morphs, it is difficult to determine their familial placement without the sexual morph and molecular data. Examples are Briansuttonia R.F. Castañeda, Minter & Saikawa, Cheiromoniliophora Tzean & J.L. Chen, Dangeardiella Sacc. & P. Syd and Pleosphaerellula Naumov & Czerepan (Obrist 1959; Tóth 1975; Tzean and Chen 1990; Castañeda-Ruiz et al. 2004).

During the examination of collections from medicinal plants in northern Thailand (Sun et al. 2021), two isolates representing a new species were obtained from Clerodendrum quadriloculare and Tarenna stellulata. Morphology and phylogenetic analyses confirmed that it was distinct in Pleosporales, but its familial placement was uncertain. Thus, we introduced a new genus, Pleocatenata (Pleosporales, genera incertae sedis) to accommodate the new species, P. chiangraiensis.

Materials and methods

Collection, examination and isolation

The isolates used in this study were collected from decaying twigs of Clerodendrum quadriloculare and Tarenna stellulata from Mae Fah Luang University, Chiang Rai, Thailand during June to July 2020 in terrestrial habitat. The samples were packaged in envelopes and returned to the laboratory as described in Senanayake et al. (2020). The fruiting bodies on natural substrates were observed and photographed using a stereo-microscope (SteREO Discovery, V12, Carl Zeiss Microscopy GmBH, Germany). Morphological characters were observed using a Nikon ECLIPSE Ni compound microscope (Nikon, Japan) and photographed with a Nikon DS-Ri2 digital camera (Nikon, Japan). The Adobe Photoshop CS6 Extended v. 13.0 software was used to make photo-plates. Measurements were done with the Tarosoft (R) Image Frame Work software.

Single spore isolations were used to obtain pure cultures following the methods described by Senanayake et al. (2020). Germinated conidia were transferred to new potato dextrose agar (PDA) plates and incubated at 26 °C for four weeks. The pure cultures obtained were deposited in Mae Fah Luang University Culture Collection (MFLUCC), Chiang Rai, Thailand. Herbaria materials were deposited in the herbarium of Mae Fah Luang University (MFLU), Chiang Rai, Thailand. Facesoffungi (FoF) and Index Fungorum numbers were acquired as described in Jayasiri et al. (2015) and Index Fungorum (2022).

DNA extraction, PCR amplification and sequencing

Fresh fungal mycelia grown on PDA medium for 4 weeks at 26 °C were scraped with a sterile scalpel. Genomic DNA was extracted from scraped mycelia using the BIOMIGA Fungus Genomic DNA Extraction Kit (GD2416, BIOMIGA, San Diego, California, USA) following the manufacture’s protocol. Five genes were selected in this study: the 28S subunit rDNA (LSU), the 18S subunit rDNA (SSU), the internal transcribed spacers (ITS), the translation elongation factor 1 (tef1-α), and the RNA polymerase II subunit 2 (rpb2). Polymerase chain reaction (PCR) was carried out in 20 μL reaction volume which contained 10 μL 2 × PCR Master Mix, 7 μL ddH2O, 1 μL of each primer, and 1 μL template DNA. The PCR thermal cycle program and primers are given (Table 1). Purification and sequencing of PCR products were carried out at SinoGenoMax (Beijing) Co., China.

Table 1.
Download as
CSV
XLSX

Primers and PCR procedures used in this study.

Locus Primers PCR procedures References
Name Sequence (5’–3’)
Large subunit (LSU) LR0R ACCCGCTGAACTTAAGC 94 °C 3 min; 35 cycles of 94 °C 30 s, 52 °C 30 s, 72 °C 1 min; 72 °C 8 min; 4 °C on hold Vilgalys and Hester (1990), Rehner and Samuels (1994)
LR5 TCCTGAGGGAAACTTCG
Small subunit (SSU) NS1 GTAGTCATATGCTTGTCTC White et al. (1990)
NS4 CTTCCGTCAATTCCTTTAAG
Internal transcribed spacer (ITS) ITS5 GGAAGTAAAAGTCGTAACAAGG
ITS4 TCCTCCGCTTATTGATATGC
Elongation factor-1 alpha (tef1-α) EF1-983F GCYCCYGGHCAYCGTGAYTTYAT 94 °C 2 min; 36 cycles of 66 °C – 56 °C (touchdown 9 cycles), 94 °C 30 sec, 56 °C 1 min, 72 °C 1 min; 72 °C 10 min; 4 °C on hold Rehner and Buckley (2005)
EF1-2218R ATGACACCRACRGCRACRGTYTG
RNA polymerase II subunit (rpb2) fRPB2-5F GAYGAYMGWGATCAYTTYGG 94 °C 3 min; 40 cycles of 94 °C 20 sec, 55 °C 30 sec, 72 °C 1 min; 72 °C 10 min; 4 °C on hold Liu et al. 1999
fRPB2-7cR CCCATRGCTTGYTTRCCCAT

Phylogenetic analyses

BLASTn (https://blast.ncbi.nlm.nih.gov//Blast.cgi) was used to evaluate closely related strains to our new taxa. Other sequences used in this study were obtained from GenBank referring to Zhang et al. (2012, 2018) and Hongsanan et al. (2020a, 2021) (Table 2). The single gene sequences were viewed using BioEdit v. 7.0.9.0 (Hall 1999). Alignments for each locus were generated with MAFFT v.7 (https://mafft.cbrc.jp/alignment/server/) and manually improved using AliView (Larsson 2014) for maximum alignment and minimum gaps. The final single gene alignments were combined by SequenceMatrix 1.7.8 (Vaidya et al. 2011).

Table 2.
Download as
CSV
XLSX

Taxa of Pleosporales used in the phylogenetic analysis with the corresponding GenBank accession numbers. The newly generated strains are indicated in bold. N/A: Not available.

Species names Strain number LSU SSU ITS tef1-α rpb2
Acrocalymma aquatica MFLUCC 11-0208 JX276952 JX276953 JX276951 N/A N/A
Acrocalymma pterocarpi MFLUCC 17-0926 MK347949 MK347840 MK347732 MK360040 N/A
Acuminatispora palmarum MFLUCC 18-0264 MH390437 MH390401 NR_163327 MH399248 N/A
MFLUCC 18-0460 MH390438 MH390402 MN749106 MH399249 N/A
Aigialus grandis BCC 20000 GU479775 GU479739 N/A GU479839 N/A
Alternaria alternata AFTOL ID-1610 DQ678082 KC584507 KF465761 KC584634 KC584375
Amniculicola aquatica MFLUCC 16-1123 MK106096 MK106108 N/A MK109800 N/A
Amorocoelophoma cassia MFLUCC 17-2283 MK347956 NG_065775 MK347739 MK360041 MK434894
Angustimassarina lonicerae MFLUCC 15-0087 KY496724 N/A KY496759 N/A N/A
Anteaglonium parvulum SMH5223 GQ221909 N/A N/A GQ221918 N/A
Aquasubmersa japonica HHUF 30469 NG_057138 NG_062426 NR_154739 LC194384 LC194421
Aquasubmersa mircensis MFLUCC 11-0401 NG_042699 NG_061141 JX276954 N/A N/A
Ascocylindrica marina MD6011 KT252905 KT252907 N/A N/A N/A
MF416 MK007123 MK007124 N/A N/A N/A
Astragalicola vasilyevae MFLUCC 17-0832 MG828986 MG829098 NR_157504 MG829193 MG829248
Astrosphaeriella fusispora MFLUCC 10-0555 KT955462 KT955443 N/A KT955425 KT955413
Atrocalyx acutisporus KT 2436 LC194341 LC194299 LC194475 LC194386 LC194423
Bahusandhika indica GUFCC 18001 KF460274 N/A KF460273 N/A N/A
Bambusicola bambusae MFLUCC 11-0614 JX442035 JX442039 JX442031 N/A KP761718
Berkleasmium crunisia BCC 17023 DQ280271 N/A DQ280265 N/A N/A
Berkleasmium typhae BCC 12536 DQ280275 N/A DQ280264 N/A N/A
Brevicollum hyalosporum MFLUCC 17-0071 MG602200 MG602202 MG602204 MG739516 N/A
Brevicollum versicolor HHUF 30591 NG_058716 NG_065124 NR_156335 LC271246 LC271250
Camarosporidiella caraganicola MFLUCCC 14-0605 KP711381 KP711382 KP711380 N/A N/A
Camarosporium quaternatum CPC 31081 NG_064442 KY929123 NR_159756 KY929201 N/A
Camarosporomyces flavigenus CBS 314.80 GU238076 NG_061093 MH861266 N/A N/A
Coniothyrium palmarum CBS 400.71 JX681084 EU754054 MH860184 N/A KT389592
Corynespora cassiicola CBS 100822 GU301808 GU296144 N/A GU349052 GU371742
Corynespora torulosa CPC 15989 KF777207 N/A NR_145181 N/A N/A
Crassiperidium octosporum MAFF 246406 LC373116 LC373092 LC373104 LC373128 LC373140
Cryptocoryneum japonicum HHUF 30482 NG_059035 NG_065118 NR_153938 LC096144 LC194438
Cryptocoryneum pseudorilstonei CBS 113641 NG_059036 LC194322 NR_153941 LC096152 LC194446
Cucurbitaria berberidis MFLUCC 11-0387 KC506796 KC506800 N/A N/A N/A
Cyclothyriella rubronotata CBS 141486 KX650544 NG_061252 NR_147651 KX650519 KX650574
Cylindroaseptospora leucaenicola MFLUCC 17-2424 MK347966 MK347856 NR_163333 MK360047 N/A
Dacampia engeliana Hafellner 72868 KT383791 N/A N/A N/A N/A
Dacampia hookeri Hafellner 73897 KT383792 N/A N/A N/A N/A
Delitschia chaetomioides SMH 3253.2 GU390656 N/A N/A GU327753 N/A
Delitschia winteri AFTOL ID-1599 DQ678077 DQ678026 N/A DQ677922 DQ677975
Dendryphion fluminicola MFLUCC 17-1689 MG208141 N/A NR_157490 MG207992 N/A
Dictyocheirospora bannica KH 332 AB807513 AB797223 LC014543 AB808489 N/A
Dictyosporium elegans NBRC 32502 DQ018100 DQ018079 DQ018087 N/A N/A
Didymella exigua CBS 183.55 MH868977 GU296147 MH857436 N/A N/A
Didymella rumicicola CBS 683.79 MH873007 N/A KT389503 N/A KT389622
Didymosphaeria rubi-ulmifolii MFLUCC 14-0023 KJ436586 KJ436588 MK646049 N/A N/A
Dimorphosporicola tragani CBS 570.85 KU728536 N/A KU728497 N/A N/A
Dothidotthia aceris MFLUCC 16-1183 MK751816 MK751761 MK751726 N/A N/A
Fissuroma calami MFLUCC 13-0836 MF588993 NG_062430 N/A MF588975 N/A
Flammeascoma bambusae MFLU 11-0143 NG_059553 KP753952 NR_132915 N/A N/A
Flavomyces fulophazii CBS 135761 NG_058131 NG_061191 NR_137960 N/A N/A
Foliophoma fallens CBS 161.78 GU238074 GU238215 KY940772 N/A KC584502
CBS 284.70 GU238078 GU238218 MH859609 N/A N/A
Fuscostagonospora cytisi MFLUCC 16-0622 KY770978 KY770977 N/A KY770979 N/A
Fuscostagonospora sasae HHUF 29106 AB807548 AB797258 AB809636 AB808524 N/A
Fusculina eucalypti CBS 120083 DQ923531 N/A DQ923531 N/A N/A
Fusculina eucalyptorum CBS 145083 MK047499 N/A NR_161140 N/A N/A
Halojulella avicenniae BCC 20173 GU371822 GU371830 N/A GU371815 GU371786
Halotthia posidoniae BBH 22481 GU479786 GU479752 N/A N/A N/A
Hazslinszkyomyces aloes CBS 136437 KF777198 N/A KF777142 N/A N/A
Helminthosporium velutinum L131 KY984352 KY984432 KY984352 KY984463 KY984413
Hermatomyces iriomotensis HHUF 30518 LC194367 LC194325 LC194483 LC194394 LC194449
Hermatomyces tectonae MFLUCC 14-1140 KU764695 KU712465 KU144917 KU872757 KU712486
Hypsostroma caimitalense GKM1165 GU385180 N/A N/A N/A N/A
Hypsostroma saxicola SMH5005 GU385181 N/A N/A N/A N/A
Hysterium angustatum CBS 123334 FJ161207 N/A N/A N/A N/A
Hysterobrevium smilacis CBS 114601 FJ161174 FJ161135 N/A FJ161091 FJ161114
Latorua caligans CBS 576.65 NG_058180 N/A N/A N/A N/A
Latorua grootfonteinensis CBS 369.72 NG_058181 N/A N/A N/A N/A
Lentimurispora urniformis MFLUCC 18-0497 MH179144 MH179160 N/A MH188055 N/A
Lentithecium clioninum HHUF 28199 NG_059391 NG_064845 NR_154137 AB808515 N/A
Lentithecium pseudoclioninum HHUF 29055 NG_059392 NG_064847 AB809633 AB808521 N/A
Lepidosphaeria nicotiae AFTOL ID-1576 DQ678067 N/A N/A DQ677910 DQ677963
Leptosphaeria cichorium MFLUCC 14-1063 KT454712 KT454728 KT454720 N/A N/A
Leucaenicola phraeana MFLUCC 18-0472 MK348003 NG_065784 MK347785 MK360060 MK434867
Libertasomyces myopori CPC 27354 NG_058241 N/A KX228281 N/A N/A
Ligninsphaeria jonesii MFLUCC 15-0641 NG_059642 N/A N/A N/A N/A
Lindgomyces cigarospora G619 KX655804 KX655805 KX655794 N/A N/A
Lindgomyces ingoldianus ATCC 200398 AB521736 NG_016531 NR_119938 N/A N/A
Longiostiolum tectonae MFLUCC 12-0562 KU764700 N/A KU712447 N/A N/A
Longipedicellata aptrootii MFLU 10-0297 KU238894 KU238895 KU238893 KU238892 KU238891
Lophiostoma macrostomum KT508 AB619010 AB618691 N/A LC001751 N/A
Lophiotrema eburnoides KT 1424.1 LC001707 LC001706 LC001709 LC194403 LC194458
Macrodiplodiopsis desmazieri CBS 140062 NG_058182 N/A NR_132924 N/A N/A
Massaria anomia CBS 59178 GU301839 GU296169 N/A N/A GU371769
Massaria inquinans M19 N/A HQ599444 HQ599402 HQ599342 HQ599460
Melanomma japonicum MAFF 239634 NG_060360 NG_065122 NR_154215 LC203367 LC203395
Melanomma pulvis pyrius CBS 124080 MH874873 GU456302 MH863349 GU456265 GU456350
Misturatosphaeria aurantonotata GKM 1238 NG_059927 N/A N/A GU327761 N/A
Morosphaeria muthupetensis NFCCI4219 MF614796 MF614797 MF614795 MF614798 N/A
Morosphaeria velatispora KH221 AB807556 AB797266 LC014572 AB808532 N/A
Multilocularia bambusae MFLUCC 11-0180 KU693438 KU693442 KU693446 N/A N/A
Murispora galii MFLUCC 13-0819 KT709175 KT709182 KT736081 KT709189 N/A
Neocamarosporium goegapense CPC 23676 KJ869220 N/A KJ869163 N/A N/A
Neoconiothyrium persooniae CBS 143175 MG386094 N/A MG386041 N/A N/A
Neomassaria fabacearum MFLUCC 16-1875 KX524145 NG_061245 N/A KX524149 N/A
Neomassaria formosana NTUCC 17-007 MH714756 MH714759 N/A MH714762 MH714765
Neomassarina thailandica MFLU 11-0144 NG_059718 N/A NR154244 N/A N/A
MFLUCC 17-1432 MT214467 MT214420 MT214373 N/A N/A
Neopaucispora rosaecae MFLUCC 17-0807 MG829033 NG_061293 MG828924 MG829217 N/A
Neophaeosphaeria agaves CPC 21264 KF777227 N/A KF777174 N/A N/A
Neophaeosphaeria filamentosa CBS 102202 GQ387577 GQ387516 JF740259 GU349084 GU371773
Neophaeosphaeria phragmiticola KUMCC 16-0216 MG837009 NG_065735 N/A MG838020 N/A
Neoplatysporoides aloes CPC 36068 MN567619 N/A NR_166316 N/A N/A
Neopyrenochaeta cercidis MFLUCC 18-2089 MK347932 MK347823 MK347718 N/A MK434908
Neopyrenochaetopsis hominis UTHSC DI16 238 LN907381 N/A LT592923 N/A LT593061
Neoroussoella bambusae MFLUCC 11-0124 KJ474839 N/A KJ474827 KJ474848 KJ474856
Neotestudina rosatii CBS 690.82 DQ384107 DQ384069 N/A N/A N/A
Neoyrenochaeta acicola CBS 812.95 GQ387602 GQ387541 NR_160055 N/A LT623271
Nigrograna fuscidula CBS 141556 KX650550 N/A NR_147653 KX650525 N/A
Nigrograna mackinnonii CBS 674.75 GQ387613 NG_061081 NR_132037 KF407986 KF015703
Occultibambusa bambusae MFLUCC 13-0855 KU863112 N/A KU940123 KU940193 KU940170
Occultibambusa jonesii GZCC 16-0117 KY628322 KY628324 N/A KY814756 KY814758
Parabambusicola bambusina KH 139 AB807537 AB797247 LC014579 AB808512 N/A
Paradictyoarthrinium aquatica MFLUCC 16-1116 NG_064501 N/A NR_158861 N/A N/A
Paradictyoarthrinium diffractum MFLUCC 13-0466 KP744498 KP753960 KP744455 N/A KX437764
Paralophiostoma hysterioides PUFNI 17617 MT912850 MN582762 MN582758 N/A MT926117
Parapyrenochaeta protearum CBS 131315 JQ044453 N/A JQ044434 N/A LT717683
Periconia delonicis MFLUCC 17-2584 NG_068611 NG_065770 N/A N/A MK434901
Periconia pseudodigitata KT 1395 AB807564 AB797274 LC014591 N/A N/A
Phaeoseptum mali MFLUCC 17-2108 MK625197 N/A MK659580 MK647990 MK647991
Phaeoseptum terricola MFLUCC 10-0102 MH105779 MH105780 MH105778 MH105781 MH105782
Phaeosphaeria oryzae CBS 110110 KF251689 GQ387530 KF251186 N/A KF252193
Phaeosphaeriopsis triseptata MFLUCC 13-0271 KJ522479 KJ522484 KJ522475 MG520919 KJ522485
Plenodomus salvia MFLUCC 13-0219 KT454717 KT454732 KT454725 N/A N/A
Pleocatenatium chiangraiense MFLUCC 21-0222 OL986398 N/A OL986396 OM240638 OM117709
MFLUCC 21-0223 OL986399 N/A OL986397 OM240637 OM117708
Pleohelicoon richonis CBS 282.54 N/A AY856952 MH857332 N/A N/A
Pleomonodictys descalsii FMR 12716 KY853522 N/A KY853461 N/A N/A
Preussia funiculate CBS 659.74 GU301864 GU296187 N/A GU349032 GU371799
Pseudoastrosphaeriella longicolla MFLUCC 11-0171 KT955476 N/A N/A KT955438 KT955420
Pseudoastrosphaeriella thailandensis MFLUCC 11-0144 KT955478 KT955457 N/A KT955440 KT955416
Pseudoberkleasmium chiangmaiense MFLUCC 17-1809 MK131260 N/A MK131259 MK131261 N/A
Pseudoberkleasmium pandanicola KUMCC 17-0178 MH260304 MH260344 MH275071 N/A N/A
Pseudocoleodictyospora tectonae MFLUCC 12-0385 KU764709 NG_061232 NR_154338 N/A KU712491
Pseudocoleodictyospora thailandica MFLUCC 12-0565 KU764701 NG_062417 NR_154337 N/A KU712494
Pseudodidymosphaeria spartii MFLUCC 13-0273 KP325436 KP325438 KP325434 N/A N/A
Pseudopyrenochaeta lycopersici FMR 15746 EU754205 NG_062728 NR_103581 N/A LT717680
Pseudopyrenochaeta terretris FMR 15327 LT623216 N/A LT623228 N/A LT623287
Pseudotetraploa longissima HC 4933 AB524612 AB524471 AB524796 AB524827 N/A
Pseudoxylomyces elegans KT 2887 AB807598 AB797308 LC014593 AB808576 N/A
Pyrenochaetopsis leptospora CBS 101635 GQ387627 NG_063097 JF740262 MF795881 LT623282
Pyrenochaetopsis tabarestanensis IBRC M 30051 KF803343 NG_065034 NR_155636 N/A N/A
Quadricrura bicornis yone 153 AB524613 AB524472 AB524797 AB524828 N/A
Quercicola fusiformis MFLUCC 18-0479 MK348009 MK347898 MK347790 MK360085 MK434864
Quercicola guttulospora MFLUCC 18-0481 MK348010 MK347899 MK347791 MK360086 N/A
Quixadomyces cearensis HUEFS 238438 MG970695 N/A NR_160606 N/A N/A
Roussoella nitidula MFLUCC 11-0634 KJ474842 N/A KJ474834 KJ474851 KJ474858
Salsuginea phoenicis MFLU 19-0015 MK405280 N/A N/A MK404650 N/A
Salsuginea ramicola KT 2597.2 GU479801 GU479768 N/A GU479862 GU479834
Seltsamia ulmi CBS 143002 MF795794 MF795794 MF795794 MF795882 MF795836
Shiraia bambusicola GZAAS2.629 KC460980 N/A GQ845415 N/A N/A
Splanchnonema platani CBS 222.37 KR909316 KR909318 MH855895 KR909319 KR909322
Sporormia fimetaria UPS Dissing Gr.81.194 GQ203729 N/A GQ203769 N/A N/A
Sporormiella isomera CBS 166.73 MH872355 N/A AY943053 N/A N/A
Stemphylium herbarum CBS 191.86 GU238160 GU238232 NR_111243 KC584731 DQ247794
Striatiguttula nypae MFLUCC 18-0265 MK035992 MK035977 MK035969 MK034432 MK034440
Striatiguttula phoenicis MFLUCC 18-0266 MK035995 MK035980 MK035972 MK034435 MK034442
Sublophiostoma thailandica MFLUCC 11-0185 KX534216 KX534222 MW136275 KX550080 MW088718
MFLUCC 11-0207 KX534212 KX534218 MW136257 KX550077 MW088714
Subplenodomus violicola CBS 306.68 MH870849 GU238231 MH859138 N/A N/A
Sulcatispora acerina KT 2982 LC014610 LC014605 LC014597 LC014615 N/A
Sulcatispora berchemiae KT 1607 AB807534 AB797244 AB809635 AB808509 N/A
Sulcosporium thailandica MFLUCC 12-0004 KT426563 KT426564 MG520958 N/A N/A
Teichospora trabicola C134 KU601591 N/A KU601591 KU601601 KU601600
Tetraplosphaeria sasicola KT 563 AB524631 AB524490 AB524807 AB524838 N/A
Thyridaria acaciae CBS 138873 NG_058127 N/A KP004469 N/A N/A
Thyridaria broussonetiae TB1 KX650568 KX650515 KX650568 KX650539 KX650586
Torula aquatica MFLUCC 16-1115 MG208146 N/A MG208167 N/A MG207977
Torula pluriseptata MFLUCC 14-0437 KY197855 KY197862 MN061338 KY197875 KY197869
Tremateia arundicola MFLU 16-1275 KX274248 KX274254 KX274241 KX284706 N/A
Trematosphaeria grisea CBS 332.50 NG_057979 NG_062930 NR_132039 KF015698 KF015720
Trematosphaeria pertusa CBS 122368 NG_057809 FJ201991 NR_132040 KF015701 FJ795476
Tzeanania taiwanensis NTUCC 17-006 MH461121 MH461127 MH461124 MH461131 N/A
Wicklowia aquatica CBS 125634 MH875044 NG_061099 N/A N/A N/A
Wicklowia submersa MFLUCC 18-0373 MK637644 MK637643 N/A N/A N/A
Xenopyrenochaetopsis pratorum CBS 445.81 GU238136 NG_062792 MH861363 N/A KT389671

The single locus and combined analyses were carried out for maximum likelihood (ML) and Bayesian posterior probability (BYPP). The ML analyses were carried out using IQ-TREE (Nguyen et al. 2015; Trifinopoulos et al. 2016) on the IQ-TREE web server (http://iqtree.cibiv.univie.ac.at, 30 September 2021) under partitioned models. The best-fit substitution models were determined by WIQ-TREE (Chernomor et al. 2016): SYM+I+G4 for LSU and SSU; TIM+F+I+G4 for tef1-α; GTR+F+I+G4 for rpb2; TIM2+F+I+G4 for ITS. Ultrafast bootstrap analysis was implemented with 1,000 replicates (Minh et al. 2013; Hoang et al. 2018).

The BYPP analyses were performed in CIPRES (Miller et al. 2010) with MrBayes on XSEDE 3.2.7a (Ronquist et al. 2012). The best nucleotide substitution model for each data partition was evaluated by MrModeltest 2.2 (Nylander 2004). The substitution model GTR+I+G was decided for LSU, SSU, ITS, tef1-α and rpb2 sequences. The Markov chain Monte Carlo (MCMC) sampling approach was used to calculate posterior probabilities (PP) (Rannala and Yang 1996). Six simultaneous Markov chains were run for 10 million generations and trees were sampled every 1,000th generation. The first 20% of trees, representing the burn-in phase of the analyses, were discarded and the remaining trees were used for calculating posterior probabilities (PP) in the majority rule consensus tree.

Phylogenetic trees were viewed using FigTree v1.4.0 (Rambaut and Drummond 2008) and modified in Microsoft Office PowerPoint 2010 and converted to jpg file using Adobe Photoshop CS6 Extended 10.0 (Adobe Systems, San Jose, CA, USA). The new sequences derived from this study were deposited in GenBank. The final alignment and tree were deposited in TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S29199).

Results

Phylogenetic analyses

Blast searches of LSU, tef1-α, rpb2 and ITS sequences data in NCBI showed that our sequences were related to Acrocalymmaceae, Amorosiaceae, Sporormiaceae and Sublophiostomataceae. One hundred and seventy-six taxa, representing all families in Pleosporales, with Hysterium angustatum Alb. & Schwein (CBS 123334) and Hysterobrevium smilacis (Schwein.) E. Boehm & C.L. Schoch (CBS 114601) as the outgroups, were selected for the analyses. The final combined dataset consisted of 4,953 characters (LSU: 1–850 bp, SSU: 851–1,851 bp, tef1-α: 1,852–2,720 bp, rpb2: 2,721–3,701 bp, ITS: 3,702–4,953 bp), including alignment gaps. Among them, 2,336 characters were constant, 608 variable characters were parsimony-uninformative, and 2,009 characters were parsimony informative. The most likely tree (-ln = 98,965.704) is presented (Figure. 1) to show the phylogenetic placement of the newly introduced genus and its relationship with other members in Pleosporales.

Figure 1. 

Maximum likelihood tree generated by IQ-Tree, based on analysis of a combined dataset of LSU, SSU, tef1-α, rpb2 and ITS sequence data. Bootstrap support values for ML greater than 75% and Bayesian posterior probabilities greater than 0.95 are given near nodes, respectively. Ex-type strains are in bold, the new isolates are in red.

Analyses of both ML and BYPP (not shown) yielded almost identical results, and the topology of the trees were similar to previous studies (Zhang et al. 2018; Hongsanan et al. 2020a, 2021). The combined analyses showed that two suborders Massarineae and Pleosporineae were well-supported and formed an upper clade in Pleosporales. Our two newly obtained fungal isolates (MFLUCC 21-0222 and MFLUCC 21-0223) clustered together and formed a distinct clade with maximum support (ML-BS = 100%, BYPP = 1.00) and they grouped with Amorosiaceae, Sporormiaceae and Sublophiostomataceae with weak support.

Taxonomy

Pleocatenata Y.R. Sun, Yong Wang bis & K.D. Hyde, gen. nov.

Index Fungorum number:IF559457
Facesoffungi number: FoF 10630

Etymology

“Pleo-” an abbreviation of Pleosporales, the order in which this fungus is classified; “-catenata” refers to the catenate conidia of this fungus.

Description

Saprobic on decaying twigs in terrestrial habitats. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, dark, velvety. Conidiophores macronematous, mononematous, straight or slightly curved, cylindrical, unbranched, septate, brown or dark brown. Conidiogenous cells monotretic, integrated, terminal, cylindrical, brown to dark brown. Conidia catenate, formed in acropetal chains, straight or bent, obclavate, olivaceous to dark brown, multi-euseptate, slightly constricted at septa, distal conidia rounded at apex, truncate at base, intercalary conidia truncate at both ends, with thickened and darkened scars at base or both ends. Sexual morph: Undetermined.

Type species

Pleocatenata chiangraiensis Y.R. Sun, Yong Wang bis & K.D. Hyde

Notes

The morphology of Pleocatenata is distinguished from members in other families in Pleosporales by its tretic conidiogenous cells and catenate, euseptate conidia, and phylogenic analyses indicated it does not belong to any existing families. To avoid establishing a new family with only one species, Pleocatenata is introduced as a new genus and assigned to Pleosporales, genera incertae sedis. Pleocatenata is a monotypic genus reported from terrestrial habitats but without a known sexual morph. Further discovery of other species in Pleocatenata or phylogenetic related genera with supported monophyly will determine the familial level of Pleocatenata.

Pleocatenata chiangraiensis Y.R. Sun, Yong Wang bis & K.D. Hyde, sp. nov.

Index Fungorum number:IF559458
Facesoffungi number: FoF 10631
Fig. 2

Etymology

The epithet referring to the location in which the fungus was collected.

Holotype

MFLU: 22-0002

Description

Saprobic on twigs of Clerodendrum quadriloculare and Tarenna stellulata. Asexual morph: Hyphomycetous. Colonies on natural substrate effuse, dark, velvety. Mycelium immersed, composed of septate, branched, hyaline to subhyaline hyphae. Conidiophores macronematous, mononematous, erect, straight or slightly curved, cylindrical, unbranched, robust, 4–6-septate, brown or dark brown, rough, 35–100 µm long, 5.5–8.5 µm wide. Conidiogenous cells monotretic, integrated, terminal, determinate, cylindrical, dark brown. Conidia catenate, formed in acropetal chains of 2–3, straight or curved, obclavate, olivaceous to brown when young, blackish brown when mature, 5–8-euseptate, slightly constricted at septa, distal conidia rounded at apex, truncate at base, intercalary conidia truncate at both ends, with thickened and darkened scars at base or both ends, 34–70 µm long, 6.5–12 µm at the widest. Sexual morph: Unknown.

Figure 2. 

Pleocatenata chiangraiensis (MFLU 22-0002, holotype) a host (Tarenna stellulata) b, c colonies on natural substrate d, e conidiophores with conidia f conidiogenous cells g–k conidia l germinated conidium m, n colonies on PDA (upper view and lower view). Scale bars: 1 mm (b); 100 μm (c); 20 μm (d–l).

Culture characteristics

Conidia germinated on PDA within 12 hours at 26 °C. Germ tubes were produced from both ends. Colony reached 20–25 mm diameter after 4 weeks at room temperature on PDA media. Mycelia superficial, irregularly circular, entire edge, dark brown from above, black from below, pigment produced which turns the media reddish brown.

Material examined

Thailand, Chiang Rai Province, Mae Fah Luang University, on twigs of Tarenna stellulata, 3 July 2020, Y.R. Sun, MFU5 (MFLU 22-0002, holotype, ex-type living culture MFLUCC 21-0222). Thailand, Chiang Rai Province, Medicinal Plants Garden, on twigs of Clerodendrum quadriloculare, 7 June 2020, Y.R. Sun, B45 (MFLU 22-0001, living culture MFLUCC 21-0223).

Notes

Two isolates collected from different hosts share similar morphology and clustered together in the phylogenic tree. There are no base pair differences in LSU and tef1-α genes between these two isolates. One base pair and two base pair differences (without gaps) are observed in ITS and rpb2, respectively. Therefore, the two isolates MFLUCC 21-0222 and MFLUCC 21-0223 are identified as conspecific.

Discussion

Pleocatenata is phylogenetically related to Amorosiaceae, Sporormiaceae, and Sublophiostomataceae in our multi-gene analyses, but their monophyly was not well-supported, indicating their uncertain phylogenetic affinities. No hyphomycetous asexual morph has been reported in Sporormiaceae or Sublophiostomataceae (Hongsanan et al. 2020a, 2021). However, in Amorosiaceae, only two known hyphomycetous genera, Amorosia and Angustimassarina, are characterized by micronematous to semimacronematous, pale brown conidiophores, monoblastic conidiogenous cells, and single, elongate-clavate conidia (Mantle et al. 2006; Thambugala et al. 2015; Hongsanan et al. 2020a). Pleocatenata can be distinguished from these two genera by having monotretic conidiogenous cells and catenate, obclavate conidia.

A recently introduced species, Corynespora sinensis Jian Ma, X.G. Zhang & R.F. Castañeda, resembles Pleocatenata in its unbranched, cylindrical conidiophores and monotretic, terminal conidiogenous cells that produce catenate, obclavate conidia (Xu et al. 2020). Morphologically, Corynespora sinensis is more similar to P. chiangraiensis than to the type species of Corynespora, C. cassiicola (Berk. & M.A. Curtis) C.T. Wei (Wei 1950). Since Corynespora (Corynesporascaceae, Pleosporales) is a polyphyletic genus (Schoch et al. 2009; Voglmayr and Jaklitsch 2017), and there is no available sequence data for C. sinensis, we presume that C. sinensis may belong to Pleocatenata. However, due to lack of molecular data, and since morphology-based classification is not reliable for many hyphomycetous genera (Shenoy et al. 2006; Su et al. 2016; Yang et al. 2018), we retain the current classification. Sequences of C. sinensis are needed to resolve its phylogenetic placement. Detailed morphological comparison among C. cassiicola, C. sinensis and P. chiangraiensis is provided (Table 3).

Table 3.
Download as
CSV
XLSX

Comparison between Corynespora cassiicola, C. sinensis, and Pleocatenata chiangraiensis.

Species Conidiophores Conidiogenous cells Conidia References
Corynespora cassiicola Unbranched, cylindrical proliferations, pale to mid brown, up to 9 septate, 110–850 × 4–11 µm Monotretic, cylindrical, pale to mid brown Solitary or in chains of 2–6, obclavate to cylindrical, subhyaline to pale olivaceous brown or brown, 4–20 distoseptate, 40–220 × 9–22 µm Wei 1950
Corynespora sinensis (HJAUP M0156) Unbranched, cylindrical, brown to dark, 4–8-septate, 53–96.5 × 7–8.5 µm Monotretic, cylindrical, brown, In chains of 2, primary conidia obclavate or fusiform, 3(–4)-distoseptate, 31.5–42 × 8–9.5 µm. secondary conidia ellipsoid, 3-distoseptate, 21–28.5 × 8–9.5 µm Xu et al. 2020
Pleocatenata chiangraiensis (MFLU 21-0222) Unbranched, cylindrical, brown or dark brown, 4–6-septate, 35–100 × 5.5–8.5 µm Monotretic, cylindrical, dark brown In chains of 2–3, obclavate, olivaceous to brown when young, blackish brown when mature, 5–8-euseptate, 34–70 µm × 6.5–12 µm This study

Pleocatenata is similar to Sporidesmium sensu stricto, which is characterized by distinctive, unbranched conidiophores, monoblastic, determinate or proliferating conidiogenous cells, and acrogenous, solitary, transversely septate conidia (Ellis 1958, 1971; Shenoy et al. 2006; Boonmee et al. 2012; Su et al. 2016; Yang et al. 2018). However, Pleocatenata is different from Sporidesmium by having catenate conidia. Additionally, Pleocatenata is phylogenetically distinct from Sporidesmium, supporting the introduction of the new genus.

The catenate, obclavate phragmoconidia of P. chiangraiensis are similar to capnodendron asexual morph of Antennulariella Woron (Antennulariellaceae, Capnodiales) (Hughes 1976, 2000; Seifert et al. 2011). Although sequence data of Antennulariella is not available, morphological characters, such as holoblastic conidiogenous cells and branched conidiophores of Antennulariella, support its separation from P. chiangraiensis (Hughes 1976, 2000; Seifert et al. 2011). Pleocatenata is also similar to Corynesporina Subram (Pezizomycotina, incertae sedis) in having unbranched, robust conidiophores and catenate conidia (Seifert et al. 2011). However, they differ in that the distoseptate conidia form in basipetal chains in Corynesporina and euseptate conidia form in acropetal chains in Pleocatenata.

Acknowledgements

We would like to thank Dr. Shaun Pennycook for checking the nomenclature. Ya-Ru Sun thanks Mae Fah Luang University for the award of a fee-less scholarship. Ya-Ru Sun also thanks the director of the Mae Fah Luang University Botanical Garden, the botanist Dr. Jantrararuk Tovaranonte for her support. The study was funded by Guizhou Science Technology Department International Cooperation Basic project ([2018]5806), National Natural Science Foundation of China (No.31972222, 31560489), Program of Introducing Talents of Discipline to Universities of China (111 Program, D20023), and Talent project of Guizhou Science and Technology Cooperation Platform ([2017]57885, [2019]5641 and [2020]5001).

References

  • Abtahi F, Nourani SL (2017) The most important fungal diseases associated with some useful medicinal plants. In: Ghorbanpour M, Varma A (Eds) Medicinal plants and environmental challenges. Springer International Publishing, Cham, 279–293. https://doi.org/10.1007/978-3-319-68717-9_16
  • Abutaha N, Mashaly AM, Al-Mekhlafi FA, Farooq M, Al-shami M, Wadaan MA (2015) Larvicidal activity of endophytic fungal extract of Cochliobolus spicifer (Pleosporales: Pleosporaceae) on Aedes caspius and Culex pipiens (Diptera: Culicidae). Applied Entomology and Zoology 50: 405–414. https://doi.org/10.1007/s13355-015-0347-6
  • Barr ME (1987) Prodromus to class Loculoascomycetes. Amherst. University of Massachusetts, Massachusetts.
  • Bhagat J, Kaur A, Sharma M, Saxena AK, Chadha BS (2012) Molecular and functional characterization of endophytic fungi from traditional medicinal plants. World Journal of Microbiology and Biotechnology 28: 963–971. https://doi.org/10.1007/s11274-011-0894-0
  • Bonnardeaux Y, Brundrett M, Batty A, Dixon K, Koch J, Sivasithamparam K (2007) Diversity of mycorrhizal fungi of terrestrial orchids: compatibility webs, brief encounters, lasting relationships and alien invasions. Mycological Research 111: 51–61. https://doi.org/10.1016/j.mycres.2006.11.006
  • Boonmee S, Ko TWK, Chukeatirote E, Hyde KD, Chen H, Cai L, McKenzie EHC, Jones EBG, Kodsueb R, Hassan BA (2012) Two new Kirschsteiniothelia species with Dendryphiopsis anamorphs cluster in Kirschsteiniotheliaceae fam. nov. Mycologia 104: 698–714. https://doi.org/10.3852/11-089
  • Castañeda-Ruiz RF, Heredia GP, Arias RM, Saikawa M, Minter DW, Stadler M, Guarro J, Decock C (2004) Two new hyphomycetes from rainforests of México, and Briansuttonia, a new genus to accommodate Corynespora alternarioides. Mycotaxon 89: 297–305.
  • Chernomor O, Von Haeseler A, Minh BQ (2016) Terrace aware data structure for phylogenomic inference from supermatrices. Systematic Biology 65: 997–1008. https://doi.org/10.1093/sysbio/syw037
  • Chomnunti P, Hongsanan S, Aguirre-Hudson B, Tian Q, Peršoh D, Dhami MK, Alias AS, Xu JC, Liu XZ, Stadler M, Hyde KD (2014) The sooty moulds. Fungal Diversity 66: 1–36. https://doi.org/10.1007/s13225-014-0278-5
  • Crous PW, Wingfield MJ, Burgess TI, Hardy GESJ, Barber PA, Alvarado P, Barnes CW, Buchanan PK, Heykoop M, Moreno G, Thangavel R, van der Spuy S, Barili A, Barrett S, Cacciola SO, Cano-Lira JF, Crane C, Decock C, Gibertoni TB, Guarro J, Guevara-Suarez M, Hubka V, Kolařík M, Lira CRS, Ordoñez ME, Padamsee M, Ryvarden L, Soares AM, Stchigel AM, Sutton DA, Vizzini A, Weir BS, Acharya K, Aloi F, Baseia IG, Blanchette RA, Bordallo JJ, Bratek Z, Butler T, Cano-Canals J, Carlavilla JR, Chander J, Cheewangkoon R, Cruz RHSF, da Silva M, Dutta AK, Ercole E, Escobio V, Esteve-Raventós F, Flores JA, Gené J, Góis JS, Haines L, Held BW, Jung MH, Hosaka K, Jung T, Jurjević Ž, Kautman V, Kautmanova I, Kiyashko AA, Kozanek M, Kubátová A, Lafourcade M, La Spada F, Latha KPD, Madrid H, Malysheva EF, Manimohan P, Manjón JL, Martín MP, Mata M, Merényi Z, Morte A, Nagy I, Normand AC, Paloi S, Pattison N, Pawłowska J, Pereira OL, Petterson ME, Picillo B, Raj KNA, Roberts A, Rodríguez A, Rodríguez-Campo FJ, Romański M, Ruszkiewicz-Michalska M, Scanu B, Schena L, Semelbauer M, Sharma R, Shouche YS, Silva V, Staniaszek-Kik M, Stielow JB, Tapia C, Taylor PWJ, Toome-Heller M, Vabeikhokhei JMC, van Diepeningen AD, Van Hoa N, M VT, Wiederhold NP, Wrzosek M, Zothanzama J, Groenewald JZ (2017) Fungal Planet description sheets: 558–624. Persoonia 38: 240–384. https://doi.org/10.3767/003158517X698941
  • Ellis MB (1958) Clasterosporium and some allied Dematiaceae Phragmosporae: I. Mycological Papers 7: 1–89.
  • Ellis MB (1971) Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.
  • Ferdinandez HS, Manamgoda DS, Udayanga D, Deshappriya N, Munasinghe MS, Castlebury LA (2021) Molecular phylogeny and morphology reveal three novel species of Curvularia (Pleosporales, Pleosporaceae) associated withcereal crops and weedy grass hosts. Mycological Progress 20: 431–451. https://doi.org/10.1007/s11557-021-01681-0
  • Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. In, 95–98.
  • Hashimoto A, Matsumura M, Hirayama K, Tanaka K (2017) Revision of Lophiotremataceae (Pleosporales, Dothideomycetes): Aquasubmersaceae, Cryptocoryneaceae, and Hermatomycetaceae fam. nov. Persoonia 39: 51–73. https://doi.org/10.3767/persoonia.2017.39.03
  • Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518–522. https://doi.org/10.1093/molbev/msx281
  • Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Boonmee S, Lücking R, Bhat DJ, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang SH, Jones EBG, Phillips AJL, Manawasinghe IS, Tibpromma S, Jayasiri SC, Sandamali DS, Jayawardena RS, Wijayawardene NN, Ekanayaka AH, Jeewon R, Lu YZ, Dissanayake AJ, Zeng XY, Luo ZL, Tian Q, Phukhamsakda C, Thambugala KM, Dai DQ, Chethana KWT, Samarakoon MC, Ertz D, Bao DF, Doilom M, Liu JK, Pérez-Ortega S, Suija A, Senwanna C, Wijesinghe SN, Konta S, Niranjan M, Zhang SN, Ariyawansa HA, Jiang HB, Zhang JF, Norphanphoun C, de Silva NI, Thiyagaraja V, Zhang H, Bezerra JDP, Miranda-González R, Aptroot A, Kashiwadani H, Harishchandra D, Sérusiaux E, Aluthmuhandiram JVS, Abeywickrama PD, Devadatha B, Wu HX, Moon KH, Gueidan C, Schumm F, Bundhun D, Mapook A, Monkai J, Chomnunti P, Suetrong S, Chaiwan N, Dayarathne MC, Yang J, Rathnayaka AR, Bhunjun CS, Xu JC, Zheng JS, Liu G, Feng Y, Xie N (2020a) Refined families of Dothideomycetes: Dothideomycetidae and Pleosporomycetidae. Mycosphere 11: 1553–2107. https://doi.org/10.5943/mycosphere/11/1/13
  • Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Lücking R, Boonmee S, Bhat JD, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang SH, Jones GEB, Phillips AJL, Manawasinghe IS, Tibpromma S, Jayasiri SC, Sandamali D, Jayawardena RS, Wijayawardene NN, Ekanayaka AH, Jeewon R, Lu YZ, Phukhamsakda C, Dissanayake AJ, Zeng XY, Luo ZL, Tian Q, Thambugala KM, Dai D, Samarakoon MC, Chethana KWT, Ertz D, Doilom M, Liu JK, Pérez-Ortega S, Suija A, Senwanna C, Wijesinghe SN, Niranjan M, Zhang SN, Ariyawansa HA, Jiang HB, Zhang J-F, Norphanphoun C, de Silva NI, Thiyagaraja V, Zhang H, Bezerra JDP, Miranda-González R, Aptroot A, Kashiwadani H, Harishchandra D, Sérusiaux E, Abeywickrama PD, Bao D-F, Devadatha B, Wu HX, Moon KH, Gueidan C, Schumm F, Bundhun D, Mapook A, Monkai J, Bhunjun CS, Chomnunti P, Suetrong S, Chaiwan N, Dayarathne MC, Yang J, Rathnayaka AR, Xu JC, Zheng J, Liu G, Feng Y, Xie N (2020b) Refined families of Dothideomycetes: orders and families incertae sedis in Dothideomycetes. Fungal Diversity 105: 17–318. https://doi.org/10.1007/s13225-020-00462-6
  • Hongsanan S, Phookamsak R, Goonasekara ID, Thambugala KM, Hyde KD, Bhat JD, Suwannarach N, Cheewangkoon R (2021) Introducing a new pleosporalean family Sublophiostomataceae fam. nov. to accommodate Sublophiostoma gen. nov. Scientific Reports 11: e9496. https://doi.org/10.1038/s41598-021-88772-w
  • Huang WY, Cai YZ, Hyde KD, Corke H, Sun M (2008) Biodiversity of endophytic fungi associated with 29 traditional Chinese medicinal plants. Fungal Diversity 33: 61–75.
  • Hughes SJ (2000) Antennulariella batistae n. sp. and its Capnodendron and Antennariella synanamorphs, with notes on Capnodium capsuliferum. Canadian Journal of Botany 78: 1215–1226. https://doi.org/10.1139/b00-098
  • Hyde KD, Jones EBG, Liu JK, Ariyawansa H, Boehm E, Boonmee S, Braun U, Chomnunti P, Crous PW, Dai DQ, Diederich P, Dissanayake A, Doilom M, Doveri F, Hongsanan S, Jayawardena R, Lawrey JD, Li YM, Liu YX, Lücking R, Monkai J, Muggia L, Nelsen MP, Pang KL, Phookamsak R, Senanayake IC, Shearer CA, Suetrong S, Tanaka K, Thambugala KM, Wijayawardene NN, Wikee S, Wu HX, Zhang Y, Aguirre-Hudson B, Alias SA, Aptroot A, Bahkali AH, Bezerra JL, Bhat DJ, Camporesi E, Chukeatirote E, Gueidan C, Hawksworth DL, Hirayama K, De Hoog S, Kang JC, Knudsen K, Li WJ, Li XH, Liu ZY, Mapook A, McKenzie EHC, Miller AN, Mortimer PE, Phillips AJL, Raja HA, Scheuer C, Schumm F, Taylor JE, Tian Q, Tibpromma S, Wanasinghe DN, Wang Y, Xu JC, Yacharoen S, Yan JY, Zhang M (2013) Families of Dothideomycetes. Fungal Diversity 63: 1–313. https://doi.org/10.1007/s13225-013-0263-4
  • Hyde KD, Chaiwan N, Norphanphoun C, Boonmee S, Camporesi E, Chethana KWT, Dayarathne MC, de Silva NI, Dissanayake AJ, Ekanayaka AH, Hongsanan S, Huang SK, Jayasiri SC, Jayawardena RS, Jiang HB, Karunarathna A, Lin CG, Liu JK, Liu NG, Lu YZ, Luo ZL, Maharachchimbura SSN, Manawasinghe IS, Pem D, Perera RH, Phukhamsakda C, Samarakoon MC, Senwanna C, Shang QJ, Tennakoon DS, Thambugala KM, Tibpromma S, Wanasinghe DN, Xiao YP, Yang J, Zeng XY, Zhang JF, Zhang SN, Bulgakov TS, Bhat DJ, Cheewangkoon R, Goh TK, Jones EBG, Kang JC, Jeewon R, Liu ZY, Lumyong S, Kuo CH, McKenzie EHC, Wen TC, Yan JY, Zhao Q (2018) Mycosphere notes 169–224. Mycosphere 9: 271–430. https://doi.org/10.5943/mycosphere/9/2/8
  • Hyde KD, Xu JC, Rapior S, Jeewon R, Lumyong S, Niego AGT, Abeywickrama PD, Aluthmuhandiram JVS, Brahamanage RS, Brooks S, Chaiyasen A, Chethana KWT, Chomnunti P, Chepkirui C, Chuankid B, de Silva NI, Doilom M, Faulds C, Gentekaki E, Gopalan V, Kakumyan P, Harishchandra D, Hemachandran H, Hongsanan S, Karunarathna A, Karunarathna SC, Khan S, Kumla J, Jayawardena RS, Liu JK, Liu NG, Luangharn T, Macabeo APG, Marasinghe DS, Meeks D, Mortimer PE, Mueller P, Nadir S, Nataraja KN, Nontachaiyapoom S, O’Brien M, Penkhrue W, Phukhamsakda C, Ramanan US, Rathnayaka AR, Sadaba RB, Sandargo B, Samarakoon BC, Tennakoon DS, Siva R, Sriprom W, Suryanarayanan TS, Sujarit K, Suwannarach N, Suwunwong T, Thongbai B, Thongklang N, Wei D, Wijesinghe SN, Winiski J, Yan J, Yasanthika E, Stadler M (2019) The amazing potential of fungi: 50 ways we can exploit fungi industrially. Fungal Diversity 97: 1–136. https://doi.org/10.1007/s13225-019-00430-9
  • Hyde KD, Dong Y, Phookamsak R, Jeewon R, Bhat DJ, Jones EBG, Liu NG, Abeywickrama PD, Mapook A, Wei DP, Perera RH, Manawasinghe IS, Pem D, Bundhun D, Karunarathna A, Ekanayaka AH, Bao DF, Li JF, Samarakoon MC, Chaiwan N, Lin CG, Phutthacharoen K, Zhang SN, Senanayake IC, Goonasekara ID, Thambugala KM, Phukhamsakda C, Tennakoon DS, Jiang HB, Yang J, Zeng M, Huanraluek N, Liu JK, Wijesinghe SN, Tian Q, Tibpromma S, Brahmanage RS, Boonmee S, Huang SK, Thiyagaraja V, Lu YZ, Jayawardena RS, Dong W, Yang EF, Singh SK, Singh SM, Rana S, Lad SS, Anand G, Devadatha B, Niranjan M, Sarma VV, Liimatainen K, Aguirre-Hudson B, Niskanen T, Overall A, Alvarenga RLM, Gibertoni TB, Pfliegler WP, Horváth E, Imre A, Alves AL, da Silva Santos AC, Tiago PV, Bulgakov TS, Wanasinghe DN, Bahkali AH, Doilom M, Elgorban AM, Maharachchikumbura SSN, Rajeshkumar KC, Haelewaters D, Mortimer PE, Zhao Q, Lumyong S, Xu J, Sheng J (2020) Fungal diversity notes 1151–1276: taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Diversity 100: 5–277. https://doi.org/10.1007/s13225-020-00439-5
  • Iturrieta‐González I, Pujol I, Iftimie S, García D, Morente V, Queralt R, Guevara-Suarez M, Alastruey‐Izquierdo A, Ballester F, Hernández-Restrepo M (2020) Polyphasic identification of three new species in Alternaria section Infectoriae causing human cutaneous infection. Mycoses 63: 212–224. https://doi.org/10.1111/myc.13026
  • Jayasiri SC, Hyde KD, Ariyawansa HA, Bhat J, Buyck B, Cai L, Dai YC, Abd-Elsalam KA, Ertz D, Hidayat I, Jeewon R, Jones EBG, Bahkali AH, Karunarathna SC, Liu JK, Luangsa-ard JJ, Lumbsch HT, Maharachchikumbura SSN, McKenzie EHC, Moncalvo JM, Ghobad-Nejhad M, Nilsson H, Pang KL, Pereira OL, Phillips AJL, Raspé O, Rollins AW, Romero AI, Etayo J, Selçuk F, Stephenson SL, Suetrong S, Taylor JE, Tsui CKM, Vizzini A, Abdel-Wahab MA, Wen TC, Boonmee S, Dai DQ, Daranagama DA, Dissanayake AJ, Ekanayaka AH, Fryar SC, Hongsanan S, Jayawardena RS, Li WJ, Perera RH, Phookamsak R, de Silva NI, Thambugala KM, Tian Q, Wijayawardene NN, Zhao RL, Zhao Q, Kang JC, Promputtha I (2015) The Faces of Fungi database: fungal names linked with morphology, phylogeny and human impacts. Fungal Diversity 74: 3–18. https://doi.org/10.1007/s13225-015-0351-8
  • Kirk PM, Cannon PF, Minter DW, Staplers JA (2008) Dictionary of the Fungi 10th edn. CABI Bioscience, UK.
  • Li GJ, Hyde KD, Zhao RL, Hongsanan S, Abdel-Aziz FA, Abdel-Wahab MA, Alvarado P, Alves-Silva G, Ammirati JF, Ariyawansa HA, Baghela A, Bahkali AH, Beug M, Bhat DJ, Bojantchev D, Boonpratuang T, Bulgakov TS, Camporesi E, Boro MC, Ceska O, Chakraborty D, Chen JJ, Chethana KWT, Chomnunti P, Consiglio G, Cui BK, Dai DQ, Dai YC, Daranagama DA, Das K, Dayarathne MC, De Crop E, De Oliveira RJV, de Souza CAF, de Souza JI, Dentinger BTM, Dissanayake AJ, Doilom M, Drechsler-Santos ER, Ghobad-Nejhad M, Gilmore SP, Góes-Neto A (2016) Fungal diversity notes 253–366: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 78: 1–237. https://doi.org/10.1007/s13225-016-0366-9
  • Li H, Sun G, Batzer JC, Crous PW, Groenewald JZ, Karakaya A, Gleason ML (2011) Scleroramularia gen. nov. associated with sooty blotch and flyspeck of apple and pawpaw from the Northern Hemisphere. Fungal Diversity 46: 53–66. https://doi.org/10.1007/s13225-010-0074-9
  • Ma XY, Maharachchikumbura SSN, Chen BW, Hyde KD, McKenzie EHC, Chomnunti P, Kang JC (2019) Endophytic pestalotiod taxa in Dendrobium orchids. Phytotaxa 419: 268–286. https://doi.org/10.11646/phytotaxa.419.3.2
  • Mantle PG, Hawksworth DL, Pazoutova S, Collinson LM, Rassing BR (2006) Amorosia littoralis gen. sp. nov., a new genus and species name for the scorpinone and caffeine-producing hyphomycete from the littoral zone in The Bahamas. Mycological Research 110: 1371–1378. https://doi.org/10.1016/j.mycres.2006.09.013
  • Mathiyazhagan S, Kavitha K, Nakkeeran S, Chandrasekar G, Manian K, Renukadevi P, Krishnamoorthy AS, Fernando WGD (2004) PGPR mediated management of stem blight of Phyllanthus amarus (Schum and Thonn) caused by Corynespora cassiicola (Berk and Curt) Wei. Archives of Phytopathology and Plant Protection 37: 183–199. https://doi.org/10.1080/03235400410001730658
  • Miller MA, Pfeiffer W, Schwartz T (2010) “Creating the CIPRES Science Gateway for inference of large phylogenetic trees” in Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA, 1–8. https://doi.org/10.1109/GCE.2010.5676129
  • Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. https://doi.org/10.1093/molbev/msu300
  • Nylander JAA (2004) MrModeltest v2.2. Program distributed by the author: 2. Evolutionary Biology Centre, Uppsala University, 1–2.
  • Ramesh C (2003) Loculoascomycetes from India. Rao GP, Manoharachari C, Bhat DJ (Eds) Frontiers of Fungal Diversity in India, International Book Distributing Company, Lucknow, India, 457–479.
  • Rambaut A, Drummond A (2008) FigTree: Tree figure drawing tool, version 1.2. 2. Institute of Evolutionary Biology, University of Edinburgh.
  • Rannala B, Yang ZH (1996) Probability distribution of molecular evolutionary trees: A new method of phylogenetic inference. Journal of Molecular Evolution 43: 304–311. https://doi.org/10.1007/BF02338839
  • Rehner SA, Buckley E (2005) A beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97(1): 84–98. https://doi.org/10.1080/15572536.2006.11832842
  • Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schoch C, Crous PW, Groenewald JZ, Boehm E, Burgess TI, De Gruyter J, De Hoog GS, Dixon L, Grube M, Gueidan C (2009) A class-wide phylogenetic assessment of Dothideomycetes. Studies in Mycology 64: 1–15. https://doi.org/10.3114/sim.2008.61.08
  • Seifert K, Morgan-Jones G, Gams W, Kendrick B (2011) The genera of hyphomycetes. CBS–KNAW Fungal Biodiversity Centre, Utrecht.
  • Senanayake IC, Rathnayake AR, Marasinghe DS, Calabon MS, Gentekaki E, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS, Jayawardena RS, Wanasinghe DN, Jeewon R, Bhat DJ, Xiang MM (2020) Morphological approaches in studying fungi: collection, examination, isolation, sporulation and preservation. Mycosphere 11: 2678–2754. https://doi.org/10.5943/mycosphere/11/1/20
  • Shenoy BD, Jeewon R, Wu WP, Bhat DJ, Hyde KD (2006) Ribosomal and RPB2 DNA sequence analyses suggest that Sporidesmium and morphologically similar genera are polyphyletic. Mycological Research 110: 916–928. https://doi.org/10.1016/j.mycres.2006.06.004
  • Strobel G, Stierle A, Stierle D, Hess WM (1993) Taxomyces andreanae, a proposed new taxon for a bulbilliferous hyphomycete associated with Pacific Yew (Taxus brevifolia). Mycotaxon. 47: 71–80.
  • Su H, Kang JC, Cao JJ, Mo L, Hyde KD (2014) Medicinal plant endophytes produce analogous bioactive compounds. Chiang Mai Journal Science 41: 1–13.
  • Su HY, Hyde KD, Maharachchikumbura SSN, Ariyawansa HA, Luo ZL, Promputtha I, Tian Q, Lin CG, Shang QJ, Zhao YC, Chai HM, Liu XY, Bahkali AH, Bhat JD, McKenzie EHC, Zhou DQ (2016) The families Distoseptisporaceae fam. nov., Kirschsteiniotheliaceae, Sporormiaceae and Torulaceae, with new species from freshwater in Yunnan Province, China. Fungal Diversity 80: 375–409. https://doi.org/10.1007/s13225-016-0362-0
  • Sun JZ, Liu XZ, McKenzie EHC, Jeewon R, Liu JK, Zhang XL, Zhao Q, Hyde KD (2019) Fungicolous fungi: terminology, diversity, distribution, evolution, and species checklist. Fungal Diversity 95: 337–430. https://doi.org/10.1007/s13225-019-00422-9
  • Tan YP, Crous PW, Shivas RG (2016) Eight novel Bipolaris species identified from John L. Alcorn’s collections at the Queensland Plant Pathology Herbarium (BRIP). Mycological Progress 15: 1203–1214. https://doi.org/10.1007/s11557-016-1240-6
  • Tennakoon DS, Kuo CH, Maharachchikumbura SSN, Thambugala KM, Gentekaki E, Phillips AJL, Bhat DJ, Wanasinghe DN, de Silva NI, Promputtha I, Hyde KD (2021) Taxonomic and phylogenetic contributions to Celtis formosana, Ficus ampelas, F. septica, Macaranga tanarius and Morus australis leaf litter inhabiting microfungi. Fungal Diversity 108: 1–215. https://doi.org/10.1007/s13225-021-00474-w
  • Thambugala KM, Hyde KD, Tanaka K, Tian Q, Wanasinghe DN, Ariyawansa HA, Jayasiri SC, Boonmee S, Camporesi E, Hashimoto A, Hirayama K, Schumacher RK, Promputtha I, Liu ZY (2015) Towards a natural classification and backbone tree for Lophiostomataceae, Floricolaceae, and Amorosiaceae fam. nov. Fungal Diversity 74: 199–266. https://doi.org/10.1007/s13225-015-0348-3
  • Tóth S (1975) Some new microscopic fungi, III. Annales Historico-naturales Musel nationalis Hungarici 67: 31–35.
  • Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ (2016) W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44: W232–W235. https://doi.org/10.1093/nar/gkw256
  • Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
  • Wei CT (1950) Notes on Corynespora. Mycological Papers 34, 10 pp.
  • White TJ, Bruns T, Lee SJWT, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M, Gelfand D, Shinsky J, White T (Eds) PCR protocols: a guide to methods and applications. Academic Press, New York, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Wijayawardene NN, Crous PW, Kirk PM, Hawksworth DL, Boonmee S, Braun U, Dai DQ, D’souza MJ, Diederich P, Dissanayake A, Doilom M, Hongsanan S, Jones EBG, Groenewald JZ, Jayawardena R, Lawrey JD, Liu JK, Lücking R, Madrid H, Manamgoda DS, Muggia L, Nelsen MP, Phookamsak R, Suetrong S, Tanaka K, Thambugala KM, Wanasinghe DN, Wikee S, Zhang Y, Aptroot A, Ariyawansa HA, Bahkali AH, Bhat DJ, Gueidan C, Chomnunti P, De Hoog GS, Knudsen K, Li WJ, McKenzie EHC, Miller AN, Phillips AJL, Piątek M, Raja HA, Shivas RS, Slippers B, Taylor JE, Tian Q, Wang Y, Woudenberg JHC, Cai L, Jaklitsch WM, Hyde KD (2014) Naming and outline of Dothideomycetes–2014 including proposals for the protection or suppression of generic names. Fungal Diversity 69: 1–55. https://doi.org/10.1007/s13225-014-0309-2
  • Wijayawardene NN, Hyde KD, Al-Ani LKT, Tedersoo L, Haelewaters D, Rajeshkumar KC, Zhao RL, Aptroot A, Leontyev D, Saxena RK, Tokarev YS, Dai DQ, Letcher PM, Stephenson SL, Ertz D, Lumbsch HT, Kukwa M, Issi IV, Madrid H, Phillips AJL, Selbmann L, Pfliegler WP, Horváth E, Bensch K, Kirk PM, Kolaříková K, Raja HA, Radek R, Papp V, Dima V, Ma J, Malosso E, Takamatsu S, Rambold G, Gannibal PB, Triebel D, Gautam AK, Avasthi S, Suetrong S, Timdal E, Fryar SC, Delgado G, Réblová M, Doilom M, Dolatabadi S, Pawłowska JZ, Humber RA, Kodsueb R, Sánchez-Castro I, Goto BT, Silva DKA, de Souza FA, Oehl F, da Silva GA, Silva IR, Błaszkowski J, Jobim K, Maia LC, Barbosa FR, Fiuza PO, Divakar PK, Shenoy BD, Castañeda-Ruiz RF, Somrithipol S, Lateef AA, Karunarathna SC, Tibpromma S, Mortimer PE, Wanasinghe DN, Phookamsak R, Xu J, Wang Y, Tian F, Alvarado P, Li DW, Kušan I, Matočec N, Mešić A, Tkalčec Z, Maharachchikumbura SSN, Papizadeh M, Heredia G, Wartchow F, Bakhshi M, Boehm E, Youssef N, Hustad VP, Lawrey JD, Santiago ALCMA, Bezerra JDP, Souza-Motta CM, Firmino AL, Tian Q, Houbraken J, Hongsanan S, Tanaka K, Dissanayake AJ, Monteiro JS, Grossart HP, Suija A, Weerakoon G, Etayo J, Tsurykau A, Vázquez V, Mungai P, Damm U, Li QR, Zhang H, Boonmee S, Lu YZ, Becerra AG, Kendrick B, Brearley FQ, Motiejūnaitė J, Sharma B, Khare R, Gaikwad S, Wijesundara DSA, Tang LZ, He MQ, Flakus A, Rodriguez-Flakus P, Zhurbenko MP, McKenzie EHC, Stadler M, Bhat DJ, Liu JK, Raza M, Jeewon R, Nassonova ES, Prieto M, Jayalal RGU, Erdoğdu M, Yurkov A, Schnittler M, Shchepin ON, Novozhilov YK, Silva-Filho AGS, Gentekaki E, Liu P, Cavender JC, Kang Y, Mohammad S, Zhang LF, Xu RF, Li YM, Dayarathne MC, Ekanayaka AH, Wen TC, Deng CY, Pereira OL, Navathe S, Hawksworth DL, Fan XL, Dissanayake LS, Kuhnert E, Grossart HP, Thines M (2020) Outline of Fungi and fungus-like taxa. Mycosphere 11: 1060–1456. https://doi.org/10.5943/mycosphere/11/1/8
  • Wijayawardene NN, Hyde KD, Anand G, Dissanayake LS, Tang LZ, Dai DQ (2021) Towards incorporating asexually reproducing fungi in the natural classification and notes for pleomorphic genera. Mycosphere 12: 238–405. https://doi.org/10.5943/mycosphere/12/1/4
  • Xu ZH, Kuang WG, Qiu L, Zhang XG, Castañeda-Ruíz RF, Ma J (2020) Corynespora sinensis sp. nov. from Jiangxi, China. Mycotaxon 135: 803–809. https://doi.org/10.5248/135.803
  • Yang J, Maharachchikumbura SSN, Liu JK, Hyde KD, Jones EBG, Al-Sadi AM, Liu ZY (2018) Pseudostanjehughesia aquitropica gen. et sp. nov. and Sporidesmium sensu lato species from freshwater habitats. Mycological Progress 17: 591–616. https://doi.org/10.1007/s11557-017-1339-4
  • Zhang Q, Yang ZF, Cheng W, Wijayawardene NN, Hyde KD, Chen Z, Wang Y (2020) Diseases of Cymbopogon citratus (Poaceae) in China: Curvularia nanningensis sp. nov. MycoKeys 63: 49–67. https://doi.org/10.3897/mycokeys.63.49264
  • Zhang SN, Hyde KD, Gareth Jones EB, Cheewangkoon R, Liu JK (2018) Acuminatispora palmarum gen. et sp. nov. from mangrove habitats. Mycological Progress 17: 1173–1188. https://doi.org/10.1007/s11557-018-1433-2
login to comment