Research Article
Print
Research Article
Examination of the generic concept and species boundaries of the genus Erioscyphella (Lachnaceae, Helotiales, Ascomycota) with the proposal of new species and new combinations based on the Japanese materials
expand article infoYukito Tochihara§, Tsuyoshi Hosoya§
‡ The University of Tokyo, Tokyo, Japan
§ Department of Botany, National Museum of Nature and Science, Tsukuba, Japan
Open Access

Abstract

The genus Erioscyphella Kirschst., which was morphologically confused with Lachnum, was herein examined. Based on molecular phylogenetic analyses using a combined dataset of ITS, LSU, mtSSU, and RPB2 and morphological examinations, Erioscyphella was distinguished from Lachnum and redefined by longer ascospores and the presence of apical amorphous materials and/or resinous materials equipped on hairs. Species boundaries recognized by morphology/ecology and phylogenetic analyses were cross-checked using species delimitation analyses based on DNA barcode sequences downloaded from UNITE, resulting in that species’ taxonomic problems being uncovered. Six new species (E. boninensis, E. insulae, E. otanii, E. papillaris, E. paralushanensis, and E. sasibrevispora) and two new combinations (E. hainanensis and E. sinensis) were proposed.

Keywords

ITS, morphology, phylogeny, species delimitation, species hypothesis, taxonomy, UNITE

Introduction

The genus Erioscyphella Kirschst belongs to the family Lachnaceae Raitv. (Helotiales, Ascomycota) and includes 11 species: E. abnormis (Mont.) Baral, Šandová & B. Perić [lectotype of Erioscyphella (Haines and Dumont 1984); as ‘E. longispora (P. Karst.) Kirschst.’ in the original description (Kirschstein 1938)], E. alba Ekanayaka & K.D. Hyde, E. aseptata Ekanayaka & K.D. Hyde, E. bambusina (Bres.) Kirschst., E. brasiliensis (Mont.) Baral, Šandová & B. Perić, E. curvispora B. Perić & Baral, E. euterpes (S.A. Cantrell & J.H. Haines) Guatim., R.W. Barreto & Crous, E. fusiformis (Ekanayaka & K.D. Hyde) Ekanayaka & K.D. Hyde, E. lunata (W.Y. Zhuang & Spooner) B. Perić & Baral, E. lushanensis (W.Y. Zhuang & Zheng Wang) Guatim., R.W. Barreto & Crous, and E. sclerotii (A.L. Sm.) Baral, Šandová & B. Perić. (Index Fungorum 2021).

Erioscyphella has been suggested as a monophyletic group by molecular phylogenetic analyses by Cantrell and Hanlin (1997), Hosoya et al. (2010), Perić and Baral (2014), and Guatimosim et al. (2016). However, the morphological delimitation of the genus is currently ill-defined. In the original description (Kirschstein 1938), Erioscyphella was misleadingly defined based on features that are not taxonomically informative, such as filiform, colored, and pigmented ascospores and lanceolate paraphyses (Korf 1978; Perić and Baral 2014). After that, in the genus Lachnum Retz. [type genus of Lachnaceae], species of so-called ‘long-spored Lachnum’, which were characterized by longer ascospores and the occurrence in tropical areas, were suggested as members of Erioscyphella (Haines and Dumont 1984) and have been transferred into Erioscyphella based on molecular phylogenetic analyses by Perić and Baral (2014) and Guatimosim et al. (2016). However, in fact, as morphology of Erioscyphella, including ‘long-spored Lachnum’, is consecutive with that of the genus Lachnum especially regarding the ascospore length and shape of ectal excipular cells (Haines and Dumont 1984), the morphological delimitation of Erioscyphella has not been sufficiently discussed. Since much more potential species are thought to be included in Erioscyphella, its morphological concept must be discussed and updated based on a wider size of taxon sampling.

In the present study, the authors aimed to: a) clarify the generic boundaries of Erioscyphella using molecular and morphological/ecological data, and b) propose new species or new combinations based on more objectively defined species boundaries. To reach our first goal, we used specimens from the herbarium of the National Museum of Nature and Science (TNS) (Tsukuba, Japan) as most of them were accompanied by culture and/or DNA extracts. In TNS, only three identified species of Erioscyphella were recognized (E. abnormis, E. brasiliensis, and E. sclerotii); however, we presumed that many unidentified species of Erioscyphella were housed therein. To reach our second goal, for species recognition, we tested DNA barcoding using the internal transcribed spacer region of nuclear ribosomal DNA (ITS), widely accepted as fungal DNA barcode (Begerow et al. 2010; Schoch et al. 2012; Hosoya 2021). ITS-based species boundaries were explored based on multiple methods, and the results were compared to species boundaries based on morphology, ecology, and phylogenetic relationships.

Materials and methods

Taxon sampling

In TNS, specimens labeled as Erioscyphella were initially searched, and closely related specimens to Erioscyphella were searched based on the sequence similarities of ITS. Selected specimens were tentatively identified based on morphology following Dennis (1954), Haines (1980), Haines and Dumont (1984), Spooner (1987), and Perić and Baral (2014).

Morphological observation, DNA extraction, and sequencing

Micromorphology was examined using cotton blue (CB) dissolved in lactic acid (LA) (CB/LA; 0.5 g CB and 99.5 mL LA) as a mounting fluid. To check the ascal apex iodine reaction, Melzer’s reagent (MLZ; 0.5 g I2, 1.5 g KI, 20 g chloral hydrate, and 20 g water) was initially used without KOH pretreatment, and Lugol’s iodine (IKI; 1 g I2 and 1 g KI, and 100 mL H2O) and MLZ with 3% KOH pretreatment were used when necessary. World Geodetic System 84 was used for the geographic coordinates. URLs herein shown were accessed on April 15, 2021, except for GBIF website accessed on Feb 10, 2020.

DNA was extracted from cultivated isolates in 2% malt extract broth (MEB) using the modified cetyltrimethylammonium bromide (CTAB) method (Hosaka and Castellano 2008; Tochihara and Hosoya 2019). When isolates are not available, DNA was extracted directly from a crushed apothecium using DNA extraction buffer following Tochihara and Hosoya (2019). The isolates from which DNA extracted were deposited in the NITE National Biological Resource Center (NBRC) (Kisarazu, Japan), except for isolates with restriction on transition by Japanese laws and those unavailable because of contracts with private companies.

Polymerase chain reaction (PCR) was used to amplify the following regions: ITS (= ITS1-5.8S-ITS2), the partial large subunit nuclear ribosomal RNA gene (LSU), the partial mitochondrial small subunit (mtSSU), and section ‘6–7’ of the second largest subunit of the nuclear RNA polymerase II gene (RPB2). Primer pairs for PCR reactions of ITS, LSU and mtSSU were ITS1F (5’–CTTGGTCATTTAGAGGAAGTAA–3’) (Gardes and Bruns 1993) or ITS1 (5’–TCCGTAGGTGAACCTCGGG–3’) (White et al. 1990) and ITS4 (5’–TCCTCCGCTTATTGATATGC–3’) (White et al. 1990), LR0R (5’–ACCCGCTGAACTTAAGC–3’) and LR5 (5’–TCCTGAGGGAAACTTCG–3’) (Vilgalys and Hester 1990), and mrSSU1 (5’–AGCAGTGAGGAATATTGGTC–3’) and mrSSU3R (5’–ATGTGGCACGTCTATAGCCC–3’) (Zoller et al. 1999) respectively. The PCR program consisted of an initial denaturation at 95 °C for 3 min, followed by 30 cycles of 94 °C for 35 s, 51 °C for 30 s, and 72 °C for 1 min, and a final extension at 72 °C for 10 min. When appropriate PCR products were not obtained, a modified PCR program was applied first, and then alternative primer pairs were tested. For RPB2, an alternative forward primer fRPB2-5F (5’–GAYGAYMGWGATCAYTTYGG–3’) (Liu et al. 1999) or RPB2-P6Fa (5’–TGGGGRYTK GTBTGYCCKGCHGA–3’) (Hansen et al. 2005) and a reverse primer bRPB2-7.1R2 (5’–CCCATNGCYTGYTTVCCCATDGC–3’) (modified from bRPB2-7.1R) (Matheny 2005; Matheny et al. 2007; Gelardi et al. 2015) were used.

Sequencing was conducted on an ABI PRISM 3500xL Genetic Analyzer (Applied Biosystems; Thermo Fisher Scientific, Waltham, MA, USA) with a BigDye Terminator 3.1 Cycle Sequencing Kit (Applied Biosystems). The obtained sequences were assembled using ATGC 7 (Genetyx, Tokyo, Japan). Assembled sequences were deposited in the International Nucleotide Sequence Database Collaboration (INSDC) via the DNA Data Bank of Japan (DDBJ), and acquired INSDC accession numbers. Assembled ITS sequences were also deposited in the UNITE database (https://unite.ut.ee/) via the PlutoF workbench (https://plutof.ut.ee/) (Abarenkov et al. 2010) and acquired UNITE accession numbers.

Phylogenetic analyses

The specimens obtained from TNS were included in the phylogenetic analyses as candidate members of Erioscyphella (‘‡’ in Table 1). From other genera of the family Lachnaceae, four species of Lachnum, two species of Albotricha, Brunnipila, Capitotricha, Dasyscyphella, Incrucipulum, and Lachnellula, and one species of Neodasyscypha and Proliferodiscus were used (‘†’ in Table 1). Among the eight genera, seven of them (except Proliferodiscus) included type species. Three species of Helotiales were selected as outgroups following Tochihara and Hosoya (2019) (Table 1).

Table 1.

Taxa analyzed in the phylogenetic analyses.

Specimen no. (TNS-F-) Taxon| Collection site Collected Date Host plants and parts Strain no. (NBRC) UNITE/GenBank accession no.#
ITS LSU mtSSU RPB2
†16740 Albotricha acutipila (P. Karst.) Raitv. Japan, Nagano, Ueda, Sugadaira Montane Research Center 2006-06-17 culm of unidentified bamboo 104380 AB481234 LC438571 LC431751 AB481354
†16497 Albotricha albotestacea (Desm.) Raitv. Japan, Nagano, Ueda, Sugadaira Montane Research Center 2005-05-18 culm of Miscanthus sinensis 101346 AB481235 LC424943 LC431747 AB481340
†16635 Brunnipila fuscescens (Pers.) Baral Japan, Gunma, Higashi-Agatsuma 2006-04-27 leaf of unidentified tree 104365 AB481255 LC424945 LC431750 AB481348
†16690 Brunnipila pseudocannabina (Raitv.) Tochihara, Sasagawa & Hosoya JAPAN, Akita, Kosaka 2006-05-26 stem of unidentified herb 104374 AB481272 LC533520 LC533522 LC533521
†65670 Capitotricha bicolor (Bull.) Baral SWITZERLAND, Filisur 2016-06-06 twig of Prunus spinosa (FC-6101) LC424834 LC424942 LC533244 LC425011
†65752 Capitotricha rubi (Bres.) Baral SWITZERLAND, Saicourt 2016-06-04 twig of Rubus idaeus (FC-6075) LC438560 LC438573 LC533243 LC440395
†16439 Dasyscyphella longistipitata Hosoya JAPAN, Kanagawa, Yamakita 2005-04-17 cupule of Fagus crenata 101335 AB481239 LC424947 LC533228 AB481331
†16527 Dasyscyphella montana Raitv. Japan, Nagano, Ueda, Sugadaira Montane Research Center 2005-05-21 wood of unidentified tree 102336 AB481242 LC438577 LC533241 AB481336
‡16556 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Oita, Kokonoe 2005-05 wood of unidentified tree 114449 UDB0779051 LC533153 LC533257 LC533198
‡16582 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Kanagawa, Yamakita 2005-07-02 wood of unidentified tree 104360 AB481249 LC533176 LC533233 LC533199
‡16606 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Kanagawa, Yamakita 2005-07-03 wood of unidentified tree 114450 UDB0779053 LC533154 LC533258 LC533200
‡16609 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Kanagawa, Yamakita 2005-07-03 wood of Cephalotaxus harringtonia 101350 ††AB705234 LC533175 LC533256 LC533184
‡16639 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Ibaraki, Tsukuba Botanical Garden 2006-05-01 twig of unidentified tree 114451 UDB0779054 LC533155 LC533259 LC533201
‡25579 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Tokyo, Hongo 2009-05-25 twig of unidentified tree (FC-1887) UDB0779057 LC533146 LC533250 LC533191
‡32163 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Kanagawa, Odawara 2010-05-14 twig of unidentified tree 114456 UDB0779062 LC533158 LC533260 LC533203
‡38452 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Gunma, Naganohara 2013-06-27 wood of unidentified tree 114463 ††UDB0779069 LC533171 LC533262 LC533210
‡46416 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Taiwan, Taipei 2012-04-15 wood of unidentified tree (FC-2906) UDB0779067 LC533132 LC533277 LC549671
‡46841 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Gifu, Gujo 2012-05-28 wood of unidentified tree 114462 UDB0779086 LC533170 LC533279 LC533209
‡61773 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Kanagawa, Yokohama 2015-04-01 twig of unidentified tree 114464 ††UDB0779074 LC533137 LC533264 LC533211
‡61931 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Kanagawa, Zushi 2015-04-16 wood of unidentified tree 114466 UDB0779072 LC533139 LC533266 LC533213
‡80478 Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić Japan, Shizuoka, Oyama 2017-06-26 twig of unidentified tree 113934 LC424837 LC424949 LC533283 LC425009
†26520 Erioscyphella boninensis Tochihara & Hosoya Japan, Tokyo, Chichijima Island 2009-06-28 trunk of unidentified tree 114447 UDB0779049 LC533151 LC533254 LC533196
‡46419 Erioscyphella brasiliensis (Mont.) Baral, Šandová & B. Perić Taiwan, Taipei 2012-04-20 wood of unidentified tree (FC-2910) UDB0779068 LC533133 LC533278 LC549672
‡35049 Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) Japan, Niigata, Minamiuonuma 2010-05-14 leaf of Quercus glauca 114457 UDB0779064 LC533168 LC533274 LC533205
‡35056 Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) Japan, Niigata, Minamiuonuma 2010-05-14 leaf of Quercus serrata 114458 UDB0779065 LC533169 LC533275 LC533206
‡61775 Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) Japan, Kanagawa, Hiratsuka 2015-04-12 leaf of Quercus myrsinifolia 114465 UDB0779071 LC533138 LC533265 LC533212
‡61941 Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) Japan, Kanagawa, Kamakura 2015-04-24 leaf of Quercus glauca 112569 UDB0779073 LC533140 LC533280 LC533214
‡65722 Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) Japan, Gunma, Midori 2016-04-24 leaf of Quercus serrata subsp. Mongolicoides 114469 UDB0779076 LC533142 LC533281 LC533215
‡80356 Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) Japan, Kanagawa, Hiratsuka 2017-05-18 leaf of Quercus glauca 114470 UDB0779077 LC533172 LC533282 LC533186
‡80371 Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) Japan, Kanagawa, Hiratsuka 2017-05-18 leaf of Castanopsis sieboldii 114472 UDB0779078 LC533135 LC533246 LC533188
‡26500 Erioscyphella insulae Tochihara & Hosoya Japan, Tokyo, Hahajima Island 2009-06-24 wood of unidentified tree 114445 UDB0779060 LC533149 LC533252 LC533194
‡39720 Erioscyphella insulae Tochihara & Hosoya Japan, Okinawa, Iriomote Island 2011-06-12 bark of unidentified tree 114459 UDB0779063 LC533177 LC533261 LC533207
‡61920 Erioscyphella paralushanensis Tochihara & Hosoya Japan, Shizuoka, Atami 2015-06-08 culm of Pleioblastus argenteostriatus 114468 ††UDB0779075 LC533141 LC533267 LC533220
†81472 Erioscyphella otanii Tochihara Japan, Hokkaido, Horonobe, Teshio Experimental Forest, Hokkaido University 2018-07-11 leaf of Sasa senanensis 114476 UDB0779085 LC533179 LC533286 ||LC533226
‡81272 Erioscyphella papillaris Tochihara Japan, Gunma, Minakami 2017-07-16 leaf of unidentified bamboo 113937 UDB0779081 LC533161 LC533285 LC533204
‡80399 Erioscyphella sasibrevispora Tochihara & Hosoya Japan, Gunma, Higashi-Agatsuma 2017-06-06 sheath of Sasa veitchii UDB0779082/LC669470 LC533173 LC533268 LC533216
‡81401 Erioscyphella sasibrevispora Tochihara & Hosoya Japan, Hokkaido, Tomakomai 2018-06-16 culm of Sasa nipponica 114475 UDB0779084/LC669472 LC533174 LC533269 LC533217
‡26492 Erioscyphella sclerotii (A.L. Sm.) Baral, Šandová & B. Perić Japan, Tokyo, Hahajima Island 2009-06-24 wood of unidentified tree 114448 UDB0779050/LC669438 LC533152 LC533255 LC533197
‡38480 Erioscyphella sclerotii (A.L. Sm.) Baral, Šandová & B. Perić Taiwan, Wulai 2013-07-12 twig of unidentified tree (FC-5208) ††UDB0779070 LC533134 LC533263 LC549673
‡16838 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) Japan, Ibaraki, Tsukuba Botanical Garden 2007-06-15 leaf of unidentified broad-leaved tree 104389 AB481280 LC533164 LC533235 AB481364
‡80354 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) Japan, Kanagawa, Manazuru 2017-05 leaf of Castanopsis sieboldi 114471 UDB0779083/LC669471 LC533143 LC533245 LC533187
‡16841 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) Japan, Ibaraki, Mt. Tsukuba 2007-06-23 leaf of unidentified broad-leaved tree 104390 AB481281 LC533157 LC533236 LC533218
‡32161 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) Japan, Kanagawa, Odawara 2010-05-14 leaf of Quercus myrsinifolia 113715 UDB0779061/LC669449 LC533167 LC533273 LC533219
‡16837 Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) Japan, Ibaraki, Tsukuba Botanical Garden 2007-06-15 leaf of unidentified broad-leaved tree 114452 UDB0779055/LC669443 LC533156 LC533272 LC533202
†81520 Incrucipulum ciliare (Schrad.) Baral Japan, Shizuoka, Shizuoka 2018-08-18 leaf of Quercus mongolica subsp. crispula 113941 LC438566 LC438583 LC533284 LC438596
†17632 Incrucipulum longispineum Sasagawa & Hosoya Japan, Miyagi, Sendai 2006-07-29 leaf of Lyonia ovalifolia 102347 AB481256 LC438579 LC533234 AB481362
†81248 Lachnellula calyciformis (Batsch) Dharne Japan, Hokkaido, Engaru 2017-07-12 twig of Abies sachalinensis 113935 LC438561 LC438574 LC533247 LC438590
†16529 Lachnellula suecica (de Bary ex Fuckel) Nannf. Japan, Nagano, Ueda, Sugadaira Montane Research Center 2005-05-21 twig of Larix kaempferi 101348 AB481248 LC424944 LC533231 AB481341
†16494 Lachnum asiaticum (Y. Otani) Raitv. Japan, Nagano, Ueda, Sugadaira Montane Research Center 2005-05-18 culm of unidentified bamboo 101341 AB481251 LC533162 LC533229 AB481334
‡17249 Lachnum mapirianum (Pat. & Gaillard) M.P. Sharma Malaysia, Gerik 2004-09-07 leaf of unidentified tree UDB0779088/LC669476 LC533182 LC533223
‡17245 Lachnum mapirianum (Pat. & Gaillard) M.P. Sharma Malaysia, Gerik 2004-09-07 leaf of unidentified tree UDB0779087/LC669475 LC533181 LC533222
‡16442 Lachnum novoguineense var. yunnanicum W.Y. Zhuang Japan, Nagano, Ueda, Sugadaira Montane Research Center 2005-05-18 culm of unidentified bamboo 102339 AB481270 LC533163 LC533232 AB481342
‡16642 Lachnum novoguineense var. yunnanicum W.Y. Zhuang Japan, Ibaraki, Mt. Tsukuba 2006-05-02 culm of unidentified bamboo 104368 AB481271 LC533165 LC533227 §§LC533225
‡11197 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) Japan, Shizuoka, Shimoda 2004-07-26 leaf of Livistona chinensis var. subglobosa 106495 UDB0779047/LC669435 LC533166 LC533248 LC533185
‡13500 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) Japan, Kagoshima, Yakushima Island 2005-10-19 leaf of Livistona chinensis var. subglobosa 114441 ††LC425039/UDB779046 LC429382 LC533240 ‡‡LC431718
‡17567 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) New Zealand 2005-05-28 leaf of unidentified palm UDB0779089/LC669477 LC533183 LC533288
‡24588 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) Japan, Kagoshima, Amami-Oshima 2009-02-24 leaf of Livistona chinensis var. subglobosa 114442 UDB0779052/LC669440 LC533144 LC533270 LC533190
‡24600 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) Japan, Kagoshima, Amami-Oshima 2009-02-25 leaf of Livistona chinensis var. subglobosa 114443 UDB0779056/LC669444 LC533145 LC533249 ||LC533224
‡26161 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) Japan, Tokyo, Chichijima Island 2009-06-27 leaf of Livistona boninensis 114446 UDB0779048/LC669436 LC533150 LC533253 LC533195
‡26172 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) Japan, Tokyo, Kita-Iwojima Island 2009-06-17 leaf of Livistona chinensis var. subglobosa (FC-1935) UDB0779058/LC669446 LC533147 LC533251 LC533192
‡26185 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) Japan, Tokyo, Kita-Iwojima Island 2009-06-18 leaf of Livistona chinensis var. subglobosa 114444 UDB0779059/LC669447 LC533148 LC533271 LC533193
‡39729 Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) Japan, Okinawa, Iriomote Island 2011-06-13 leaf of Livistona chinensis var. subglobosa 114460 UDB0779066/LC669454 LC533178 LC533276 LC533208
†16501 Lachnum pudibundum (Quél.) J. Schröt. Japan, Nagano, Ueda, Sugadaira Montane Research Center 2005-05-18 wood of unidentified tree 102335 AB481259 LC533160 LC533230 AB481335
†81229 Lachnum rachidicola J.G. Han, Raitv. & H.D. Shin Japan, Hokkaido, Tomakomai, Tomakomai Experimental Forest 2017-08-09 petiole of Juglans sp. 114473 UDB0779079/LC669467 LC533136 LC533189
†16583 Lachnum virgineum (Batsch) P. Karst. Japan, Kanagawa, Yamakita 2005-07-02 wood of unidentified tree 104358 AB481268 AB926119 LC431748 AB481343
†65625 Neodasyscypha cerina (Pers.) Spooner Switzerland, Saicourt 2016-06-08 twig of Crataegus sp. (FC-6068) LC424836 LC424948 LC533242 LC425013
†17436 Proliferodiscus alboviridis (Sacc.) Spooner Japan, Ibaraki, Tsukuba Botanical Garden 2006-07-08 wood of unidentified tree 108594 LC438558 LC533159 LC533239 LC425014
§17909 Hyaloscypha spiralis (Velen.) J.G. Han, Hosoya & H.D. Shin Japan, Kumamoto, Kikuchi 2005-10-10 wood of unidentified tree 108585 ††LC438602 LC438604 LC533237 LC438606
§16472 Hymenoscyphus varicosporoides Tubaki Japan, Ibaraki, Kasumigaura 2005-05-05 wood of unidentified tree 104355 AB926052 LC424952 LC431746 AB481329
§18014 Urceolella carestiana (Rabenh.) Dennis Japan, Iwate, Hanamaki 2006-05-23 stem of Parathelypteris nipponica 108588 ††LC438603 LC438605 LC533238 LC438607

A concatenated dataset of ITS, LSU, mtSSU, and RPB2 was used in the phylogenetic analyses. Each region was aligned separately using MAFFT 7 (Katoh and Standley 2013). The Q-INS-i option was used for ITS, LSU, and mtSSU to accommodate the secondary structures of RNA, and the G-INS-1 option was used for RPB2 to assume global alignment using the entire region. The aligned sequences were edited manually using BioEdit 7.0.5.2 (Hall 1999).

Phylogenetic conflicts among gene partitions were checked before the phylogenetic analyses using the concatenated matrix. Maximum likelihood (ML) trees with 1,000 bootstrap replications (Felsenstein 1985) using the ITS, LSU, mtSSU, and RPB2 datasets separately were constructed using MEGA X (Kumar et al. 2018) with the GTR+G model; branches with bootstrap values > 70% were compared among trees. For mtSSU and RPB2, specimens containing missing data were excluded from the analyses.

The concatenated dataset was analyzed using ML, maximum parsimony (MP), and Bayesian inference (BI). For the ML and BI analyses, substitution models were estimated for each partition (ITS, LSU, mtSSU, and each codon position of RPB2) based on Akaike’s information criterion (AIC) (Akaike 1974) using Modeltest-NG 0.1.6 (Darriba et al. 2019).

ML tree search (Felsenstein 1984) and bootstrapping (Felsenstein 1985; Lemoine et al. 2018) was performed using RAxML-NG 0.9.0 (Kozlov et al. 2019) with 1,000 bootstrap replications under the substitution model SYM+I+G4 for ITS, TIM1+I+G4 for LSU, TPM1uf+I+G4 for mtSSU and RPB2 third codon position, GTR+I+G4 for RPB2 first codon position, and TPM3uf+I+G4 for RPB2 second codon position. Sequence matrix containing missing data typically yield multiple trees residing on a phylogenetic terrace (Sanderson et al. 2011; Biczok et al. 2018). Therefore, we checked if the best-scored-tree did not lie on a terrace using the Python tool called ‘terraphy’ implemented in RAxML-NG 0.9.0.

MP analysis was conducted using PAUP* 4.0a 167 (Swofford 2002). All substitutions were treated as unordered and of equal weights. All gaps were treated as missing data. A heuristic parsimony search was carried out with 1,000 replicates of random step addition, with a tree bisection reconnection (TBR) branch swapping algorithm, Multrees option on, Steepest descent modification option on, and branch collapse option set to MinBrlen. Bootstrap values (MPBP; Felsenstein 1985) were estimated from 1,000 replicates of heuristic searches, with random taxon addition, TBR branch swapping, and Multrees options off.

Figure 1. 

ML best-scored phylogenetic tree based on the concatenated dataset of ITS, LSU, mtSSU, and RPB2 constructed using RAxML-NG. MLBP/MPBP/BPP are represented on branches in this order. In MLBP/MPBP < 50% or BPP < 0.95, a hyphen appears. No evaluation values are shown on branches when MLBP and MPBP < 50% and BPP < 0.95. The branch of a clade TNS-F-17245 + 17249 to its most recent common ancestor is only one-third of the intended length due to space limitation.

BI analysis was based on MrBayes 3.2.7a (Ronquist et al. 2012) under the substitution model SYM+I+G4 for ITS, GTR+I+G4 for LSU and RPB2 first codon positions, HKY+I+G4 for mtSSU and RPB2 third codon positions, and F81+I for RPB2 second codon position. Two separate Metropolis-Coupled Markov Chains of Monte Carlo (MCMCMC) ran simultaneously starting from random trees for 20 million generations, and trees were sampled every 500 generations. The average standard deviation of split frequencies (ASDSF) and effective sample size (ESS) were checked using Tracer 1.7.1 (Rambaut 2018a) as an indication of convergence. Using post-burn-in trees, a 50% majority rule consensus tree was generated, and Bayesian posterior probabilities (BPP) were calculated to evaluate node supports. Trees were visualized using FigTree 1.4.4 (Rambaut 2018b) based on the ML, MP, and BI analyses respectively. Branches with MLBP and MPBP > 90% and BPP > 0.95 were regarded as strongly supported.

ITS-based species delimitation analyses (Fig. 2)

Figure 2. 

Diagrammatic representation showing the species delimitation analyses using ITS sequences.

To maximize the number of ITS sequences, we used the UNITE Species Hypotheses (SH) system provided by the UNITE database (Kõljalg et al. 2013; Nilsson et al. 2015; GBIF 2018; Kõljalg et al. 2020). In the UNITE SH system, all fungal ITS sequences are periodically divided into species-level clusters (species hypothesis; SH) at optional sequence-distance thresholds (0%–3% in 0.5% steps), each of which is assigned to a unique UNITE SH code represented by a digital objective identifier (DOI) accessible from internet (Kõljalg et al. 2016, 2020; Nilsson et al. 2015).

Based on the UNITE SH system, we collected ITS sequences of Erioscyphella in the following process: a) selectivity of closely related sequences: for every ITS sequence newly obtained from TNS specimens (= query sequences, 49 sequences), UNITE SH code at the 3% threshold value were searched in the UNITE database to gather sequences in wider scope, and all sequences within the UNITE SH code were downloaded. b) selectivity based on taxon names: using the UNITE search page, ITS sequences named Erioscyphella were searched, because only closely related sequences to query sequences are filtered under the a) criterion. Sequences with synonyms of Eriosyphella species were also searched, because the UNITE lookup function is not supported by any backbone taxonomies to integrate synonyms. Sequences satisfying criterion a) or b) were downloaded for ITS-based species recognition. The obtained ITS sequences were clustered into SHs based on an OTU clustering method, hierarchical clustering method, and two coalescent-based methods. For all ITS sequences, ITS1, 5.8S, and ITS2 regions were extracted using ITSx (Nilsson et al. 2010) to construct an accurate ITS dataset, because the inclusion of segments of adjacent regions (such as a small subunit of 18S rRNA or LSU) may decrease the accuracy of the calculation of ITS distances (Nilsson et al. 2010). OTU clustering was executed using VSEARCH v2.17.2 (Rognes et al. 2016) implemented in the Qiime 2 microbiome analysis platform (Bolyen et al. 2019).

The concatenated dataset of extracted ITS1, 5.8S, and ITS2 was incorporated into VSEARCH, and OTU clustering at 97% and 98.5% similarity thresholds were performed using the ‘-cluster_fast’ option. Hierarchical clustering based on pairwise sequence distances was executed using the Assemble Species by Automatic Partitioning (ASAP) method (Puillandre et al. 2021). The datasets of extracted ITS1, 5.8S, and ITS2 were separately aligned using MAFFT 7 under the Q-INS-i option and edited using trimAl v1.2 (Capella-Gutiérrez et al. 2009) under the ‘-gappyout’ option. The concatenated dataset of the three aligned partitions was analyzed using ASAP web (https://bioinfo.mnhn.fr/abi/public/asap/asapweb.html). Jukes-Cantor (JC69) was selected as a substitution model for computing pairwise distances of sequences. As phylogeny-based species delimitation methods, the generalized mixed Yule-coalescent (GMYC) model (Pons et al. 2006; Fujisawa and Barraclough 2013) and the Poisson Tree Processes (PTP) model (Zhang et al. 2013) were used. In both models, speciation (species-level differentiation) and coalescence (population-level differentiation) are identified based on the length of phylogenetic trees. GMYC requires the use of phylogenetic trees following the molecular clock model (= ultrametric tree) because it detects transition points from speciation to coalescence focusing on the time axis, while PTP does not require ultrametric tree as it focuses on the number of nucleotide substitutions. Ultrametric trees were estimated using BEAST v2.6.3. (Bouckaert et al. 2019). The ITS dataset was divided into ITS1, 5.8S, and ITS2, and suitable substitution models GTR+G for ITS1 and JC+G for 5.8S and ITS2 estimated using Modeltest-NG 0.1.6. were applied. To estimate branch length, a Yule model and a relaxed clock with a log-normal distribution were selected. MCMC chains were run for 1.5×108 generations and sampled every 1,000 generations. After each run, convergence was checked using Tracer 1.7.1, and the first 10% were discarded as burn-in. A consensus tree was generated using TreeAnnotator v1.10.4 in BEAST package, from 150,000 generated trees except for the first 10% regarded as burn-in. A single-threshold species delimitation analysis based on GMYC was conducted using the R package ‘splits’ (Fujisawa and Barraclough 2013).

For the species delimitation analyses using PTP, an unrooted ML phylogenetic tree was constructed using RAxML-NG 0.9.0. The analysis used ITS1, 5.8S, and ITS2 partitions, aligned as previously described, under the substitution models TIM2+G4 for ITS1, TPM2+I+G4 for 5.8S, and GTR+I+G4 for ITS2, estimated using Modeltest-NG 0.1.6. based on the AIC. The species delimitation analysis was executed using the generated ML best-scored tree with the bPTP web server (https://species.h-its.org/). The MCMC run was set to 500,000 generations and burn-in rate was set to 0.1. The convergence of MCMC runs was visually checked. In ML and Bayesian results, a result generating fewer SHs was adopted to avoid excessive species division.

SHs generated in the species delimitation analyses and the UNITE SHs at 3% and 1.5% threshold values were compared with one another.

Species recognition

In the present study, we initially recognized species boundaries based on the two criteria:

  1. Forming a monophyletic group in the phylogenetic analyses based on multigene data (Fig. 1).
  2. Members can be distinguished based on morphological and/or common ecological features (such as host plants).

Species boundaries recognized by 1.and 2. were cross-checked based on the results of ITS-based species delimitation analyses. When the species boundaries are supported by the majority (= more than four methods) of the seven species delimitation methods (UNITE SH at 3% threshold, UNITE SH at 1.5% threshold, VSEARCH 97% similarity, VSEARCH 98.5% similarity, ASAP, GMYC, and PTP) (Fig. 3), we regard the species as reasonable and carry out taxonomic treatments if necessary.

Figure 3. 

Species delimitation analyses using ITS sequences of Erioscyphella and its potential members. Clusters based on UNITE SH at 3% and 1.5% threshold values at UNITE v8.2, VSEARCH at 97% and 98.5% threshold values, ASAP, GMYC, and PTP are displayed. Schematic phylogenetic relationships are shown using the ultrametric tree constructed for the GMYC analysis. The taxon names shown on the tree branches follow the results of the present study.

Results

Taxon sampling from TNS specimens

Forty-nine specimens in TNS were identified as candidates of Erioscyphella and morphologically identified as E. abnormis, E. brasiliensis, E. sclerotii, Lachnum hainanense W.Y. Zhuang & Zheng Wang, L. mapirianum (Pat. & Gaillard) M.P. Sharma, Lachnum mapirianum var. sinense Z.H. Yu, W.Y. Zhuang, Lachnum novoguineense var. yunnanicum W.Y. Zhuang, and L. palmae (Kanouse) Spooner (Table 1), together with six species of Erioscyphella described here as new ([E. boninensis, E. insulae, E. otanii, E. papillaris, E. paralushanensis, and E. sasibrevispora], Table 1).

Phylogenetic analyses

The molecular phylogenetic analyses were based on 70 specimens selected from TNS (Table 1). The concatenated sequence matrix was composed of 2488 bp (sites 1–332 for ITS, 333–1108 for LSU, 1109–1828 for mtSSU, and 1829–2488 for RPB2). In the matrix, the following parts were treated as missing data: TNS-F-17245, 17249, and 81229 for mtSSU, and TNS-F-17567 for RPB2. The matrix was registered in TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S28477).

Among the four ML trees based on each region, no conflicts were found in clades with support > 70% (Suppl. material 1: Fig. S1). Therefore, we considered these four regions to be combinable, and phylogenetic analyses were based on the concatenated sequence matrix. In the ML analysis, the best-scored tree generated did not reside on the phylogenetic terrace. In the MP analysis, 766 nucleotide substitution sites were detected, 601 of which were parsimony-informative. A total of 182,630 equally parsimonious trees were generated with tree length = 2,985 steps, consistency index (CI) = 0.38, retention index (RI) = 0.73, and rescaled consistency index (RC) = 0.28. In the BI analysis, when two runs reached 20 million generations and the first 10,000 trees (25%) of generated trees were excluded, ASDSF was observed to fall below 0.004 and ESS of all parameters was over 200. The first 10,000 trees were discarded as burn-in. A 50% majority rule consensus tree was constructed and BPP was calculated based on the remaining 30,000 trees.

As no topological contradictions occurred among the ML best-scored tree, MP 50% majority-rule consensus tree, and BI 50% majority-rule consensus tree, only ML tree was illustrated, and MLBS, MPBS, and BPP were plotted on its branches (Fig. 1).

Based on the phylogenetic analyses, 49 candidates of Erioscyphella formed a strongly supported clade (= Clade A, MLBP = 100%/MPBP = 100%/BPP = 1.00), apart from the clade of Lachnum sensu stricto (= L. asiaticum (Y. Otani) Raitv., L. pudibundum (Quél.) J. Schröt., L. rachidicola J.G. Han, Raitv. & H.D. Shin, and L. virgineum (Batsch) P. Karst.) [type of Lachnum]) (Fig. 1). Clade A and Proliferodiscus alboviridis formed a relatively strongly supported clade (Clade B, MLBP = 78%, MPBP = 82%, BPP = 1.00).

Within Clade A, each morphologically identified species and variety formed strongly supported monophyletic groups of their own (Fig. 1), and five strongly supported subclades were recognized (Clade I–V, Fig. 1). Lachnum mapirianum (TNS-F-17545, 17249) and E. insulae (TNS-F-26500, 39720) did not belong to any subclade. Clade I was composed of E. boninensis, E. paralushanensis, L. hainanense, and L. mapirianum var. sinense. Within Clade I, only E. paralushanensis occurred on bamboo sheaths, while others occurred on fallen leaves of broad-leaved trees. Clade II was composed only of L. palmae, which occurred on the palm petioles. Clade III was composed of E. otanii and E. papillaris occurring on bamboo leaves. Clade IV was composed of L. novoguineense var. yunnanicum, and E. sasibrevispora, occurring on bamboo sheaths. Clade V was composed of E. abnormis, E. brasiliensis, and E. sclerotii, occurring on wood.

Morphological characters within Clade A

Members of Clade A had totally and densely granulate, hyaline to brown, thin-walled hairs, fusiform to long filiform ascospores, ectal excipulum composed of textura prismatica to textura angularis, asci lacking croziers at the bases, and smooth walled ectal excipulum cells. Exceptionally, E. sasibrevispora, L. hainanense (Hosoya et al. 2013), and L. novoguineense var. yunnanicum W.Y. Zhuang had croziers and E. boninensis had granulated ectal excipulum.

Moreover, hairs of Clade A lacked crystals, but were equipped with apical amorphous materials and/or resinous materials. In the present study, “crystals” refers to amber colored materials that positioned near the hair apices and were regular-shaped (e.g. tetrahedral materials, masses of needle-like materials, or cross-shaped materials), described by Raitviir (2002), Suková (2005) or Tochihara and Hosoya (2019). “Resinous materials” refers to colored, refractive, irregular-shaped materials attached on any parts of hairs, described by Spooner (1987). Crystals and resinous materials are easily detatched from hairs and broken into fragments in the squash mount. “Apical amorphous materials” is termed uniquely in this study, and refers to hyaline to brown, refractive, irregular-shaped materials positioned outside the hair apices. They are usually small and inconspicuous cap-like shaped, and conspicuously globular in some species. Apical amorphous materials do not grow to big masses and are not easily detached from hairs in the squash mount.

In Clade A, members except for E. boninensis, E. sasibrevispora and L. novoguineense var. yunnanicum had apical amorphous materials, and E. boninensis, E. paralushanensis, and L. palmae complex also had resinous materials (see figures of described species and Suppl. material 1: Fig. S2).

ITS-based species delimitation analyses

In UNITE v8.3, 87 ITS sequences were clustered into 23 SHs at 3% and 26 SHs at 1.5% threshold values (Table 2, Fig. 3). The UNITE SH code for each SH is presented in Table 2. In OTU clustering using VSEARCH, 87 ITS sequences were clustered into 25 SHs at 97% similarity and 28 SHs at 98.5% similarity (Table 2, Fig. 3). VSEARCH SH codes (allocated in this study uniquely; VSH97_1 to VSH97_25, VSH985_1 to VSH985_28) are shown in Table 2.

Table 2.

ITS sequences analyzed by the species delimitation analyses.

ITS sequence GenBank/UNITE accession no. TNS-F specimen no. Reference (initial appearance) Taxon name (ultimately allocated in this study) UNITE taxon name INSDC taxon name Country Host plants and parts UNITE SH code (DOI) at 3% threshold UNITE SH code (DOI) at 1.5% threshold VSEARCH SH at 97% similarity VSEARCH SH at 98.5% similarity
AB267634 Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Ehime twig of Citrus junos SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
AB267636 (duplicate; AB267635) Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Ehime twig of Citrus junos SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
AB267641 (duplicate; AB267639, AB267640) Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Tokushima twig of Citrus junos SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
AB267642 Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Tokushima twig of Citrus junos SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
JF937578 Zhao and Zhuang (2011) E. abnormis Lachnum abnorme Lachnum abnorme CHINA (unspecified) SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
JN033395 Han et al. (2014) E. abnormis Lachnum abnorme Lachnum abnorme KOREA Wood SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
UDB0779067/LC669455 46416 this study E. abnormis - - TAIWAN, Taipei wood of unidentified tree SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
UDB0779074/LC669462 61773 this study E. abnormis - - JAPAN, Kanagawa, Yokohama twig of unidentified tree SH1155612.08FU SH1522994.08FU VSH97_1 VSH985_2
MK584950 Ekanayaka et al. (2019) E. abnormis E. abnormis E. abnormis CHINA, Yunnan (unspecified) SH1155612.08FU †SH1522994.08FU VSH97_1 VSH985_2
AB267637 Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Nara Twig SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
AB267638 Miyoshi et al. (2007) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Shizuoka Twig SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
AB481249 16582 Hosoya et al. (2010) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Kanagawa, Yamakita wood of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
AB705234 16609 Zhao et al. (2012) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Kanagawa, Yamakita wood of Cephalotaxus harringtonia SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
LC424837 80478 this study E. abnormis - - JAPAN, Shizuoka, Oyama twig of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
MG712307 unpublished E. abnormis Lachnum abnorme Lachnum abnorme CHINA (unspecified) SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
MK282241 unpublished E. abnormis Lachnum abnorme Lachnum abnorme (unspecified) (unspecified) SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
MK584957 Ekanayaka et al. (2019) E. abnormis E. aseptata E. aseptata THAILAND, Chiang Rai (unspecified) SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
MN082536 unpublished E. abnormis Lachnum abnorme Lachnum abnorme (unspecified) (unspecified) SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
MT995055 unpublished E. abnormis (misregistered?) Chapsa patens Chapsa patens (unspecified) (unspecified) SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
MW007918 unpublished E. abnormis (misregistered?) Chapsa patens Chapsa patens (unspecified) (unspecified) SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779051/LC669439 16556 this study E. abnormis - - JAPAN, Oita, Kokonoe wood of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_1
UDB0779053/LC669441 16606 this study E. abnormis - - JAPAN, Kanagawa, Yamakita wood of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779054/LC669442 16639 this study E. abnormis - - JAPAN, Ibaraki, Tsukuba Botanical Garden twig of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779057/LC669445 25579 this study E. abnormis - - JAPAN, Tokyo, Hongo twig of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779062/LC669450 32163 this study E. abnormis - - JAPAN, Kanagawa, Odawara twig of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779069/LC669457 38452 this study E. abnormis - - JAPAN, Gunma, Naganohara twig of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
UDB0779072/LC669460 61931 this study E. abnormis - - JAPAN, Kanagawa, Zushi twig of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_2 VSH985_3
UDB0779086/LC669474 46841 this study E. abnormis - - JAPAN, Gifu, Gujo twig of unidentified tree SH1155612.08FU SH1523013.08FU VSH97_1 VSH985_1
AB481250 16617 Hosoya et al. (2010) E. abnormis Lachnum abnorme Lachnum abnorme JAPAN, Kanagawa, Yamakita twig of unidentified tree ‡SH1155612.08FU ‡SH1523013.08FU VSH97_1 VSH985_1
UDB0779055/LC669443 16837 this study E. sinensis (←Lachnum mapirianum var. sinense) - - JAPAN, Ibaraki, Tsukuba Botanical Garden leaf of unidentified broad-leaved tree SH1155682.08FU SH1523107.08FU VSH97_4 VSH985_5
AB481280 16838 Hosoya et al. (2010) E. sinensis (←Lachnum mapirianum var. sinense) Lachnum sp. Lachnum (Lachnum sp. FC-2355) JAPAN, Ibaraki, Tsukuba Botanical Garden leaf of unidentified broad-leaved tree SH1155682.08FU SH1523107.08FU VSH97_4 VSH985_5
AB481281 16841 Hosoya et al. (2010) E. sinensis (←Lachnum mapirianum var. sinense) Lachnum sp. Lachnum (Lachnum sp. FC-2358) JAPAN, Ibaraki, Mt. Tsukuba leaf of unidentified broad-leaved tree SH1155682.08FU SH1523107.08FU VSH97_4 VSH985_5
UDB0779061/LC669449 32161 this study E. sinensis (←Lachnum mapirianum var. sinense) - - JAPAN, Kanagawa, Odawara leaf of Quercus myrsinifolia SH1155682.08FU SH1523107.08FU VSH97_4 VSH985_5
UDB0779083/LC669471 80354 this study E. sinensis (←Lachnum mapirianum var. sinense) - - JAPAN, Kanagawa, Manazuru leaf of Castanopsis sieboldii †SH1155682.08FU †SH1523107.08FU VSH97_4 VSH985_5
UDB023346 unpublished E. curvispora E. curvispora - MONTENEGRO, Žijevo Mountains needle of Pinus heldreichii SH1155703.08FU SH1523136.08FU VSH97_12 VSH985_14
MH190414 Perić and Baral (2014) E. curvispora E. curvispora E. curvispora MONTENEGRO, Žijevo Mountains needle of Pinus heldreichii †SH1155703.08FU †SH1523136.08FU VSH97_12 VSH985_14
JF937580 Zhao and Zhuang (2011) E. brasiliensis Lachnum brasiliense Lachnum brasiliense CHINA (unspecified) SH1155705.08FU SH1523142.08FU VSH97_6 VSH985_7
MK584953 Ekanayaka et al. (2019) E. brasiliensis E. brasiliensis E. brasiliensis (unspecified) (unspecified) SH1155705.08FU SH1523142.08FU VSH97_6 VSH985_7
MK584967 Ekanayaka et al. (2019) E. brasiliensis E. brasiliensis E. brasiliensis THAILAND, Chiang Rai (unspecified) SH1155705.08FU SH1523142.08FU VSH97_6 VSH985_7
UDB0779068/LC669456 46419 this study E. brasiliensis - - TAIWAN, Taipei wood of unidentified tree SH1155705.08FU SH1523142.08FU VSH97_6 VSH985_7
JF937579 Zhao and Zhuang (2011) E. brasiliensis Lachnum brasiliense Lachnum brasiliense CHINA (unspecified) †SH1155705.08FU †SH1523142.08FU VSH97_6 VSH985_7
KX501132 Tello and Baral (2016) E. lunata E. lunata E. lunata SPAIN, Andalucía needle of Pinus nigra subsp. nigra †SH1155760.08FU †SH1523257.08FU VSH97_18 VSH985_19
JX984680 unpublished E. hainanensis (←Lachnum hainanense) Hyaloscyphaceae Fungi (uncultured fungus) KOREA, Seoul (Total suspended particulate matter (TSP) in urban air during non-Asian dust days) SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
UDB0779064/LC669452 35049 this study E. hainanensis (←Lachnum hainanense) - - JAPAN, Niigata, Minamiuonuma leaf of Quercus glauca SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
UDB0779065/LC669453 35056 this study E. hainanensis (←Lachnum hainanense) - - JAPAN, Niigata, Minamiuonuma leaf of Quercus serrata SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
UDB0779073/LC669461 61941 this study E. hainanensis (←Lachnum hainanense) - - JAPAN, Kanagawa, Kamakura leaf of Quercus glauca SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
UDB0779076/LC669464 65722 this study E. hainanensis (←Lachnum hainanense) - - JAPAN, Gunma, Midori leaf of Quercus serrata subsp. mongolicoides SH1155844.08FU SH1523423.08FU VSH97_3 VSH985_4
MK282242 unpublished E. hainanensis (←Lachnum hainanense) Lachnum sp. Lachnum albidulum KOREA (unspecified) SH1155844.08FU †SH1523423.08FU VSH97_3 VSH985_4
UDB0779077/LC669465 80356 this study E. hainanensis (←Lachnum hainanense) - - JAPAN, Kanagawa, Hiratsuka leaf of Quercus glauca SH1155844.08FU SH3597461.08FU VSH97_3 VSH985_9
UDB0779078/LC669466 80371 this study E. hainanensis (←Lachnum hainanense) - - JAPAN, Kanagawa, Hiratsuka leaf of Castanopsis sieboldii SH1155844.08FU SH3597461.08FU VSH97_3 VSH985_9
UDB0779071/LC669459 61775 this study E. hainanensis (←Lachnum hainanense) - - JAPAN, Kanagawa, Hiratsuka leaf of Quercus myrsinifolia †SH1155844.08FU †SH3597461.08FU VSH97_3 VSH985_9
UDB0779050/LC669438 26492 this study E. sclerotii - - JAPAN, Tokyo, Hahajima Island wood of unidentified tree SH1155848.08FU SH1523429.08FU VSH97_5 VSH985_6
JF937584 Zhao and Zhuang (2011) E. sclerotii Lachnum sclerotii Lachnum sclerotii CHINA (unspecified) SH1155848.08FU SH1523429.08FU VSH97_5 VSH985_6
MK584951 Ekanayaka et al. (2019) E. sclerotii E. sclerotii E. sclerotii THAILAND, Chiang Rai (unspecified) SH1155848.08FU SH1523429.08FU VSH97_5 VSH985_6
UDB0779070/LC669458 38480 this study E. sclerotii - - TAIWAN, Wulai twig of unidentified tree SH1155848.08FU SH1523429.08FU VSH97_5 VSH985_6
MK584969 Ekanayaka et al. (2019) E. sclerotii E. sclerotii E. sclerotii THAILAND, Chiang Rai (unspecified) †SH1155848.08FU †SH1523429.08FU VSH97_5 VSH985_6
AB481271 16642 Hosoya et al. (2010) Lachnum novoguineense var. yunnanicum Lachnum sp. Lachnum sp. (Lachnum sp. FC-2211) JAPAN, Ibaraki, Mt. Tsukuba culm of unidentified bamboo SH1236904.08FU SH1648536.08FU VSH97_10 VSH985_12
AB481270 16442 Hosoya et al. (2010) Lachnum novoguineense var. yunnanicum Lachnum sp. Lachnum sp. (Lachnum sp. FC-2117) JAPAN, Nagano, Ueda, Sugadaira Montane Research Center culm of unidentified bamboo †SH1236904.08FU †SH1648536.08FU VSH97_10 VSH985_12
MK584965 Ekanayaka et al. (2019) E. alba E. alba E. alba THAILAND, Chiang Mai (unspecified) †SH2596405.08FU †SH2712425.08FU VSH97_22 VSH985_25
AB267647 Miyoshi et al. (2007) Lachnum palmae sensu lato Lachnum palmae Lachnum palmae JAPAN, Oita leaf of Livistona chinensis SH1149764.08FU SH1515235.08FU VSH97_7 VSH985_8
LC425039 (duplicate; UDB0779046) 13500 Johnston et al. (2019) Lachnum palmae sensu lato Lachnum palmae Lachnum palmae JAPAN, Kagoshima, Yakushima Island leaf of Livistona chinensis var. subglobosa SH1149764.08FU SH1515235.08FU VSH97_7 VSH985_8
UDB0779066/LC669454 39729 this study Lachnum palmae sensu lato - - JAPAN, Okinawa, Iriomote Island leaf of Livistona chinensis var. subglobosa SH1149764.08FU SH1515235.08FU VSH97_7 VSH985_8
MG283320 Zhao et al. (2018) Lachnum palmae sensu lato Lachnum palmae Lachnum palmae CHINA, Linzhou root of Przewalskia tangutica (endophyte) †SH1149764.08FU †SH1515235.08FU VSH97_7 VSH985_8
UDB0779089/LC669477 17567 this study Lachnum palmae sensu lato - - NEW ZEALAND leaf of unidentified palm SH2594271.08FU SH2709065.08FU VSH97_15 VSH985_16
MH921862 unpublished Lachnum palmae sensu lato Lachnum palmae Lachnum palmae NEW ZEALAND unidentified part of Rhopalostylis sapida †SH2594271.08FU †SH2709065.08FU VSH97_15 VSH985_16
UDB0779052/LC669440 24588 this study Lachnum palmae sensu lato - - JAPAN, Kagoshima, Amami-Oshima leaf of Livistona chinensis var. subglobosa SH3569651.08FU SH3597456.08FU VSH97_9 VSH985_17
UDB0779047/LC669435 11197 this study Lachnum palmae sensu lato - - JAPAN, Shizuoka, Shimoda leaf of Livistona chinensis var. subglobosa †SH3569651.08FU †SH3597456.08FU VSH97_9 VSH985_17
UDB0779048/LC669436 26161 this study Lachnum palmae sensu lato - - JAPAN, Tokyo, Chichijima Island leaf of Livistona boninensis SH3569651.08FU SH3597457.08FU VSH97_9 VSH985_11
UDB0779058/LC669446 26172 this study Lachnum palmae sensu lato - - JAPAN, Tokyo, Kita-Iwojima Island leaf of Livistona chinensis var. subglobosa SH3569651.08FU SH3597457.08FU VSH97_16 VSH985_11
UDB0779059/LC669447 26185 this study Lachnum palmae sensu lato - - JAPAN, Tokyo, Kita-Iwojima Island leaf of Livistona chinensis var. subglobosa SH3569651.08FU †SH3597457.08FU VSH97_16 VSH985_11
UDB0779056/LC669444 24600 this study Lachnum palmae sensu lato - - JAPAN, Kagoshima, Amami-Oshima leaf of Livistona chinensis var. subglobosa †SH3569653.08FU †SH3597459.08FU VSH97_25 VSH985_28
U58640 Cantrell and Hanlin (1997) E. euterpes Lachnum euterpes Lachnum euterpes PUERTO RICO (unspecified) †SH1236906.08FU †SH1648538.08FU VSH97_21 VSH985_24
KT384413 Ekanayaka et al. (2019) E. fusiformis Lachnum fusiforme Lachnum fusiforme THAILAND dead stems ‡SH1236907.08FU ‡SH1648539.08FU VSH97_11 VSH985_13
MK584948 Ekanayaka et al. (2019) E. fusiformis Lachnum fusiforme Lachnum fusiforme CHINA dead stems SH1236907.08FU SH1648539.08FU VSH97_11 VSH985_13
UDB0779049/LC669437 26520 this study E. boninensis - - JAPAN, Tokyo, Hahajima Island wood of unidentified tree †SH3569652.08FU †SH3597458.08FU VSH97_20 VSH985_21
UDB0779060/LC669448 26500 this study E. insulae - - JAPAN, Tokyo, Hahajima Island wood of unidentified tree SH3569654.08FU SH3597460.08FU VSH97_14 VSH985_15
UDB0779063/LC669451 39720 this study E. insulae - - JAPAN, Okinawa, Iriomote Island bark of unidentified tree †SH3569654.08FU †SH3597460.08FU VSH97_14 VSH985_15
UDB0779075/LC669463 61920 this study E. paralushanensis - - JAPAN, Shizuoka, Atami culm of Pleioblastus argenteostriatus †SH3569655.08FU †SH3597462.08FU VSH97_19 VSH985_20
AF505515 E. lushanensis Lachnum lushanense Lachnum lushanense (unspecified) (unspecified) †SH1155706.08FU †SH1523143.08FU VSH97_8 VSH985_10
JF937582 Zhao and Zhuang (2011) E. lushanensis Lachnum lushanense Lachnum lushanense CHINA (unspecified) SH1155706.08FU SH1523143.08FU VSH97_8 VSH985_10
MG434782 unpublished E. lushanensis Erioscyphella sp. E. lushanensis INDIA, Tangmarg root tips of Pinus wallichiana (ectomycorrhiza) (unassigned) (unassigned) VSH97_8 VSH985_10
UDB0779081/LC669469 81272 this study E. papillaris - - JAPAN, Gunma, Minakami leaf of unidentified bamboo †SH3569656.08FU †SH3597463.08FU VSH97_23 VSH985_26
UDB0779084/LC669472 81401 this study E. sasibrevispora - - JAPAN, Hokkaido, Tomakomai culm of Sasa nipponica SH3569657.08FU SH3597464.08FU VSH97_13 VSH985_23
UDB0779082/LC669470 80399 this study E. sasibrevispora - - JAPAN, Gunma, Higashi-Agatsuma sheath of Sasa veitchii †SH3569657.08FU †SH3597464.08FU VSH97_13 VSH985_22
UDB0779085/LC669473 81472 this study E. otanii - - JAPAN, Hokkaido, Horonobe, Teshio Experimental Forest, Hokkaido University leaf of Sasa senanensis †SH3569658.08FU †SH3597465.08FU VSH97_24 VSH985_27
UDB0779087/LC669475 17245 this study Lachnum mapirianum - - MALAYSIA, Gerik leaf of unidentified tree †SH3569659.08FU †SH3597466.08FU VSH97_17 VSH985_18
UDB0779088/LC669476 17249 this study Lachnum mapirianum - - MALAYSIA, Gerik leaf of unidentified tree SH3569659.08FU SH3597466.08FU VSH97_17 VSH985_18

The extracted and aligned ITS sequences were composed of three partitions, ITS1 (162 bp), 5.8S (157 bp), and ITS2 (142 bp). The concatenated ITS sequence matrix was registered in TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S28473). In the ASAP analysis, the concatenated dataset of these partitions (461 bp) was input, and 87 ITS sequences were clustered into 18 SHs with the lowest asap-score, reflecting better partitioning (Suppl. material 1: Fig. S3). In the GMYC analysis, 29 SHs were delimited (Suppl. material 1: Fig. S4). The ultrametric tree constructed for the GMYC analysis is available in TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S28473). For the PTP analyses, an ML best-scored tree was constructed (Suppl. material 1: Fig. S5). PTP analyses delimited 23 SHs in the Bayesian support and 26 SHs in the ML support (Suppl. material 1 Fig. S6), and the former was adopted.

Comparing the number of SHs generated by different clustering methods and applied thresholds, 18 SHs by ASAP, and 23 SHs by UNITE SH at 3% threshold represented the lowest SH numbers (Fig. 3; Table 2). The ASAP results were too rough to delimit the boundaries of E. abnormis, E. boninensis, E. brasiliensis, E. curvispora, and E. sclerotii. SH-classification recognized by UNITE SH at 3% threshold mostly corresponded to taxon names originally assigned to sequences.

Comparing the results of seven species delimitation methods (UNITE SH at 3% threshold, UNITE SH at 1.5% threshold, VSEARCH 97% similarity, VSEARCH 98.5% similarity, ASAP, GMYC, and PTP), sequences labeled as E. alba, E. brasiliensis, E. curvispora, E. euterpes, E. fusiformis, E. lunata, E. sclerotii, L. mapirianum, L. mapirianum var. sinense, L. novoguineense var. yunnanica, and six new species candidates were distinguished as separate clusters by more than four delimitation methods (Fig. 3). These species clusters did not contradict with morphological/ecological and phylogenetic relationships (Fig. 1). Seven sequences labeled as L. hainanense were clustered into one SH by four species delimitation analyses, and part of the SHs included a sequence labeled as Lachnum albidulum (Fig. 3).

Erioscyphella abnormis, E. aseptate, and L. palmae did not form separate clusters supported by majority of four species delimitation analyses (Fig. 3). Sequences labeled as E. abnormis were clustered into one to four SHs, and some SHs included sequences labeled as Chapsa patens (Nyl.) Frisch, E. aseptata, E. brasiliensis, and E. sclerotii (Fig. 3). Twelve sequences labeled as L. palmae were clustered into four to six SHs (Fig. 3).

Discussion

Generic delimitation and generic concept of Erioscyphella

We accepted Clade A as a monophyletic unit for Erioscyphella which is supported by morphology. Although Clade B comprised Clade A together with P. alboviridis, Clade B should not be regarded as a genus delimitation of Erioscyphella, because Proliferodiscus differs from members of Clade A in having apothecia proliferating from the margins continuously and thick-walled and coarsely warted hairs (Haines and Dumont 1983; Spooner 1987). All members of Clade A are distinguishable from the other lachnacenous genera. In contrast to Erioscyphella, Albotricha and Dasyscyphella are distinguished by hair apices with no granulation (Hosoya et al. 2010), Brunnipila, Capitotricha, and Incrucipulum by hair-crystals (Baral and Krieglsteiner 1985; Tochihara and Hosoya 2019), and Lachnellula by ectal excipulum composed of textura globose to textura oblita (Dharne 1965). Typical members of Clade A can be easily segregated from Neodasyscypha, because the characteristic features of Neodasyscypha, such as dark-brown hairs, ectal-excipulum structure, and ellipsoid to fusoid ascospores < 10 µm long (Spooner 1987), are rare in Clade A. Among members of Clade A and Lachnum sensu stricto, the shape and length of ascospores were continuous (Fig. 4), as indicated by Haines and Dumont (1984). However, ascospores longer than 15–20 µm were restricted to Clade A (Fig. 4). Moreover, most members of Clade A have hairs with apical amorphous materials, which are not seen in Lachnum sensu stricto. Members of Clade A usually also have hairs not swelling at the apices and distantly septate, as Perić and Baral (2014) pointed out for three tropical members, while members of Lachnum have swelling apices. The combination of such characters allows us to differentiate typical members of Erioscyphella from Lachnum.

Figure 4. 

Comparison of ascospores of Clade A (= Erioscyphella) and the clade of Lachnum sensu stricto in Fig. 1. Subclade numbers for members of Clade A in Fig. 1 are shown in parentheses. Bars show variation of ascospore length within each species.

In summary, Erioscyphella is still difficult to define solely based on morphology because of multiple exceptional characters continuous to other genera, but its typical members could be recognizable mainly by the hair structures and ascospore length. Based on members of Clade A, Erioscyphella is tentatively described as follows: apothecia occurring on dead hardwood leaves, rotten wood, bamboo sheaths, bamboo leaves or palm leaves; asci mostly arising from simple septa, but occasionally from croziers; ascospores fusiform to long needle-shaped, aseptate to multi-septate; paraphyses filiform to narrowly lanceolate, shortly exceeding the asci, but rarely lanceolate and long exceeding the asci; hairs straight or irregularly curved, usually not swollen at the apices, thin-walled, hyaline, but sometimes brown, totally and densely granulated, usually distantly septate, without needle-like or three-dimensional shaped crystals but mostly equipped with hyaline to brown apical amorphous materials, and/or resinous materials at any part of hairs; walls of ectal excipulum cells smooth but granulate in one species.

Perić and Baral (2014) pointed out that “yellow hymenium derived from carotenoid” is one of the common characters of Erioscyphella. This feature was not discussed in this study because some specimens were not observed when fresh; the hymenium color is variable (usually white hymenium becomes yellow) between fresh and dried states in lachnaceous species.

Host selectivity of Erioscyphella

In Erioscyphella, the tendency of selectivity of species to host plants or parts occurs across the genus. Each subclade within Erioscyphella (Clade I–V) generally shared tendencies toward host selectivity as follows: Clade I on leaves of broad-leaved trees, except for E. paralushanensis occurring on bamboo sheaths, Clade II on palm leaves, Clade III on bamboo leaves, Clade IV on bamboo sheaths, and Clade V on rotten wood (Fig. 1). The results showed that selectivity to host plants, and parts of Erioscyphella, was acquired as apomorphic characters during speciation.

Is Erioscyphella limited to ‘tropical’ zones

Erioscyphella (long-spored Lachnum) has long been known as the tropical genus in Lachnaceae (Dennis 1954; Spooner 1987; Guatimosim et al. 2016). Most long-spored species were described from tropical areas of Latin America (Dennis 1954) and tropical to temperate areas of Australasia (Spooner 1987). However, the new species or new combinations proposed in this study were reported from Japan in subtropical areas (E. boninensis and E. insulae), temperate area (E. hainanensis, E. palalushanensis, and E. sinensis) and cool-temperate to subarctic areas (E. otanii, E. papillaris, and E. sasibrevispora), showing that Erioscyphella is not limited to tropical zones, but is also distributed in temperate to subarctic zones in the northern hemisphere.

Ascal iodine reactions seen in E. papillaris

Iodine reactions of the ascus apical apparatus have been classified into several types (inamyloid, hemiamyloid [Type RB and RR, and euamyloid Type BB]) (Baral 2009), and the reaction ‘MLZ- without KOH pretreatment and MLZ+ with KOH pretreatment’, observed in E. papillaris (Fig. 11E1 and Fig. 11E2) has been restricted to the type of hemiamyloid. However, the apical apparatus of E. papillaris showed a dark blue reaction in IKI without KOH pretreatment (Fig. 11E3), while the hemiamyloid apparatus usually shows a red reaction under these conditions. The hemiamyloid ascal apparatus could show IKI-blue without KOH pretreatment due to long storage in the herbarium (Baral 2009), but this is not applicable for the material of E. papillaris, which has been maintained for only two years in herbarium until observed. Therefore, we assessed the iodine reaction of E. papillaris as a new type, and color reactions with various solutions of the species should be further examined using new materials, because there are few apothecia in the type specimen.

Species-level taxonomic treatment of Erioscyphella

In this study, we carried out taxonomic treatment for species which were distinguished by morphology/ecology and phylogenetic analyses, and formed single clusters in species delimitation analyses. Based on this criteria, six undescribed species of Erioscyphella have been proposed as new species of Erioscyphella [E. boninensis, E. insulae, E. otanii, E. papillaris, E. paralushanensis, and E. sasibrevispora], and Lachnum hainanense and L. mapirianum var. sinense have been proposed as new members of Erioscyphella. Interpretation of species boundaries of L. hainanense was discussed in the taxonomy chapter. For new species and new combinations, Japanese names were also denominated for wider use of Japanese mycologists or amateurs.

In the phylogenetic analyses, Malaysian materials of L. mapirianum (TNS-F-17245, 17249) and Japanese materials of L. novoguineense var. yunnanicum (TNS-F-16442, 16642) were also found to be members of Erioscyphella (Fig. 1). However, we hesitate to transfer the two species into Erioscyphella, as we cannot guarantee the identification accuracy of the materials, because of inadequate type information of the two species.

Taxonomic assessments of E. abnormis, L. aseptate, and L. palmae, which were not accepted as independent species in species delimitation analyses, are discussed below.

In the species delimitation analyses, sequences labeled as E. abnormis formed a single SH at UNITE SH 3% threshold (DOI: SH1155612.08FU) and divided into two to four SHs at UNITE SH 1.5% threshold, VSEARCH, and GMYC (Fig. 3).

In ASAP, sequences labeled as E. abnormis belong to a single SH, but the SH also contained sequences labeled as Chapsa patens, E. aseptata, E. brasiliensis, E. curvispora, and E. sclerotii (Fig. 3). However, the phylogenetic analyses revealed that E. brasiliensis, and E. sclerotii are separate from the clade of E. abnormis (Fig. 1), suggesting that the two species are different from E. abnormis. Although E. curvispora was not included in the phylogenetic analyses (Fig. 1), the apparent morphological and ecological differentiation (Perić and Baral 2014) and low similarity of ITS (< 97%) with members of E. abnormis (Fig. 3) suggest that E. curvispora is different from E. abnormis.

Erioscyphella aseptata was originally described in Thailand and characterized by having aseptate ascospores, unlike E. abnormis or E. sclerotii with septate ascospores (Ekanayaka et al. 2019). However, the species delimitation analyses in this study suggested the difficulty of delimiting E. aseptata (MK584957) from E. abnormis (Fig. 3), suggesting that E. aseptata is a morphologically atypical (aseptate-ascospored) individual of E. abnormis.

Although two ITS sequences of C. patens (MT995055 = specimen no. FJ19131 and MW007918 = specimen no. FJ19049) were positioned in SHs dominated by E. abnormis, LSU and mtSSU sequences of FJ19131 and LSU sequence of FJ19049 were closely related to Chapsa spp. [Graphidaceae, Ostropales]. Since Lachnaceae and Graphidaceae are phylogenetically distant, the two ITS sequences MT995055 and MW007918 have been misidentified.

Considering that the monophyly of E. abnormis is strongly supported (Fig. 1) and members of the species share high ITS similarities (> 97%, compiled into SH1155612.08FU) (Fig. 3, Table 2), E. abnormis is accepted here as a species with some intraspecific morphological and phylogenetic variation.

Taxonomy of Lachnumpalmae

Lachnum palmae formed a strongly supported clade in the phylogenetic analyses (Clade II in Fig. 1). They also shared strong selectivity to palm leaves and characteristic morphology such as thick-walled asci, hairs with resinous materials and apical amorphous materials (Suppl. material 1: Fig. S2) and ectal excipulum composed of thick-walled prismatic cells and interwoven hyphae. However, sequences labeled as L. palmae were divided into 4 to 7 SHs in all species delimitation analyses (Fig. 3), indicating that L. palmae is a species complex that includes multiple potential sister species. At present, we avoid creating new species from the complex, because the morphological and ecological differences detected among SHs are not enough to delimit species boundaries, although the size of asci and ascospores differ among some SHs, as shown in Fig. 4. Phylogenetic analyses revealed that members of the L. palmae complex belonged to Erioscyphella (Fig. 1). However, we could not judge which SH within the complex is equivalent to L. palmae as originally described from Honduras by Kanouse (1941) and redescribed by Spooner (1987) from the type plus another specimen from New Zealand. There are no L. palmae sequences from the tropical American type locality, so phylogenetic characterization and recombination of the species were avoided in the present study.

Taxonomy

Erioscyphella boninensis Tochihara & Hosoya, sp. nov.

MycoBank No: MycoBank No: 835702
Figs 5, 6

Diagnosis

Differs from all other Erioscyphella species by the granulate walls of the ectal excipular cells.

Figure 5. 

Erioscyphella boninensis TNS-F-26520 (Holotype) A dried apothecia B pure culture on PDA (NBRC 114447) C ascus D ascal pore MLZ (+) E ascospores F paraphyses G ectal excipular cells H ectal excipular cells with red granules I hairs with resinous matters arising from ectal excipular cells. Mounted in CB/LA (C, E–I), MLZ (D). Scale bars: 1 mm (A); 10 µm (C–I).

Holotype

Japan, Bonin Islands, Chichijima Island, Mt. Tsutsujiyama, 27.060556, 142.222500, ca 270 m, 28 Jun. 2009, on fallen leaves of Pittosporum boninense, T.Hosoya (TNS-F-26520).

Figure 6. 

Erioscyphella boninensis TNS-F-26520 (Holotype) A ascospores B apothecium C vertical section of an apothecium D expansion of a vertical section of an apothecium E ectal excipular cells F asci G paraphyses H hairs.

GenBank/UNITE no. ex holotype

LC669437/UDB0779049 (ITS), LC533151 (LSU), LC533254 (mtSSU), LC533196 (RPB2).

Etymology

Referring to the type locality Bonin Islands.

Japanese name

Ogasawara-cha-hina-no-chawantake.

Description

Apothecia scattered, superficial, 0.5–1.0 mm in diameter, having well-developed stipes, up to 1.5 mm high, cream to pale brown, externally covered with short and shiny hairs. Disc concave, cream to pale yellow. Ectal excipulum textura prismatica composed of long elongated cells to textura angularis, 6–25 × 5–13 µm, hyaline to relatively brown colored, somewhat thick-walled; cell walls covered by granules with a similar appearance to those on hairs. Stipe composed of textura prismatica with a granulate surface as ectal excipular cells. Medullary excipulum textura intricata of hyaline hyphae up to 3 µm wide. Hairs straight, cylindrical, 38–62 × 2.5–4.0 µm, hyaline, completely covered by brown granules, 2–3-septate, thin-walled, arising from swelling cells completely covered by granules; apex lacking crystals or apical amorphous materials, equipped with amber-colored resinous materials dissolvable with CB/LA at a little below the apex. Asci (36–)37.7–44(–46) × (3.5–)3.6–4.2(–4.5) µm (av. 41 ±3.2 × 3.9 ± 0.3 µm, n = 16), 8-spored, cylindrical-clavate; pore blue in MLZ without 3% KOH pretreatment; croziers absent at the basal septa. Ascospores (9–)10–12.3(–13) × 1.2–1.7(–1.8) µm (av. 11 ± 1.2 × 1.5 ± 0.2 µm, n = 16), Q = (6.3–)6.9–9.2(–10) (av. 7.8 ± 1.5, n = 16), fusiform, aseptate. Paraphyses straight, up to 2.5 µm wide, septate, exceeding the asci up to 5 µm, narrowly lanceolate.

Culture characteristics

Colony of NBRC 114447/TNS-F-26520 on PDA umbonate forming a dome-shape, slightly sulcate. Context not shiny, velvety, buff at the center, paler toward the margin, dark buff from the reverse. Sectors and zonation absent. Aerial mycelium white or buff, dense cottony, forming white mycelium strands except in the margin. Margin distinct, entire, flat. Asexual morph absent.

Distribution

Japan. (Bonin Islands). Known only from the type locality.

Notes

Granulation on the surface of the ectal excipular cells has been observed only in Incrucipulum in Lachnaceae (Baral and Krieglsteiner 1985; Tochihara and Hosoya 2019), and E. boninensis is the first report for such a character in Erioscyphella (Fig. 5H, 6E). Phylogenetic analysis revealed that E. boninensis is closely related to E. paralushanensis (Fig. 1). The two species (Clade IA, Fig. 1) have colored granules on hairs and forming red mycelia on PDA. However, granulation of ectal excipulum is seen only in E. boninensis.

Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara, comb. nov.

MycoBank No: MycoBank No: 835707

Lachnum hainanense W.Y. Zhuang & Zheng Wang, Mycotaxon 67: 25 (1998).

Diagnosis

Forming apothecia with long stipes and long hairs. Differing E. sinensis in much shorter ascospores.

Japanese name

Shii-Kashi-hina-no-chawantake.

Specimens examined

Japan, Niigata, Minamiuonuma, 37.056808, 138.80705, ca 720 m, 14 May 2010, on fallen leaves of Quercus glauca, T.Hosoya (TNS-F-35049). Ibid (TNS-F-35056). Japan, Kanagawa, Hiratsuka, 35.33861111, 139.285, ca 80 m, 12 Apr. 2015, on fallen leaves of Q. myrsinifolia, M.Nakajima (TNS-F-61775). JAPAN, Kanagawa, Kamakura, 35.30756, 139.51958, ca 40 m, 24 Apr. 2015, on fallen leaves of Q. serrata, M.Nakajima (TNS-F-61941). Japan, Gunma, Midori, 36.476684, 139.242771, ca 510 m, 9 May 2016, on fallen leaves of Q. serrata, K.Furuya (TNS-F-65722). Japan, Kanagawa, Hiratsuka, 35.340139, 139.287167, ca 60 m, 18 May 2017, on fallen leaves of Q. glauca, Y.Tochiara (TNS-F-80356). The same locality, on fallen leaves of Castanopsis sieboldii, Y. Tochihara (TNS-F-80371).

Distribution

China (Hainan), Japan (Honshu: Kanto region).

Notes

Based on the UNITE SH system at a 3% threshold, ITS sequences of this species were integrated into a single SH (DOI: SH1155844.08FU). SH1155844.08FU included sequences labeled as ‘Hyaloscyphaceae’ (JX984680) in UNITE and ‘L. albidulum’ (MK282242) in INSDC (Table 2). JX984680 was sequenced from air samples in Seoul, South Korea, and was not tied to any fungal specimens or cultures. Lachnum albidulum is common on leathery dicot leaves of the old and new world tropics (Haines 1992). Erioscyphella hainanensis resembles L. albidulum in morphology, but L. albidulum has yellow resinous substances at the tip of apothecial hairs and occurs on dead leaves of Rubiaceae (Haines 1992), whereas E. hainanensis lacks resinous substances and occurs on leaves of broad-leaved trees (Zhuang and Wang 1998b; Hosoya et al. 2013). Therefore, we presume that MK282242, coexisting with L. hainanense in every SH, was misidentified as L. albidulum. No sequences are available for L. albidulum specimens from the type locality. Lachnum hainanense was therefore judged as acceptable species, and recombined into Erioscyphella.

Erioscyphella hainanensis resembles E. sinensis in occurring on dead leaves of Quercus spp. or Castanopsis spp. However, E. hainanensis has much shorter ascospores than E. sinensis. In this study, presence of minute, hyaline apical amorphous materials and absence of any crystals or resinous materials were confirmed in both species (Suppl. material 1: Fig. S2).

Erioscyphella insulae Tochihara & Hosoya, sp. nov.

MycoBank No: MycoBank No: 835703
Figs 7, 8

Diagnosis

Characterized by pure white apothecia unlike related species Lachnum nothofagi, and two-layered ectal excipulum.

Holotype

Japan, Okinawa, Yaeyama, Taketomi, Iriomote Island, Otomi, 24.297458, 123.866128, ca 50 m, 12 Jun. 2011, on fallen bark of unidentified tree, T.Fukiharu (TNS-F-39720).

GenBank/UNITE no. ex holotype

LC669451/UDB0779063 (ITS), LC533177 (LSU), LC533261 (mtSSU), LC533207 (RPB2).

Other specimens examined

Japan, Bonin Islands, Hahajima Island, Sekimon, 26.666686, 142.152222, ca 260 m, 24 Jun. 2009, on fallen bark of unidentified tree, T.Hosoya (TNS-F-26485, 26500).

Etymology

Referring to the occurrence of the species on remote islands in Japan.

Japanese name

Shima-hina-no-chawantake.

Description

Apothecia gregarious, superficial, 0.7–1.4(–2.5) mm in diameter, short- and thick-stipitate, up to 0.8 mm high, externally white to cream throughout but sometimes pale brown in the lower parts, covered with white hairs. Disc concave, cream to pale yellow (fresh state not observed). Ectal excipulum composed of two layers: outer layer textura angularis, up to 20 µm thick, 3–28 × 2–8 µm, hyaline, thin to relatively thick-walled, with cell walls smooth; inner layer up to 15 µm thick, textura porrecta composed of hyaline hyphae up to 5 µm wide. Medullary excipulum up to 100 µm thick, composed of hyaline hyphae forming textura intricata; hyphae up to 3 µm wide. Hairs straight or irregularly curved, cylindrical, sometimes branched, up to 125 × 2.5–3.0 µm, hyaline, completely granulate, thin-walled; lacking crystals or resinous materials; apex usually equipped with hyaline apical amorphous materials. Asci (88–)92–101(–106) × 6–7.3(–8) µm (av. 96 ± 4.5 × 6.7 ± 0.6 µm, n = 18), 8-spored, thick-walled, cylindrical-clavate, arising from ascogenous hyphae branching several times; pore blue in MLZ without 3% KOH pretreatment; croziers absent at the basal septa. Ascospores (24–)26.7–34.5(–39) × (1.8–)1.9–2.3(–2.5) µm (av. 31 ± 3.9 × 2.1 ± 0.2 µm, n = 18), Q = (11–)12.5–17(–20) (av. 14.7 ± 2.3, n = 18), showing various shapes and lengths, usually long fusiform and sometimes hypsiloid or sigmoid due to bending of both ends, sometimes swelling or constricted irregularly, aseptate or one- to three-septate (usually one-septate). Paraphyses straight, narrowly lanceolate, up to 2.5 µm wide, septate, exceeding the asci up to 7.5 µm.

Culture characteristics

Colony of NBRC 114445/TNS-F-26500 and NBRC 114459/TNS-F-39720 on PDA relatively thick-planar, pruinose, white to cream, ivory at the margin, pale sepia. Sectors and zonation absent. Aerial mycelium white to pale ocher, mainly developed except in the margin, not forming mycelial strands. Soluble pigment amber colored produced at the center. Margin unclear, flat and immersed into agar, radially undulate. Anamorph not seen.

Distribution

Japan (Bonin Islands, Yaeyama Islands).

Notes

This fungus resembles Lachnum nothofagi (Dennis) Spooner in the size and shape of apothecia, ascospores, asci, and hairs. However, E. insulae has completely hyaline hairs and ectal excipulum, and hairs are equipped with apical materials (Fig. 7J, 8A), whereas L. nothofagi has partly to totally brown hairs and ectal excipulum (Spooner 1987). Lachnum nothofagi is currently known only from New Zealand and Australia and mainly arises from Nothofagus spp., which are native in the southern hemisphere (Spooner 1987).

Figure 7. 

Erioscyphella insulae TNS-F-39720 (Holotype) A dried apothecia B a pure culture on PDA (NBRC 114459) C asci D ascal pore MLZ (+) E ascospores F ascogenous hyphae G paraphyses H layer structures of excipulum H1 medullary excipulum H2 inner layer of ectal excipulum composed of hyphae H3 outer layer of ectal excipulum composed of textura angularis I, J hairs with apical amorphous materials. Mounted in CB/LA (C, E–J), MLZ (D). Scale bars: 1 mm (A); 10 µm (A–J).

Figure 8. 

Erioscyphella insulae TNS-F-39720 (Holotype) A expansion of a vertical section of an apothecium B ascospores C apothecium D vertical section of an apothecium E asci F paraphyses G layer structures of excipulum.

Erioscyphella otanii Tochihara, sp. nov.

MycoBank No: MycoBank No: 835704
Figs 9, 10

Diagnosis

Characterized by pure white minute apothecia (< 0.3 mm in diameter) unlike L. diminutum with rather colored apothecia, and smaller asci compared to similar species Lachnum minutum.

Holotype. Japan, Hokkaido, Horonobe, Toikambetsu, Teshio Experimental Forest, Field Science Center for Northern Biosphere, Hokkaido University, 44.993978, 142.130125, ca 400 m, 11 Jul. 2018, on fallen leaves of Sasa senanensis, Y.Tochihara & K.Kaneko (TNS-F-81472).

GenBank/UNITE no. ex holotype

LC669471/UDB0779083 (ITS), LC533179 (LSU), LC533286 (mtSSU), LC533226 (RPB2).

Other specimen examined

Japan, Hokkaido, Sapporo, Mt. Moiwa, 43.024718, 141.318427, ca 530 m, 21 Jun. 1965, on fallen leaves of Sasa kurilensis, Y.Otani (TNS-F-50482, in poor condition).

Etymology

Referring to the name of Dr Yoshio Otani, the first discoverer of this species.

Japanese name

Kita-sasaba-hina-no-chawantake.

Description

Apothecia scattered, superficial, minute, 0.1–0.3 mm in diameter, at first spherical and later urceolate, having well-developed stipes, up to 0.3 mm high, pure white, externally covered with short white hairs, never colored brown. Disc concave, almost enclosed by an incurving margin when fresh and dry, cream to pale yellow when dry (not observed when fresh). Ectal excipulum textura prismatica like stone pavings arranged in rows, 3–25 × 3–8 µm, hyaline, relatively thick-walled; cell walls smooth. Medullary excipulum textura intricata; hyphae up to 2.5 µm wide. Hairs straight, cylindrical or tapering toward the apices, up to 60 µm long, up to 5 µm wide near the bases and 2.5–3.0 µm wide near the apices, arising from swollen ectal excipular cells, hyaline, up to 3-septate (usually 1- or 2-septate), thin-walled, completely granulated; granules dense near the apices and coarse toward the bases; apex sometimes with a hyaline and inconspicuous apical amorphous materials not dissolved with CB/LA, lacking any crystals or resinous materials. Asci (33–)34–38.8(–41) × 4–5 µm (av. 37 ± 2.2 × 4.4 ± 0.4 µm, n = 15), 8-spored, cylindrical-clavate, relatively thick-walled; pore blue in MLZ without 3% KOH pretreatment; croziers absent at the basal septa. Ascospores (11.5–)12.3–14.6(–15) × (1.2–)1.36–1.7(–1.8) µm (av. 13.4 ± 1.2 × 1.6 ± 0.2 µm, n = 15), Q = (6.7–)7.8–9.6(–10.8) (av. 8.7 ± 0.9, n = 15), fusiform, aseptate. Paraphyses straight, narrowly lanceolate to lanceolate, up to 2.5 µm wide, septate, exceeding the asci up to 10 µm.

Culture characteristics

Colony of NBRC 114476/TNS-F-81472 on PDA flat, partially protruding and forming mycelial mass, divided into two sectors. One sector flat, wooly to velvety, white to cream; dark ocher from the reverse. The other sector with wooly context, white and partly yellow; pale ocher from the reverse. Aerial mycelia developed throughout the colony, white, sparse to cottony, not forming mycelium strands. Margin distinct, flat and immersed into the agar. Soluble pigment absent. Asexual morph absent.

Distribution

Japan (Hokkaido; subarctic zone).

Notes

Erioscyphella otanii was first collected and documented by Otani (1967) under the misapplied name Dasyscyphus diminutus (TNS-F-50482). Based on the description, we concluded that the specimen was the same species as TNS-F-81472. The present species is very similar to Lachnum diminutum (Roberge ex Desm.) Rehm in the minute apothecia, ascospore size, and narrow paraphyses; however, E. otanii is pure white when fresh and dry (Fig. 9A, in dried state) and occurs on bamboo leaves, while L. diminutum is somewhat brown in the exterior parts of apothecia and occurs on sheaths of Juncus spp. (Dennis 1949). In the mature state, the apothecia of E. otanii become urceolate (Fig. 9A and Fig. 10B), whereas the apothecia of L. diminutum are flat (Dennis 1949). The ITS sequence of TNS-F-81472 showed low similarity (< 80%) with that of L. diminutum collected in France (GenBank accession number: MH857306). Based on the French sequence, L. diminutum is phylogenetically a good Lachnum.

Figure 9. 

Erioscyphella otanii TNS-F-81472 (Holotype) A dried apothecia B pure culture on PDA (NBRC 114476) C asci D ascal pore MLZ (+) E ascospore F paraphyses G a hair H hair-apex with a apical amorphous material I ectal excipular cells. Mounted in CB/LA (C, E–I), MLZ (D). Scale bars: 0.5 mm (A); 10 µm (C–I).

The appearance of E. otanii is also similar to that of the graminicolous species Lachnum minutum W.Y. Zhuang and M. Ye documented in China (Ye and Zhuang 2003). Erioscyphella otanii is distinguished from L. minutum in having smaller asci, although DNA sequences of the species are not available.

Figure 10. 

Erioscyphella otanii TNS-F-81472 (Holotype) A ascospores B apothecium C vertical section of an apothecium D hairs with cap-like structures arising from ectal excipular cells E expansion of a vertical section of an apothecium F paraphyses G asci.

Erioscyphella papillaris Tochihara, sp. nov.

MycoBank No: MycoBank No: 835705
Figs 11, 12

Diagnosis

Characterized by protruding papillary hairs with hyaline apical amorphous materials.

Holotype

Japan, Gunma, Minakami, Yubiso, Mt. Tanigawadake, 36.064014, 141.344653, ca 710 m, 16 Jul. 2017, on both sides of a fallen leaf of bamboo, Y.Tochihara (TNS-F-81272).

GenBank/UNITE no. ex holotype

LC669473/UDB0779085 (ITS), LC533161 (LSU), LC533285 (mtSSU), LC533204 (RPB2).

Etymology

Referring to papillate hair apices.

Japanese name

Sasaba-hina-no-chawantake.

Description

Apothecia gregarious, superficial, minute, 0.1–0.3 mm in diameter, short-stipitate, up to 0.25 mm high, externally densely covered with pure white short hairs. Disc concave, white to lemon yellow when fresh and dry. Ectal excipulum textura prismatica composed of cuboid cells, 3–13 × 2.5–7 µm, hyaline, thin-walled, lacking carotenoid pigments; cell walls smooth. Medullary excipulum textura intricata of hyaline hyphae up to 3 µm wide. Hairs straight, cylindrical, 45–75 × 3–5 µm, 2–3-septate, hyaline, totally granulate, thin-walled, arising from swollen cells; apical cells rather longer than other cells, 30–40 µm long, with papillate at the apex, sometimes swelling, equipped with hyaline and globose apical amorphous materials not dissolved with CB/LA, lacking any crystals or resinous matters. Asci (59–)59.8–66(–69) × (7.5–)7.6–8.3(–9) µm (av. 63 ± 2.9 × 8.0 ± 0.4 µm, n = 16), 8-spored, cylindrical-clavate; pore inamyloid with MLZ without 3% KOH pretreatment, faint blue with MLZ with 3% KOH pretreatment, dark blue with IKI with and without KOH pretreatment; vesicle apparatus inverted-v-shaped present near the apices; croziers absent at the basal septa; base sympodially branched. Ascospores (16–)17.5–21.7(–24) × (2–)2.3–2.8(–3) µm (av. 20 ± 2.1 × 2.6 ± 0.3 µm, n = 20), Q = (6.4–)6.8–8.9(–9.8) (av. 7.8 ± 1.0, n = 20), fusiform, aseptate, or one-septate (rarely two-septate), filled with hyaline oil drops. Paraphyses straight, cylindrical, up to 3 µm wide, septate, containing small hyaline lipid bodies, equal or scarcely exceeding the asci.

Culture characteristics

Colony of NBRC 113937/TNS-F-81272 on PDA divided into two semicircular zones. The first zone umbonate, pruinose, white, producing white aerial mycelia densely, presenting wooly appearance; margin distinct, entire, flat. The second zone flat, glutinous, white to beige with concentric patterns, producing few aerial mycelia; margin entire, flat and immersed into agar, irregularly undulate. The reverse uniform unrelated to the zoning position, beige to pale dark brown throughout. Soluble pigment and asexual morph absent throughout the colony.

Distribution

Japan (Mt. Tanigawa). Currently known only from the type locality.

Notes

This species is similar to Lachnum sclerotii var. microascum in the dimension and shape of asci and ascospores, habitats, and inconspicuous ascus apex reaction in MLZ (Zhuang 2004). However, E. papillaris has ascospores containing conspicuous guttules in any mount (Fig. 11G) and filiform paraphyses rarely exceeding the asci (Fig. 11F, Fig. 12D, and Fig. 12G), whereas L. sclerotii var. microascum has non-guttulate asci and narrowly lanceolate to lanceolate paraphyses exceeding the asci by 15–18 µm (Zhuang 2004). Although DNA sequences of L. sclerotii var. microascum are not available, we judged the present fungus as different from it, because the presence or absence of guttules in ascospores is a significant taxonomic character at the species level (Baral 2015).

Figure 11. 

Erioscyphella papillaris TNS-F-81272 (Holotype) A dried apothecia B pure culture on PDA (NBRC 113937) C Ascus arising from ascogenous hyphae D an ascus E ascal pore iodine reactions E1 MLZ (-) without 3% KOH pretreatment E2 MLZ (-) with 3% KOH pretreatment E3 IKI (+) without 3% KOH pretreatment F paraphysis G ascospores with guttules H ectal excipulum I hair-apex with a apical amorphous material J hairs. Mounted in CB/LA (C, D, F–J), MLZ (E1, E2), IKI (E3). Scale bars: 0.5 mm (A); 10 µm (C–J).

Papillate hairs are also shown in the line drawings of Lachnum gahniae Spooner (Spooner 1987), suggesting the relationship of the present fungus to Australasian species. However, L. gahniae can be distinguished by having longer hairs, occurring on different substrates (leaves of Cyperaceae) and showing different ascal-iodine reactions (MLZ+) (Spooner 1987), although DNA sequences of L. gahnia are not available.

Figure 12. 

Erioscyphella papillaris TNS-F-81272 (Holotype) A apothecium B vertical section of an apothecium C ascospores D expansion of an vertical section of an apothecium E ectal excipular cells F asci G paraphyses H hairs with cap-like structures.

Erioscyphella paralushanensis Tochihara and Hosoya, sp. nov.

MycoBank No: MycoBank No: 839618
Figs 13, 14

Diagnosis

Characterized by throughout red apothecia occurring on bamboo sheaths. Similar to E. lushanensis in macro- and micromorphology and habitats, but has larger asci and ascospores.

Holotype

Japan, Shizuoka, Atami, Izusan, 35.128834, 139.051194, ca 620 m, 8 Jun. 2015, on fallen sheaths of Pleioblastus argenteostriatus, M.Nakajima (TNS-F-61920).

GenBank/UNITE no. ex holotype

LC669463/UDB0779075 (ITS), LC533141 (LSU), LC533267 (mtSSU), LC533220 (RPB2).

Etymology

Referring to the similarity with E. lushanensis.

Japanese name

Akage-hina-no-chawantake.

Description

Apothecia scattered, superficial, 0.7–1.5 mm in diameter, long-stipitate, up to 2.0 mm high, externally covered with dark-red hairs. Disc concave, cream to pale yellow. Ectal excipulum well-developed textura prismatica and partly t. angularis, 6–13 × 2.0–2.5 µm, hyaline, relatively thick-walled, with smooth walls. Medullary excipulum textura intricata of hyaline hyphae up to 2 µm wide. Hairs straight, cylindrical, up to 160 µm long, 2.0–3.0 µm wide, pale brown but hyaline near the bases; hair cells narrowly septate, > 7 µm long, covered by big and amber-colored granules; granules big and dense near the apices and smaller and sparse near the bases, up to 2 µm in diameter near the apices, equipped with amber-colored resinous materials that dissolves in CB/LA at any position of hairs; apices with amber-colored apical amorphous materials, lacking any crystals. Asci (59–)61.4–70.2(–73) × (4.5–)4.7–5.6(–6) µm (av. 65.8 ± 4.4 × 5.2 ± 0.4 µm, n = 15), Q = (11.5–)12–13.6(–14.6) (av. 12.8 ± 0.8, n = 15), 8-spored, cylindrical-clavate; pore faintly blue in MLZ without 3% pretreatment, clear blue in MLZ with 3% KOH pretreatment and IKI without 3% KOH pretreatment. Ascospores (14–)15.8–20.7(–22) × (1.5–)1.7–2.0 µm (av. 18.2 ± 2.5 × 1.8 ± 0.2 µm, n = 15), Q = (7.5–)8.7–11.2(–12.6) (av. 9.9 ± 1.3, n = 15), septate, sometimes bent to U-shaped or S-shaped, containing conspicuous guttules; guttules hyaline but sometimes red. Paraphyses straight, up to 2 µm wide, septate, exceeding the asci 5–10 µm, initially cylindrical to clavate, later becoming narrowly lanceolate.

Culture characteristics

Colony of NBRC 114468/TNS-F-61920 on PDA flat, sparse, dendritically spread. Context wooly, ocher to pale buff, dark buff from the reverse. Sectors and zonation absent. Aerial mycelium ocher to pale buff, dense cottony, developed near the center, forming white mycelium strands; margin distinct, flat and partly immersed into the agar. Asexual morph absent. Soluble pigments present, buff, dyeing agar without colony pale buff.

Distribution

Japan (Shizuoka). Currently known only from the type locality.

Figure 13. 

Erioscyphella paralushanensis TNS-F-61920 (Holotype) A apothecia B pure culture on PDA (NBRC 114468) C ascus D ascal pore iodine reactions D1 MLZ (faintly +) without 3% KOH pretreatment D2 MLZ (+) with 3% KOH pretreatment D3 IKI (+) without 3% KOH pretreatment E paraphysis F ascospores G ectal excipular cells H marginal section of an apothecium generating hairs I hairs with red resinous materials J apical amorphous materials of hairs. Mounted in CB/LA (C, E–J), MLZ (D1, D2), IKI (D3). Scale bars: 0.5 mm (A); 10 µm (C–J).

Notes

Erioscyphella paralushanensis is closely related to E. lushanensis in having red hairs (Fig. 13I) and the ectal excipulum composed of well-developed rectangular cells in common (Fig. 13H, Fig. 14C, and Fig. 14F) (Zhuang and Wang 1998a). Compared with E. lushanensis, E. paralushanensis has slightly larger asci, ascospores and hairs. Red guttules in ascospores were observed only in E. paralushanensis (Fig. 13F). In this study, we proposed the present fungus as a new species, because species delimitation analyses based on ITS sequences strongly supported that E. paralushanensis is different from E. lushanensis (Fig. 3).

Figure 14. 

Erioscyphella paralushanensis TNS-F-61920 (Holotype) A apothecia B vertical section of an apothecium C expansion of an vertical section of an apothecium D asci E hairs F ectal excipulum G paraphyses H ascospores.

Erioscyphella sasibrevispora Tochihara & Hosoya, sp. nov.

MycoBank No: MycoBank No: 835706
Figs 15, 16

Diagnosis

Characterized by wooly appearance and yellow to orange discs, and distinguished from similar species Lachnum novoguineense var. yunnanicum in having shorter ascospores.

Holotype

Japan, Hokkaido, Tomakomai, Utonai, 42.705314, 141.7346, ca 10 m, 16 Jun. 2018, on fallen sheaths of Sasa nipponica, Y.Tochihara & T.Hosoya (TNS-F-81401).

GenBank/UNITE no. ex holotype

LC669470/UDB0779082 (ITS), LC533174 (LSU), LC533269 (mtSSU), LC533217 (RPB2).

Other specimen examined

Japan, Gunma, Higashiagatsuma, 36.562253, 138.724139, ca 1330 m, 6 Jun. 2017, on fallen sheaths of Sasa veitchii, Y.Tochihara & T.Hosoya (TNS-F-80399, in bad condition).

Etymology

“sasi” means bamboo [host plants] and “brevispora” means shorter ascospores compared to L. novoguineense var. yunnanicum.

Japanese name

Sasa-no-youmou-chawantake.

Description

Apothecia gregarious, superficial, 0.6–1.3 mm in diameter, short-stipitate, up to 0.8 mm high, pure white, externally covered with long white hairs. Disc concave, yellow to pale orange when fresh and dry. Ectal excipulum textura prismatica to t. angularis, 3–16 × 2–10 µm, hyaline, thin-walled; surface smooth. Medullary excipulum textura intricata of hyaline hyphae up to 2 µm wide. Hairs straight, delicate, cylindrical with relatively acute apices, up to 190 × 2–3 µm, hyaline, totally granulate, thin-walled; apical cell a little longer than other cells, lacking any crystals, resinous materials, or apical amorphous materials. Asci (79–)82.5–90(–95) × (6–)6.6–8.1(–9) µm (av. 86 ± 4.0 × 7.4 ± 0.8 µm, n = 15), 8-spored, cylindrical-clavate; lateral parts sometimes swelling irregularly; pore blue in MLZ without 3% KOH pretreatment; croziers with perforation present at the basal septa. Ascospores (26–)27.9–36.1(–39) × (1.5–)1.7–2 µm (av. 32 ± 4.1 × 1.8 ± 0.2 µm, n = 17), Q = (13–)15–19.7(–21) (av. 17.5 ± 2.3, n = 17), long fusiform, usually 3-septate, rarely 0- to 2-septate (only observed in TNS-F-81401 because TNS-F-80399 was immature). Paraphyses straight, lanceolate, 2.5–4 µm wide, densely septate, exceeding the asci up to 15 µm. Note that the description is solely based on the holotype because another examined specimen TNS-F-80399 was in bad condition.

Culture characteristics

Colony of NBRC 114475/TNS-F-81401 on PDA wrinkled. Context cottony and partially funiculose, white, turning ocher at the center; almost ocher except for the white margin from the reverse. Sectors and zonation absent. Aerial mycelium developed throughout the colony, concolous, forming mycelium strands. Margin indistinct, flat and immersed into agar. Soluble pigment absent. Asexual morph absent.

Distribution

Japan (cool-temperate zone, subarctic zone).

Notes

Erioscyphella sasibrevispora is closely related to L. novoguineensis var. yunnanicum (TNS-F-16442, 16642) (Fig. 1) and occurs in the same habitats (that is, bamboo sheaths) but has shorter asci and ascospores. The ascal bases of the two species are very characteristic, in that they have croziers with perforations (Fig. 15G and Fig. 16E). In Lachnaceae, this type of crozier has only been reported in Lachnellula (Baral 1984). Additionally, both species exceptionally lack any hair materials in Erioscyphella.

Figure 15. 

Erioscyphella sasibrevispora TNS-F-81401 (Holotype, A–F, H–J). Lachnum novoguineense var. yunnanicum TNS-F-16442 (G) A dried apothecia B a pure culture on PDA (NBRC 114475) C ectal excipular cells D ascus E an ascal pore MLZ (+) F ascal base with a perforated crozier G ascal base with a perforated crozier H septated paraphyses I ascospores J vertical section through the apothecium. Mounted in CB/LA (D, F–J), MLZ (E). Scale bars: 1 mm (A); 10 µm (C–J).

The tropical species E. bambusina and Lachnum albidum var. americanum (Dennis) W.Y. Zhuang also occur on bamboo sheaths. However, compared with the present fungus, the former has smaller ascospores and filiform paraphyses (Dennis 1954), and the latter has extremely large asci and ascospores (Dennis 1960). In cool-temperate to subarctic zones, L. asiaticum and Lachnum sasae Raitv. occur on bamboo sheaths (Otani 1967; Raitviir 1985), but their ascospores are much shorter than those of the present fungus.

Figure 16. 

Erioscyphella sasibrevispora TNS-F-81401 (Holotype A–D, F, G). Lachnum novoguineense var. yunnanicum TNS-F-16642 (E) A apothecium B vertical section of an apothecium C ascospores D asci (with basal structures sometimes with perforation) E ascal base arising from a crozier with perforation F paraphyses G ectal excipular cells H hairs.

The wooly appearance and yellow disc of this species (Fig. 15A) resemble those of Capitotricha rubi (Bres.) Baral; however, microscopic observations easily distinguish the two species.

Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya, comb. et, stat. nov.

MycoBank No: MycoBank No: 835709

Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang, Nova Hedwigia 74(3-4): 422 (2002).

Diagnosis

Occurring on fallen leaves of of Quercus spp. or Castanopsis spp. in early summer and having needle-like ascospores.

Japanese name

Shii-Kashi-hina-no-chawantake-modoki.

Specimen examined

Japan, Ibaraki, Tsukuba, Mt. Tsukuba, 36.228539, 140.103504, ca 870 m, 23 Jun. 2007, on fallen leaves of Castanopsis sieboldii, R.Sasagawa (TNS-F-16841). Japan, Ibaraki, Tsukuba, Amakubo, Tsukuba Botanical Garden, 36.101472, 140.110944, ca 20 m, 15 Jun. 2007, on fallen leaves of C. sieboldii, R.Sasagawa (TNS-F-16838). JAPAN, Tottori, Yonago, Yonago Castle, 35.42437, 133.325472, ca 50 m, 3 Jun. 2018, on fallen leaves of C. sieboldii, Y.Tochihara (TNS-F-81383).

Distribution

China (Hainan, Yunnan; Yu and Zhuang 2003). Japan (warm-temperate zone).

Notes

The present fungus was treated as Lachnum sp. 13 by Hosoya et al. (2010). This fungus occurs in the same habitats as E. hainanensis, but it is easily distinguished in having longer and needle-like ascospores. Erioscyphella sinensis resembles L. mapirianum in the shape of ascospores, but the two species are different in that L. mapirianum has long slender apothecial stipes, larger asci, longer ascospores, and wider paraphyses.

In the present study, we transferred this fungus to Erioscyphella and upgraded it from variety to species level, because this fungus is not phylogenetically related to ‘L’. mapirianum (Fig. 1). The presence of apical amorphous materials of hairs was confirmed in this study (Suppl. material 1: Fig. S2).

Acknowledgements

We thank Dr Shimpei Hiruta at the National Museum of Nature and Science for his kind support in the species delimitation analyses. We also thank Dr Toshimitsu Fukiharu at the Natural History Museum and Institute, Chiba, Ms Michiru Fujisaki and Rei Sasagawa at the Faculty of Life and Environmental Sciences, University of Tsukuba, and Mr Minoru Nakajima at Kanagawa Kinoko no Kai for collecting and donating their significant fungal specimens to TNS.

References

  • Abarenkov K, Tedersoo L, Nilsson RH, Vellak K, Saar I, Veldre V, Parmasto E, Prous M, Aan A, Ots M, Kurina O, Ostonen I, Jõgeva J, Halapuu S, Põldmaa K, Toots M, Truu J, Larsson K-H, Kõljalg U (2010) PlutoF – a web based workbench for ecological and taxonomic research, with an online implementation for fungal ITS sequences. Evolutionary Bioinformatics 6: 189–196. https://doi.org/10.4137/EBO.S6271
  • Baral HO (1984) Taxonomische und ökologische Studien über die Koniferen bewohnenden europäischen Arten der Gattung Lachnellula Karsten. Beiträge zur Kenntnis der Pilze Mitteleuropas 1: 143–156. [in German]
  • Baral HO (2015) Hymenoscyphus menthae, H. macroguttatus and H. scutula, a comparative taxonomic study emphasizing the value of spore guttulation and croziers. Ascomycete. org 7(6): 255–287. https://doi.org/10.25664/art-0147
  • Baral HO, Krieglsteiner GJ (1985) Bausteine zu einer Askomyzeten-Flora der Bundersrepublik Deutschland. In: Süddeutchland gefundene inoperculte Diskomyceten mit taxonomischen, ökologischen, chorologischen Hinweisen und einer Farbtafel. Beiheften zur Zeitschrift für Mykologie 6: 1–160. [in German]
  • Begerow D, Nilsson H, Unterseher M, Maier W (2010) Current state and perspectives of fungal DNA barcoding and rapid identification procedures. Applied Microbiology and Biotechnology 87: 99–108. https://doi.org/10.1007/s00253-010-2585-4
  • Biczok R, Bozsoky P, Eisenmann P, Ernst J, Ribizel T, Scholz F, Trefzer A, Weber F, Hamann M, Stamatakis A (2018) Two C++ libraries for counting trees on a phylogenetic terrace. Bioinformatics 34(19): 3399–3401. https://doi.org/10.1093/bioinformatics/bty384
  • Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, Alexander H, Alm EJ, Arumugam M, Asnicar F, Bai Y, Bisanz JE, Bittinger K, Brejnrod A, Brislawn CJ, Brown CT, Callahan BJ, Caraballo-Rodríguez AM, Chase J, Cope EK, Da Silva R, Diener C, Dorrestein PC, Douglas GM, Durall DM, Duvallet C, Edwardson CF, Ernst M, Estaki M, Fouquier J, Gauglitz JM, Gibbons SM, Gibson DL, Gonzalez A, Gorlick K, Guo J, Hillmann B, Holmes S, Holste H, Huttenhower C, Huttley GA, Janssen S, Jarmusch AK, Jiang L, Kaehler BD, Kang KB, Keefe CR, Keim P, Kelley ST, Knights D, Koester I, Kosciolek T, Kreps J, Langille MGI, Lee J, Ley R, Liu YX, Loftfield E, Lozupone C, Maher M, Marotz C, Martin BD, McDonald D, McIver LJ, Melnik AV, Metcalf JL, Morgan SC, Morton JT, Naimey AT, Navas-Molina JA, Nothias LF, Orchanian SB, Pearson T, Peoples SL, Petras D, Preuss ML, Pruesse E, Rasmussen LB, Rivers A, Robeson MS 2nd, Rosenthal P, Segata N, Shaffer M, Shiffer A, Sinha R, Song SJ, Spear JR, Swafford AD, Thompson LR, Torres PJ, Trinh P, Tripathi A, Turnbaugh PJ, Ul-Hasan S, van der Hooft JJJ, Vargas F, Vázquez-Baeza Y, Vogtmann E, von Hippel M, Walters W, Wan Y, Wang M, Warren J, Weber KC, Williamson CHD, Willis AD, Xu ZZ, Zaneveld JR, Zhang Y, Zhu Q, Knight R, Caporaso JG (2019) Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nature Biotechnology 37: 852–857. https://doi.org/10.1038/s41587-019-0209-9
  • Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment M, Gavryushkina A, Heled J, Jones G, Kühnert D, Maio ND, Matschiner M, Mendes FK, Müller NF, Ogilvie HA, Plessis L, Popinga A, Rambaut A, Rasmussen D, Siveroni I, Suchard MA, Wu C-H, Xie D, Zhang C, Stadler T, Drummond AJ (2019) BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PLOS Computational Biology 15(4): e1006650. https://doi.org/10.1371/journal.pcbi.1006650
  • Cantrell SA, Hanlin RT (1997) Phylogenetic relationships in the family Hyaloscyphaceae inferred from sequences of ITS regions, 5.8S ribosomal DNA and morphological characters. Mycologia 89(5): 745–755. https://doi.org/10.1080/00275514.1997.12026841
  • Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T (2009) trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25(15): 1972–1973. https://doi.org/10.1093/bioinformatics/btp348
  • Darriba D, Posada D, Kozlov AM, Stamatakis A, Morel B, Flouri T (2019) ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Molecular Biology and Evolution 37(1): 291–294. https://doi.org/10.1093/molbev/msz189
  • Dennis RWG (1949) A revision of the British Hyaloscyphaceae with notes on related European species. Mycological Papers 32: 1–97.
  • Fujisawa T, Barraclough TG (2013) Delimiting species using single-locus data and the Generalized Mixed Yule Coalescent approach: a revised method and evaluation on simulated data sets. Systematic Biology 62(5): 707–724. https://doi.org/10.1093/sysbio/syt033
  • Gelardi M, Vizzini A, Ercole E, Horak E, Ming Z, Li TH (2015) Circumscription and taxonomic arrangement of Nigroboletus roseonigrescens Gen. Et Sp. Nov., a new member of Boletaceae from tropical South-Eastern China. PloS ONE 10: e0134295. https://doi.org/10.1371/journal.pone.0134295
  • Guatimosim E, Schwartsburd PB, Barreto RW, Crous PW (2016) Novel fungi from an ancient niche: cercosporoid and related sexual morphs on ferns. Persoonia 37: 106–141. https://doi.org/10.3767/003158516X690934
  • Haines JH (1980) Studies in the Hyaloscyphaceae. I: Some species of Dasyscyphus on tropical ferns. Mycotaxon 11(1): 189–216.
  • Haines JH (1992) Studies in the Hyaloscyphaceae. VI: The genus Lachnum (ascomycetes) of the Guayana Highlands. Nova Hedwigia 54: 97–112.
  • Haines JH, Dumont KP (1984) Studies in the Hyaloscyphaceae III: The long-spored, lignicolous species of Lachnum. Mycotaxon 19: 1–39.
  • Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Han JG, Hosoya T, Sung GH, Shin HD (2014) Phylogenetic reassessment of Hyaloscyphaceae sensu lato (Helotiales, Leotiomycetes) based on multigene analyses. Fungal Biology 118: 150–167. https://doi.org/10.1016/j.funbio.2013.11.004
  • Hansen K, LoBuglio KF, Pfister DH (2005) Evolutionary relationships of the cup-fungus genus Peziza and Pezizaceae inferred from multiple nuclear genes: RPB2, β-tubulin, and LSU rDNA. Molecular Phylogenetics and Evolution 36(1): 1–23. https://doi.org/10.1016/j.ympev.2005.03.010
  • Hosoya T (2021) Systematics, ecology, and application of Helotiales: Recent progress and future perspectives for research with special emphasis on activities within Japan. Mycoscience 62(1): 1–9. https://doi.org/10.47371/mycosci.2020.05.002
  • Hosoya T, Sasagawa R, Hosaka K, Gi-Ho S, Hirayama Y, Yamaguchi K, Toyama K, Kakishima M (2010) Molecular phylogenetic studies of Lachnum and its allies based on the Japanese material. Mycoscience 51(3): 170–180. https://doi.org/10.1007/S10267-009-0023-1
  • Johnston PR, Quijada L, Smith CA, Baral HO, Hosoya T, Baschien C, Pärtel K, Zhuang WY, Haelewaters D, Park D, Carl S, López-Giráldez F, Wang Z, Townsend JP (2019) A multigene phylogeny toward a new phylogenetic classification of Leotiomycetes. IMA Fungus 10: e1. https://doi.org/10.1186/s43008-019-0002-x
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Kirschstein W (1938) Über neue, seltene und kritische Ascomyceten und Fungi imperfecti. I. Annales Mycologici 36(5–6): 367–400.
  • Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AF, Bahram M, Bates ST, Bruns TD, Bengtsson-Palme J, Callaghan TM, Douglas B, Drenkhan T, Eberhardt U, Dueñas M, Grebenc T, Griffith GW, Hartmann M, Kirk PM, Kohout P, Larsson E, Lindahl BD, Lücking R, Martín MP, Matheny PB, Nguyen NH, Niskanen T, Oja J, Peay KG, Peintner U, Peterson M, Põldmaa K, Saag L, Saar I, Schüßler A, Scott JA, Senés C, Smith ME, Suija A, Taylor DL, Telleria MT, Weiss M, Larsson KH (2013) Towards a unified paradigm for sequence-based identification of fungi. Molecular Ecology 22: 5271–5277. https://doi.org/10.1111/mec.12481
  • Kõljalg U, Nilsson HR, Schigel D, Tedersoo L, Larsson K-H, May TW, Taylor AFS, Jeppesen TS, Frøslev TG, Lindahl BD, Põldmaa K, Saar I, Suija A, Savchenko A, Yatsiuk I, Adojaan K, Ivanov F, Piirmann T, Pöhönen R, Zirk A, Abarenkov K (2020) The Taxon Hypothesis Paradigm – On the Unambiguous Detection and Communication of Taxa Microorganisms 8(12): e1910. https://doi: 10.3390/microorganisms8121910
  • Korf RP (1978) Nomenclatural and taxonomic notes on Lasiobelonium, Erioscypha and Erioscyphella. Mycotaxon 7(2): 399–406.
  • Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A (2019) RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 35(21): 4453–4455. https://doi.org/10.1093/bioinformatics/btz305
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Lemoine F, Entfellner JBD, Wilkinson E, Correia D, Felipe MD, Oliveira TD, Gascuel O (2018) Renewing Felsenstein’s phylogenetic bootstrap in the era of big data. Nature 556: 452–456. https://doi.org/10.1038/s41586-018-0043-0
  • Matheny PB (2005) Improving phylogenetic inference of mushrooms with RPB1 and RPB2 nucleotide sequences (Inocybe, Agaricales). Molecular Phylogenetics and Evolution 35: 1–20. https://doi.org/10.1016/j.ympev.2004.11.014
  • Matheny PB, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH, Hughes KW, Hofstetter V, Ammirati JF, Schoch CL, Langer E, Langer G, McLaughlin DJ, Wilson AW, Frøslev T, Ge ZW, Kerrigan RW, Slot JC, Yang ZL, Baroni TJ, Fischer M, Hosaka K, Matsuura K, Seidl MT, Vauras J, Hibbett DS (2007) Contributions of rpb2 and tef1 to the phylogeny of mushrooms and allies (Basidiomycota, Fungi). Molecular Phylogenetics and Evolution 43(2): 430–451. https://doi.org/10.1016/j.ympev.2006.08.024
  • Miyoshi T, Ono Y, Shimizu S (2007) Occurrence of concave stem canker of citrus in Ehime prefecture [Japan] and detection of the pathogenic fungus Lachnum abnorme by PCR. Japanese Journal of Phytopathology 73(1): 9–14. https://doi.org/10.3186/jjphytopath.73.9 [in Japanese]
  • Nilsson RH, Abarenkov K, Veldre V, Nylinder S, De Wit P, Brosché S, Alfredsson JF, Ryberg M, Kristiansson E (2010) An open source chimera checker for the fungal ITS region. Molecular Ecology Resources 10(6): 1076–1081. https://doi.org/10.1111/j.1755-0998.2010.02850.x
  • Nilsson RH, Tedersoo L, Ryberg M, Kristiansson E, Hartmann M, Unterseher M, Porter TM, Bengtsson-Palme J, Walker DM, de Sousa F, Gamper HA, Larsson E, Larsson KH, Kõljalg U, Edgar RC, Abarenkov K (2015) A comprehensive, automatically updated fungal ITS sequence dataset for reference-based chimera control in environmental sequencing efforts. Microbes and Environments 30(2): 145–150. https://doi.org/10.1264/jsme2.ME14121
  • Otani Y (1967) Notes on some cup fungi of the Hyaloscyphaceae collected in Hokkaido, Japan. Transactions of the Mycological Society of Japan 8: 33–42.
  • Pons J, Barraclough TG, Gomez-Zurita J, Cardoso A, Duran DP, Hazell S, Kamoun S, Sumlin WD, Vogler AP (2006) Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Systematic Biology 55(4): 595–609. https://doi.org/10.1080/10635150600852011
  • Raitviir A (1985) Species Hyaloscyphacearum in Sasa spp. inventae. Novosti Sistematiki Nizshikh Rastenii 22: 157–162.
  • Raitviir A (2002) A revision of the genus Dasyscyphella (Hyaloscyphaceae, Helotiales). Polish Botanical Journal 47(2): 227–241.
  • Rambaut A (2018a) Tracer. Molecular evolution, phylogenetics and epidemiology, Edinburgh. http://beast.community/tracer [Accessed on: 2021-03-15]
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. PNAS 109(16): 6241–6246. https://doi.org/10.1073/pnas.1117018109
  • Suková M (2005) A revision of selected material of lignicolous species of Brunnipila, Capitotricha, Dasyscyphella and Neodasyscypha from the Czech Republic. Czech Mycology 57(1–2): 139–172. https://doi.org/10.33585/cmy.57108
  • Spooner BM (1987) Helotiales of Australasia: Geoglossaceae, Orbiliaceae, Sclerotiniaceae, Hyaloscyphaceae. Bibliotheca Micologica 116: 1–711.
  • Swofford DL (2002) PAUP*. Phylogenetic analysis using parsimony (* and other methods). Version 4.0 b10. Sinauer Associates, Sunderland, MA.
  • Tello S, Baral HO (2016) Erioscyphella lunata (Lachnaceae), a rare discomycete collected in Spain. Ascomycete. org 8(4): 157–162. https://doi.org/10.25664/ART-0183
  • Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
  • White T, Bruns TD, Lee A, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Snisky JJ, White TJ (Eds) PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Zhao M, Yuan LY, Guo DL, Ye Y, Da-Wa ZM, Wang XL, Ma FW, Chen L, Gu YC, Ding LS, Zhou Y (2018) Bioactive halogenated dihydroisocoumarins produced by the endophytic fungus Lachnum palmae isolated from Przewalskia tangutica. Phytochemistry 148: 97–103. https://doi.org/10.1016/j.phytochem.2018.01.018
  • Zhao P, Zhuang WY (2011) Evaluation of ITS region as a possible DNA barcode for the genus Lachnum (Helotiales). Mycosystema 30(6): 932–937.
  • Zhao YJ, Hosoya T, Baral HO, Hosaka K, Kakishima M (2012) Hymenoscyphus pseudoalbidus, the correct name for Lambertella albida reported from Japan. Mycotaxon 122: 25–41. https://doi.org/10.5248/122.25
  • Zhuang WY, Wang Z (1998a) Some new species and new records of discomycetes in China. VIII. Mycotaxon 66: 429–438.
  • Zhuang WY, Wang Z (1998b) Discomycetes of tropical China. I. Collections from Hainan Island. Mycotaxon 67: 21–31.
  • Zoller S, Scheidegger C, Sperisen C (1999) PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming ascomycetes. The Lichenologist 31: 511–516. https://doi.org/10.1006/lich.1999.0220

Supplementary materials

Supplementary material 1 

Figure S1. ML trees

Yukito Tochihara, Tsuyoshi Hosoya

Data type: Image.

Explanation note: ML trees based on ITS (A), LSU (B), mtSSU (C) and RPB2 (D) constructed using MEGA X. Bootstrap values > 50% are indicated on branches and branches with MLBS > 70% are shown bold.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (259.40 kb)
Supplementary material 2 

Figure S2. Hair apices

Yukito Tochihara, Tsuyoshi Hosoya

Data type: Image.

Explanation note: Hair apices of members of Clade A Erioscyphella abnormis TNS-F-32163 B E. abnormis TNS-F-61773 C E. brasiliensis TNS-F-46419 D E. sclerotii TNS-F-26492 ELachnummapirianum TNS-F-17245 FLachnumpalmae TNS-F-17567 F1 Hair with resinous matters F2 Hair with apical amorphous material GLachnumpalmae TNS-F-24600 G1 Hair with a resinous matter G2 Hair with apical amorphous materials H E. hainanensis TNS-F-80371 I E. sinensis TNS-F-80354. Mounted in CB/LA. Scale bars: 10 mm. Arrowheads show hair apical materials.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (105.95 kb)
Supplementary material 3 

Figure S3. Result of the ASAP species delimitation analysis

Yukito Tochihara, Tsuyoshi Hosoya

Data type: Image.

Explanation note: The graph shows the distribution of ASAP scores according to partitioning results, and the phylogenetic tree shows the way of partitioning.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (74.96 kb)
Supplementary material 4 

Figure S4. Result of the GMYC species delimitation analysis

Yukito Tochihara, Tsuyoshi Hosoya

Data type: Image.

Explanation note: Number with each node shows the support value that each cluster is an independent species.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (125.89 kb)
Supplementary material 5 

Figure S5. ML best-scored phylogenetic tree based on concatenated dataset of ITS1, 5.8S, and ITS2 constructed by RAxML-NG

Yukito Tochihara, Tsuyoshi Hosoya

Data type: Image.

Explanation note: GenBank/UNITE accession number and TNS specimen number (if any) is shown for each taxon. MLBP > 50% were attached on branches.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (269.80 kb)
Supplementary material 6 

Figure S6. Results of PTP species delimitation analyses

Yukito Tochihara, Tsuyoshi Hosoya

Data type: Image.

Explanation note: Number with each node shows the probability of the likelihood that each cluster is an independent species. Clusters showed by red branches are regarded as species.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (269.80 kb)