Research Article |
Corresponding author: Yukito Tochihara ( tochi@kahaku.go.jp ) Academic editor: Cecile Gueidan
© 2022 Yukito Tochihara, Tsuyoshi Hosoya.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Tochihara Y, Hosoya T (2022) Examination of the generic concept and species boundaries of the genus Erioscyphella (Lachnaceae, Helotiales, Ascomycota) with the proposal of new species and new combinations based on the Japanese materials. MycoKeys 87: 1-52. https://doi.org/10.3897/mycokeys.87.73082
|
The genus Erioscyphella Kirschst., which was morphologically confused with Lachnum, was herein examined. Based on molecular phylogenetic analyses using a combined dataset of ITS, LSU, mtSSU, and RPB2 and morphological examinations, Erioscyphella was distinguished from Lachnum and redefined by longer ascospores and the presence of apical amorphous materials and/or resinous materials equipped on hairs. Species boundaries recognized by morphology/ecology and phylogenetic analyses were cross-checked using species delimitation analyses based on DNA barcode sequences downloaded from UNITE, resulting in that species’ taxonomic problems being uncovered. Six new species (E. boninensis, E. insulae, E. otanii, E. papillaris, E. paralushanensis, and E. sasibrevispora) and two new combinations (E. hainanensis and E. sinensis) were proposed.
ITS, morphology, phylogeny, species delimitation, species hypothesis, taxonomy, UNITE
The genus Erioscyphella Kirschst belongs to the family Lachnaceae Raitv. (Helotiales, Ascomycota) and includes 11 species: E. abnormis (Mont.) Baral, Šandová & B. Perić [lectotype of Erioscyphella (
Erioscyphella has been suggested as a monophyletic group by molecular phylogenetic analyses by
In the present study, the authors aimed to: a) clarify the generic boundaries of Erioscyphella using molecular and morphological/ecological data, and b) propose new species or new combinations based on more objectively defined species boundaries. To reach our first goal, we used specimens from the herbarium of the National Museum of Nature and Science (
In
Micromorphology was examined using cotton blue (CB) dissolved in lactic acid (LA) (CB/LA; 0.5 g CB and 99.5 mL LA) as a mounting fluid. To check the ascal apex iodine reaction, Melzer’s reagent (MLZ; 0.5 g I2, 1.5 g KI, 20 g chloral hydrate, and 20 g water) was initially used without KOH pretreatment, and Lugol’s iodine (IKI; 1 g I2 and 1 g KI, and 100 mL H2O) and MLZ with 3% KOH pretreatment were used when necessary. World Geodetic System 84 was used for the geographic coordinates. URLs herein shown were accessed on April 15, 2021, except for GBIF website accessed on Feb 10, 2020.
DNA was extracted from cultivated isolates in 2% malt extract broth (MEB) using the modified cetyltrimethylammonium bromide (CTAB) method (
Polymerase chain reaction (PCR) was used to amplify the following regions: ITS (= ITS1-5.8S-ITS2), the partial large subunit nuclear ribosomal RNA gene (LSU), the partial mitochondrial small subunit (mtSSU), and section ‘6–7’ of the second largest subunit of the nuclear RNA polymerase II gene (RPB2). Primer pairs for PCR reactions of ITS, LSU and mtSSU were ITS1F (5’–CTTGGTCATTTAGAGGAAGTAA–3’) (
Sequencing was conducted on an ABI PRISM 3500xL Genetic Analyzer (Applied Biosystems; Thermo Fisher Scientific, Waltham, MA, USA) with a BigDye Terminator 3.1 Cycle Sequencing Kit (Applied Biosystems). The obtained sequences were assembled using ATGC 7 (Genetyx, Tokyo, Japan). Assembled sequences were deposited in the International Nucleotide Sequence Database Collaboration (INSDC) via the DNA Data Bank of Japan (DDBJ), and acquired INSDC accession numbers. Assembled ITS sequences were also deposited in the UNITE database (https://unite.ut.ee/) via the PlutoF workbench (https://plutof.ut.ee/) (
The specimens obtained from
Specimen no. ( |
Taxon| | Collection site | Collected Date | Host plants and parts | Strain no. ( |
UNITE/GenBank accession no.# | |||
---|---|---|---|---|---|---|---|---|---|
ITS | LSU | mtSSU | RPB2 | ||||||
†16740 | Albotricha acutipila (P. Karst.) Raitv. | Japan, Nagano, Ueda, Sugadaira Montane Research Center | 2006-06-17 | culm of unidentified bamboo | 104380 | AB481234 | LC438571 | LC431751 | AB481354 |
†16497 | Albotricha albotestacea (Desm.) Raitv. | Japan, Nagano, Ueda, Sugadaira Montane Research Center | 2005-05-18 | culm of Miscanthus sinensis | 101346 | AB481235 | LC424943 | LC431747 | AB481340 |
†16635 | Brunnipila fuscescens (Pers.) Baral | Japan, Gunma, Higashi-Agatsuma | 2006-04-27 | leaf of unidentified tree | 104365 | AB481255 | LC424945 | LC431750 | AB481348 |
†16690 | Brunnipila pseudocannabina (Raitv.) Tochihara, Sasagawa & Hosoya | JAPAN, Akita, Kosaka | 2006-05-26 | stem of unidentified herb | 104374 | AB481272 | LC533520 | LC533522 | LC533521 |
†65670 | Capitotricha bicolor (Bull.) Baral | SWITZERLAND, Filisur | 2016-06-06 | twig of Prunus spinosa | (FC-6101) | LC424834 | LC424942 | LC533244 | LC425011 |
†65752 | Capitotricha rubi (Bres.) Baral | SWITZERLAND, Saicourt | 2016-06-04 | twig of Rubus idaeus | (FC-6075) | LC438560 | LC438573 | LC533243 | LC440395 |
†16439 | Dasyscyphella longistipitata Hosoya | JAPAN, Kanagawa, Yamakita | 2005-04-17 | cupule of Fagus crenata | 101335 | AB481239 | LC424947 | LC533228 | AB481331 |
†16527 | Dasyscyphella montana Raitv. | Japan, Nagano, Ueda, Sugadaira Montane Research Center | 2005-05-21 | wood of unidentified tree | 102336 | AB481242 | LC438577 | LC533241 | AB481336 |
‡16556 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Oita, Kokonoe | 2005-05 | wood of unidentified tree | 114449 | UDB0779051 | LC533153 | LC533257 | LC533198 |
‡16582 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Kanagawa, Yamakita | 2005-07-02 | wood of unidentified tree | 104360 | AB481249 | LC533176 | LC533233 | LC533199 |
‡16606 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Kanagawa, Yamakita | 2005-07-03 | wood of unidentified tree | 114450 | UDB0779053 | LC533154 | LC533258 | LC533200 |
‡16609 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Kanagawa, Yamakita | 2005-07-03 | wood of Cephalotaxus harringtonia | 101350 | ††AB705234 | LC533175 | LC533256 | LC533184 |
‡16639 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Ibaraki, Tsukuba Botanical Garden | 2006-05-01 | twig of unidentified tree | 114451 | UDB0779054 | LC533155 | LC533259 | LC533201 |
‡25579 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Tokyo, Hongo | 2009-05-25 | twig of unidentified tree | (FC-1887) | UDB0779057 | LC533146 | LC533250 | LC533191 |
‡32163 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Kanagawa, Odawara | 2010-05-14 | twig of unidentified tree | 114456 | UDB0779062 | LC533158 | LC533260 | LC533203 |
‡38452 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Gunma, Naganohara | 2013-06-27 | wood of unidentified tree | 114463 | ††UDB0779069 | LC533171 | LC533262 | LC533210 |
‡46416 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Taiwan, Taipei | 2012-04-15 | wood of unidentified tree | (FC-2906) | UDB0779067 | LC533132 | LC533277 | LC549671 |
‡46841 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Gifu, Gujo | 2012-05-28 | wood of unidentified tree | 114462 | UDB0779086 | LC533170 | LC533279 | LC533209 |
‡61773 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Kanagawa, Yokohama | 2015-04-01 | twig of unidentified tree | 114464 | ††UDB0779074 | LC533137 | LC533264 | LC533211 |
‡61931 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Kanagawa, Zushi | 2015-04-16 | wood of unidentified tree | 114466 | UDB0779072 | LC533139 | LC533266 | LC533213 |
‡80478 | Erioscyphella abnormis (Mont.) Baral, Šandová & B. Perić | Japan, Shizuoka, Oyama | 2017-06-26 | twig of unidentified tree | 113934 | LC424837 | LC424949 | LC533283 | LC425009 |
†26520 | Erioscyphella boninensis Tochihara & Hosoya | Japan, Tokyo, Chichijima Island | 2009-06-28 | trunk of unidentified tree | 114447 | UDB0779049 | LC533151 | LC533254 | LC533196 |
‡46419 | Erioscyphella brasiliensis (Mont.) Baral, Šandová & B. Perić | Taiwan, Taipei | 2012-04-20 | wood of unidentified tree | (FC-2910) | UDB0779068 | LC533133 | LC533278 | LC549672 |
‡35049 | Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) | Japan, Niigata, Minamiuonuma | 2010-05-14 | leaf of Quercus glauca | 114457 | UDB0779064 | LC533168 | LC533274 | LC533205 |
‡35056 | Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) | Japan, Niigata, Minamiuonuma | 2010-05-14 | leaf of Quercus serrata | 114458 | UDB0779065 | LC533169 | LC533275 | LC533206 |
‡61775 | Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) | Japan, Kanagawa, Hiratsuka | 2015-04-12 | leaf of Quercus myrsinifolia | 114465 | UDB0779071 | LC533138 | LC533265 | LC533212 |
‡61941 | Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) | Japan, Kanagawa, Kamakura | 2015-04-24 | leaf of Quercus glauca | 112569 | UDB0779073 | LC533140 | LC533280 | LC533214 |
‡65722 | Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) | Japan, Gunma, Midori | 2016-04-24 | leaf of Quercus serrata subsp. Mongolicoides | 114469 | UDB0779076 | LC533142 | LC533281 | LC533215 |
‡80356 | Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) | Japan, Kanagawa, Hiratsuka | 2017-05-18 | leaf of Quercus glauca | 114470 | UDB0779077 | LC533172 | LC533282 | LC533186 |
‡80371 | Erioscyphella hainanensis (W.Y. Zhuang and Zheng Wang) Hosoya and Tochihara (←Lachnum hainanense W.Y. Zhuang and Zheng Wang) | Japan, Kanagawa, Hiratsuka | 2017-05-18 | leaf of Castanopsis sieboldii | 114472 | UDB0779078 | LC533135 | LC533246 | LC533188 |
‡26500 | Erioscyphella insulae Tochihara & Hosoya | Japan, Tokyo, Hahajima Island | 2009-06-24 | wood of unidentified tree | 114445 | UDB0779060 | LC533149 | LC533252 | LC533194 |
‡39720 | Erioscyphella insulae Tochihara & Hosoya | Japan, Okinawa, Iriomote Island | 2011-06-12 | bark of unidentified tree | 114459 | UDB0779063 | LC533177 | LC533261 | LC533207 |
‡61920 | Erioscyphella paralushanensis Tochihara & Hosoya | Japan, Shizuoka, Atami | 2015-06-08 | culm of Pleioblastus argenteostriatus | 114468 | ††UDB0779075 | LC533141 | LC533267 | LC533220 |
†81472 | Erioscyphella otanii Tochihara | Japan, Hokkaido, Horonobe, Teshio Experimental Forest, Hokkaido University | 2018-07-11 | leaf of Sasa senanensis | 114476 | UDB0779085 | LC533179 | LC533286 | ||LC533226 |
‡81272 | Erioscyphella papillaris Tochihara | Japan, Gunma, Minakami | 2017-07-16 | leaf of unidentified bamboo | 113937 | UDB0779081 | LC533161 | LC533285 | LC533204 |
‡80399 | Erioscyphella sasibrevispora Tochihara & Hosoya | Japan, Gunma, Higashi-Agatsuma | 2017-06-06 | sheath of Sasa veitchii | ― | UDB0779082/LC669470 | LC533173 | LC533268 | LC533216 |
‡81401 | Erioscyphella sasibrevispora Tochihara & Hosoya | Japan, Hokkaido, Tomakomai | 2018-06-16 | culm of Sasa nipponica | 114475 | UDB0779084/LC669472 | LC533174 | LC533269 | LC533217 |
‡26492 | Erioscyphella sclerotii (A.L. Sm.) Baral, Šandová & B. Perić | Japan, Tokyo, Hahajima Island | 2009-06-24 | wood of unidentified tree | 114448 | UDB0779050/LC669438 | LC533152 | LC533255 | LC533197 |
‡38480 | Erioscyphella sclerotii (A.L. Sm.) Baral, Šandová & B. Perić | Taiwan, Wulai | 2013-07-12 | twig of unidentified tree | (FC-5208) | ††UDB0779070 | LC533134 | LC533263 | LC549673 |
‡16838 | Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) | Japan, Ibaraki, Tsukuba Botanical Garden | 2007-06-15 | leaf of unidentified broad-leaved tree | 104389 | AB481280 | LC533164 | LC533235 | AB481364 |
‡80354 | Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) | Japan, Kanagawa, Manazuru | 2017-05 | leaf of Castanopsis sieboldi | 114471 | UDB0779083/LC669471 | LC533143 | LC533245 | LC533187 |
‡16841 | Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) | Japan, Ibaraki, Mt. Tsukuba | 2007-06-23 | leaf of unidentified broad-leaved tree | 104390 | AB481281 | LC533157 | LC533236 | LC533218 |
‡32161 | Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) | Japan, Kanagawa, Odawara | 2010-05-14 | leaf of Quercus myrsinifolia | 113715 | UDB0779061/LC669449 | LC533167 | LC533273 | LC533219 |
‡16837 | Erioscyphella sinensis (Z.H. Yu and W.Y. Zhuang) Sasagawa, Tochihara & Hosoya (←Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang) | Japan, Ibaraki, Tsukuba Botanical Garden | 2007-06-15 | leaf of unidentified broad-leaved tree | 114452 | UDB0779055/LC669443 | LC533156 | LC533272 | LC533202 |
†81520 | Incrucipulum ciliare (Schrad.) Baral | Japan, Shizuoka, Shizuoka | 2018-08-18 | leaf of Quercus mongolica subsp. crispula | 113941 | LC438566 | LC438583 | LC533284 | LC438596 |
†17632 | Incrucipulum longispineum Sasagawa & Hosoya | Japan, Miyagi, Sendai | 2006-07-29 | leaf of Lyonia ovalifolia | 102347 | AB481256 | LC438579 | LC533234 | AB481362 |
†81248 | Lachnellula calyciformis (Batsch) Dharne | Japan, Hokkaido, Engaru | 2017-07-12 | twig of Abies sachalinensis | 113935 | LC438561 | LC438574 | LC533247 | LC438590 |
†16529 | Lachnellula suecica (de Bary ex Fuckel) Nannf. | Japan, Nagano, Ueda, Sugadaira Montane Research Center | 2005-05-21 | twig of Larix kaempferi | 101348 | AB481248 | LC424944 | LC533231 | AB481341 |
†16494 | Lachnum asiaticum (Y. Otani) Raitv. | Japan, Nagano, Ueda, Sugadaira Montane Research Center | 2005-05-18 | culm of unidentified bamboo | 101341 | AB481251 | LC533162 | LC533229 | AB481334 |
‡17249 | Lachnum mapirianum (Pat. & Gaillard) M.P. Sharma | Malaysia, Gerik | 2004-09-07 | leaf of unidentified tree | ― | UDB0779088/LC669476 | LC533182 | ― | LC533223 |
‡17245 | Lachnum mapirianum (Pat. & Gaillard) M.P. Sharma | Malaysia, Gerik | 2004-09-07 | leaf of unidentified tree | ― | UDB0779087/LC669475 | LC533181 | ― | LC533222 |
‡16442 | Lachnum novoguineense var. yunnanicum W.Y. Zhuang | Japan, Nagano, Ueda, Sugadaira Montane Research Center | 2005-05-18 | culm of unidentified bamboo | 102339 | AB481270 | LC533163 | LC533232 | AB481342 |
‡16642 | Lachnum novoguineense var. yunnanicum W.Y. Zhuang | Japan, Ibaraki, Mt. Tsukuba | 2006-05-02 | culm of unidentified bamboo | 104368 | AB481271 | LC533165 | LC533227 | §§LC533225 |
‡11197 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | Japan, Shizuoka, Shimoda | 2004-07-26 | leaf of Livistona chinensis var. subglobosa | 106495 | UDB0779047/LC669435 | LC533166 | LC533248 | LC533185 |
‡13500 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | Japan, Kagoshima, Yakushima Island | 2005-10-19 | leaf of Livistona chinensis var. subglobosa | 114441 | ††LC425039/UDB779046 | LC429382 | LC533240 | ‡‡LC431718 |
‡17567 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | New Zealand | 2005-05-28 | leaf of unidentified palm | ― | UDB0779089/LC669477 | LC533183 | LC533288 | ― |
‡24588 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | Japan, Kagoshima, Amami-Oshima | 2009-02-24 | leaf of Livistona chinensis var. subglobosa | 114442 | UDB0779052/LC669440 | LC533144 | LC533270 | LC533190 |
‡24600 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | Japan, Kagoshima, Amami-Oshima | 2009-02-25 | leaf of Livistona chinensis var. subglobosa | 114443 | UDB0779056/LC669444 | LC533145 | LC533249 | ||LC533224 |
‡26161 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | Japan, Tokyo, Chichijima Island | 2009-06-27 | leaf of Livistona boninensis | 114446 | UDB0779048/LC669436 | LC533150 | LC533253 | LC533195 |
‡26172 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | Japan, Tokyo, Kita-Iwojima Island | 2009-06-17 | leaf of Livistona chinensis var. subglobosa | (FC-1935) | UDB0779058/LC669446 | LC533147 | LC533251 | LC533192 |
‡26185 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | Japan, Tokyo, Kita-Iwojima Island | 2009-06-18 | leaf of Livistona chinensis var. subglobosa | 114444 | UDB0779059/LC669447 | LC533148 | LC533271 | LC533193 |
‡39729 | Lachnum palmae sensu lato (←Lachnum palmae (Kanouse) Spooner) | Japan, Okinawa, Iriomote Island | 2011-06-13 | leaf of Livistona chinensis var. subglobosa | 114460 | UDB0779066/LC669454 | LC533178 | LC533276 | LC533208 |
†16501 | Lachnum pudibundum (Quél.) J. Schröt. | Japan, Nagano, Ueda, Sugadaira Montane Research Center | 2005-05-18 | wood of unidentified tree | 102335 | AB481259 | LC533160 | LC533230 | AB481335 |
†81229 | Lachnum rachidicola J.G. Han, Raitv. & H.D. Shin | Japan, Hokkaido, Tomakomai, Tomakomai Experimental Forest | 2017-08-09 | petiole of Juglans sp. | 114473 | UDB0779079/LC669467 | LC533136 | ― | LC533189 |
†16583 | Lachnum virgineum (Batsch) P. Karst. | Japan, Kanagawa, Yamakita | 2005-07-02 | wood of unidentified tree | 104358 | AB481268 | AB926119 | LC431748 | AB481343 |
†65625 | Neodasyscypha cerina (Pers.) Spooner | Switzerland, Saicourt | 2016-06-08 | twig of Crataegus sp. | (FC-6068) | LC424836 | LC424948 | LC533242 | LC425013 |
†17436 | Proliferodiscus alboviridis (Sacc.) Spooner | Japan, Ibaraki, Tsukuba Botanical Garden | 2006-07-08 | wood of unidentified tree | 108594 | LC438558 | LC533159 | LC533239 | LC425014 |
§17909 | Hyaloscypha spiralis (Velen.) J.G. Han, Hosoya & H.D. Shin | Japan, Kumamoto, Kikuchi | 2005-10-10 | wood of unidentified tree | 108585 | ††LC438602 | LC438604 | LC533237 | LC438606 |
§16472 | Hymenoscyphus varicosporoides Tubaki | Japan, Ibaraki, Kasumigaura | 2005-05-05 | wood of unidentified tree | 104355 | AB926052 | LC424952 | LC431746 | AB481329 |
§18014 | Urceolella carestiana (Rabenh.) Dennis | Japan, Iwate, Hanamaki | 2006-05-23 | stem of Parathelypteris nipponica | 108588 | ††LC438603 | LC438605 | LC533238 | LC438607 |
A concatenated dataset of ITS, LSU, mtSSU, and RPB2 was used in the phylogenetic analyses. Each region was aligned separately using MAFFT 7 (
Phylogenetic conflicts among gene partitions were checked before the phylogenetic analyses using the concatenated matrix. Maximum likelihood (ML) trees with 1,000 bootstrap replications (
The concatenated dataset was analyzed using ML, maximum parsimony (MP), and Bayesian inference (BI). For the ML and BI analyses, substitution models were estimated for each partition (ITS, LSU, mtSSU, and each codon position of RPB2) based on Akaike’s information criterion (AIC) (
ML tree search (
MP analysis was conducted using PAUP* 4.0a 167 (
ML best-scored phylogenetic tree based on the concatenated dataset of ITS, LSU, mtSSU, and RPB2 constructed using RAxML-NG. MLBP/MPBP/BPP are represented on branches in this order. In MLBP/MPBP < 50% or BPP < 0.95, a hyphen appears. No evaluation values are shown on branches when MLBP and MPBP < 50% and BPP < 0.95. The branch of a clade
BI analysis was based on MrBayes 3.2.7a (
ITS-based species delimitation analyses (Fig.
To maximize the number of ITS sequences, we used the UNITE Species Hypotheses (SH) system provided by the UNITE database (
Based on the UNITE SH system, we collected ITS sequences of Erioscyphella in the following process: a) selectivity of closely related sequences: for every ITS sequence newly obtained from
The concatenated dataset of extracted ITS1, 5.8S, and ITS2 was incorporated into VSEARCH, and OTU clustering at 97% and 98.5% similarity thresholds were performed using the ‘-cluster_fast’ option. Hierarchical clustering based on pairwise sequence distances was executed using the Assemble Species by Automatic Partitioning (ASAP) method (
For the species delimitation analyses using PTP, an unrooted ML phylogenetic tree was constructed using RAxML-NG 0.9.0. The analysis used ITS1, 5.8S, and ITS2 partitions, aligned as previously described, under the substitution models TIM2+G4 for ITS1, TPM2+I+G4 for 5.8S, and GTR+I+G4 for ITS2, estimated using Modeltest-NG 0.1.6. based on the AIC. The species delimitation analysis was executed using the generated ML best-scored tree with the bPTP web server (https://species.h-its.org/). The MCMC run was set to 500,000 generations and burn-in rate was set to 0.1. The convergence of MCMC runs was visually checked. In ML and Bayesian results, a result generating fewer SHs was adopted to avoid excessive species division.
SHs generated in the species delimitation analyses and the UNITE SHs at 3% and 1.5% threshold values were compared with one another.
In the present study, we initially recognized species boundaries based on the two criteria:
Species boundaries recognized by 1.and 2. were cross-checked based on the results of ITS-based species delimitation analyses. When the species boundaries are supported by the majority (= more than four methods) of the seven species delimitation methods (UNITE SH at 3% threshold, UNITE SH at 1.5% threshold, VSEARCH 97% similarity, VSEARCH 98.5% similarity, ASAP, GMYC, and PTP) (Fig.
Species delimitation analyses using ITS sequences of Erioscyphella and its potential members. Clusters based on UNITE SH at 3% and 1.5% threshold values at UNITE v8.2, VSEARCH at 97% and 98.5% threshold values, ASAP, GMYC, and PTP are displayed. Schematic phylogenetic relationships are shown using the ultrametric tree constructed for the GMYC analysis. The taxon names shown on the tree branches follow the results of the present study.
Forty-nine specimens in
The molecular phylogenetic analyses were based on 70 specimens selected from
Among the four ML trees based on each region, no conflicts were found in clades with support > 70% (Suppl. material
As no topological contradictions occurred among the ML best-scored tree, MP 50% majority-rule consensus tree, and BI 50% majority-rule consensus tree, only ML tree was illustrated, and MLBS, MPBS, and BPP were plotted on its branches (Fig.
Based on the phylogenetic analyses, 49 candidates of Erioscyphella formed a strongly supported clade (= Clade A, MLBP = 100%/MPBP = 100%/BPP = 1.00), apart from the clade of Lachnum sensu stricto (= L. asiaticum (Y. Otani) Raitv., L. pudibundum (Quél.) J. Schröt., L. rachidicola J.G. Han, Raitv. & H.D. Shin, and L. virgineum (Batsch) P. Karst.) [type of Lachnum]) (Fig.
Within Clade A, each morphologically identified species and variety formed strongly supported monophyletic groups of their own (Fig.
Members of Clade A had totally and densely granulate, hyaline to brown, thin-walled hairs, fusiform to long filiform ascospores, ectal excipulum composed of textura prismatica to textura angularis, asci lacking croziers at the bases, and smooth walled ectal excipulum cells. Exceptionally, E. sasibrevispora, L. hainanense (
Moreover, hairs of Clade A lacked crystals, but were equipped with apical amorphous materials and/or resinous materials. In the present study, “crystals” refers to amber colored materials that positioned near the hair apices and were regular-shaped (e.g. tetrahedral materials, masses of needle-like materials, or cross-shaped materials), described by
In Clade A, members except for E. boninensis, E. sasibrevispora and L. novoguineense var. yunnanicum had apical amorphous materials, and E. boninensis, E. paralushanensis, and L. palmae complex also had resinous materials (see figures of described species and Suppl. material
In UNITE v8.3, 87 ITS sequences were clustered into 23 SHs at 3% and 26 SHs at 1.5% threshold values (Table
ITS sequence GenBank/UNITE accession no. |
|
Reference (initial appearance) | Taxon name (ultimately allocated in this study) | UNITE taxon name | INSDC taxon name | Country | Host plants and parts | UNITE SH code (DOI) at 3% threshold | UNITE SH code (DOI) at 1.5% threshold | VSEARCH SH at 97% similarity | VSEARCH SH at 98.5% similarity |
---|---|---|---|---|---|---|---|---|---|---|---|
AB267634 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Ehime | twig of Citrus junos | SH1155612.08FU | SH1522994.08FU | VSH97_1 | VSH985_2 | |
AB267636 (duplicate; AB267635) |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Ehime | twig of Citrus junos | SH1155612.08FU | SH1522994.08FU | VSH97_1 | VSH985_2 | |
AB267641 (duplicate; AB267639, AB267640) |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Tokushima | twig of Citrus junos | SH1155612.08FU | SH1522994.08FU | VSH97_1 | VSH985_2 | |
AB267642 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Tokushima | twig of Citrus junos | SH1155612.08FU | SH1522994.08FU | VSH97_1 | VSH985_2 | |
JF937578 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | CHINA | (unspecified) | SH1155612.08FU | SH1522994.08FU | VSH97_1 | VSH985_2 | |
JN033395 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | KOREA | Wood | SH1155612.08FU | SH1522994.08FU | VSH97_1 | VSH985_2 | |
UDB0779067/LC669455 | 46416 | this study | E. abnormis | - | - | TAIWAN, Taipei | wood of unidentified tree | SH1155612.08FU | SH1522994.08FU | VSH97_1 | VSH985_2 |
UDB0779074/LC669462 | 61773 | this study | E. abnormis | - | - | JAPAN, Kanagawa, Yokohama | twig of unidentified tree | SH1155612.08FU | SH1522994.08FU | VSH97_1 | VSH985_2 |
MK584950 |
|
E. abnormis | E. abnormis | E. abnormis | CHINA, Yunnan | (unspecified) | SH1155612.08FU | †SH1522994.08FU | VSH97_1 | VSH985_2 | |
AB267637 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Nara | Twig | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_1 | |
AB267638 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Shizuoka | Twig | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_1 | |
AB481249 | 16582 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Kanagawa, Yamakita | wood of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_1 | VSH985_1 |
AB705234 | 16609 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Kanagawa, Yamakita | wood of Cephalotaxus harringtonia | SH1155612.08FU | SH1523013.08FU | VSH97_1 | VSH985_1 |
LC424837 | 80478 | this study | E. abnormis | - | - | JAPAN, Shizuoka, Oyama | twig of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_3 |
MG712307 | unpublished | E. abnormis | Lachnum abnorme | Lachnum abnorme | CHINA | (unspecified) | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_3 | |
MK282241 | unpublished | E. abnormis | Lachnum abnorme | Lachnum abnorme | (unspecified) | (unspecified) | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_1 | |
MK584957 |
|
E. abnormis | E. aseptata | E. aseptata | THAILAND, Chiang Rai | (unspecified) | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_1 | |
MN082536 | unpublished | E. abnormis | Lachnum abnorme | Lachnum abnorme | (unspecified) | (unspecified) | SH1155612.08FU | SH1523013.08FU | VSH97_1 | VSH985_1 | |
MT995055 | unpublished | E. abnormis (misregistered?) | Chapsa patens | Chapsa patens | (unspecified) | (unspecified) | SH1155612.08FU | SH1523013.08FU | VSH97_1 | VSH985_1 | |
MW007918 | unpublished | E. abnormis (misregistered?) | Chapsa patens | Chapsa patens | (unspecified) | (unspecified) | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_3 | |
UDB0779051/LC669439 | 16556 | this study | E. abnormis | - | - | JAPAN, Oita, Kokonoe | wood of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_1 |
UDB0779053/LC669441 | 16606 | this study | E. abnormis | - | - | JAPAN, Kanagawa, Yamakita | wood of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_3 |
UDB0779054/LC669442 | 16639 | this study | E. abnormis | - | - | JAPAN, Ibaraki, Tsukuba Botanical Garden | twig of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_3 |
UDB0779057/LC669445 | 25579 | this study | E. abnormis | - | - | JAPAN, Tokyo, Hongo | twig of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_3 |
UDB0779062/LC669450 | 32163 | this study | E. abnormis | - | - | JAPAN, Kanagawa, Odawara | twig of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_3 |
UDB0779069/LC669457 | 38452 | this study | E. abnormis | - | - | JAPAN, Gunma, Naganohara | twig of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_1 | VSH985_1 |
UDB0779072/LC669460 | 61931 | this study | E. abnormis | - | - | JAPAN, Kanagawa, Zushi | twig of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_2 | VSH985_3 |
UDB0779086/LC669474 | 46841 | this study | E. abnormis | - | - | JAPAN, Gifu, Gujo | twig of unidentified tree | SH1155612.08FU | SH1523013.08FU | VSH97_1 | VSH985_1 |
AB481250 | 16617 |
|
E. abnormis | Lachnum abnorme | Lachnum abnorme | JAPAN, Kanagawa, Yamakita | twig of unidentified tree | ‡SH1155612.08FU | ‡SH1523013.08FU | VSH97_1 | VSH985_1 |
UDB0779055/LC669443 | 16837 | this study | E. sinensis (←Lachnum mapirianum var. sinense) | - | - | JAPAN, Ibaraki, Tsukuba Botanical Garden | leaf of unidentified broad-leaved tree | SH1155682.08FU | SH1523107.08FU | VSH97_4 | VSH985_5 |
AB481280 | 16838 |
|
E. sinensis (←Lachnum mapirianum var. sinense) | Lachnum sp. | Lachnum (Lachnum sp. FC-2355) | JAPAN, Ibaraki, Tsukuba Botanical Garden | leaf of unidentified broad-leaved tree | SH1155682.08FU | SH1523107.08FU | VSH97_4 | VSH985_5 |
AB481281 | 16841 |
|
E. sinensis (←Lachnum mapirianum var. sinense) | Lachnum sp. | Lachnum (Lachnum sp. FC-2358) | JAPAN, Ibaraki, Mt. Tsukuba | leaf of unidentified broad-leaved tree | SH1155682.08FU | SH1523107.08FU | VSH97_4 | VSH985_5 |
UDB0779061/LC669449 | 32161 | this study | E. sinensis (←Lachnum mapirianum var. sinense) | - | - | JAPAN, Kanagawa, Odawara | leaf of Quercus myrsinifolia | SH1155682.08FU | SH1523107.08FU | VSH97_4 | VSH985_5 |
UDB0779083/LC669471 | 80354 | this study | E. sinensis (←Lachnum mapirianum var. sinense) | - | - | JAPAN, Kanagawa, Manazuru | leaf of Castanopsis sieboldii | †SH1155682.08FU | †SH1523107.08FU | VSH97_4 | VSH985_5 |
UDB023346 | unpublished | E. curvispora | E. curvispora | - | MONTENEGRO, Žijevo Mountains | needle of Pinus heldreichii | SH1155703.08FU | SH1523136.08FU | VSH97_12 | VSH985_14 | |
MH190414 |
|
E. curvispora | E. curvispora | E. curvispora | MONTENEGRO, Žijevo Mountains | needle of Pinus heldreichii | †SH1155703.08FU | †SH1523136.08FU | VSH97_12 | VSH985_14 | |
JF937580 |
|
E. brasiliensis | Lachnum brasiliense | Lachnum brasiliense | CHINA | (unspecified) | SH1155705.08FU | SH1523142.08FU | VSH97_6 | VSH985_7 | |
MK584953 |
|
E. brasiliensis | E. brasiliensis | E. brasiliensis | (unspecified) | (unspecified) | SH1155705.08FU | SH1523142.08FU | VSH97_6 | VSH985_7 | |
MK584967 |
|
E. brasiliensis | E. brasiliensis | E. brasiliensis | THAILAND, Chiang Rai | (unspecified) | SH1155705.08FU | SH1523142.08FU | VSH97_6 | VSH985_7 | |
UDB0779068/LC669456 | 46419 | this study | E. brasiliensis | - | - | TAIWAN, Taipei | wood of unidentified tree | SH1155705.08FU | SH1523142.08FU | VSH97_6 | VSH985_7 |
JF937579 |
|
E. brasiliensis | Lachnum brasiliense | Lachnum brasiliense | CHINA | (unspecified) | †SH1155705.08FU | †SH1523142.08FU | VSH97_6 | VSH985_7 | |
KX501132 |
|
E. lunata | E. lunata | E. lunata | SPAIN, Andalucía | needle of Pinus nigra subsp. nigra | †SH1155760.08FU | †SH1523257.08FU | VSH97_18 | VSH985_19 | |
JX984680 | unpublished | E. hainanensis (←Lachnum hainanense) | Hyaloscyphaceae | Fungi (uncultured fungus) | KOREA, Seoul | (Total suspended particulate matter (TSP) in urban air during non-Asian dust days) | SH1155844.08FU | SH1523423.08FU | VSH97_3 | VSH985_4 | |
UDB0779064/LC669452 | 35049 | this study | E. hainanensis (←Lachnum hainanense) | - | - | JAPAN, Niigata, Minamiuonuma | leaf of Quercus glauca | SH1155844.08FU | SH1523423.08FU | VSH97_3 | VSH985_4 |
UDB0779065/LC669453 | 35056 | this study | E. hainanensis (←Lachnum hainanense) | - | - | JAPAN, Niigata, Minamiuonuma | leaf of Quercus serrata | SH1155844.08FU | SH1523423.08FU | VSH97_3 | VSH985_4 |
UDB0779073/LC669461 | 61941 | this study | E. hainanensis (←Lachnum hainanense) | - | - | JAPAN, Kanagawa, Kamakura | leaf of Quercus glauca | SH1155844.08FU | SH1523423.08FU | VSH97_3 | VSH985_4 |
UDB0779076/LC669464 | 65722 | this study | E. hainanensis (←Lachnum hainanense) | - | - | JAPAN, Gunma, Midori | leaf of Quercus serrata subsp. mongolicoides | SH1155844.08FU | SH1523423.08FU | VSH97_3 | VSH985_4 |
MK282242 | unpublished | E. hainanensis (←Lachnum hainanense) | Lachnum sp. | Lachnum albidulum | KOREA | (unspecified) | SH1155844.08FU | †SH1523423.08FU | VSH97_3 | VSH985_4 | |
UDB0779077/LC669465 | 80356 | this study | E. hainanensis (←Lachnum hainanense) | - | - | JAPAN, Kanagawa, Hiratsuka | leaf of Quercus glauca | SH1155844.08FU | SH3597461.08FU | VSH97_3 | VSH985_9 |
UDB0779078/LC669466 | 80371 | this study | E. hainanensis (←Lachnum hainanense) | - | - | JAPAN, Kanagawa, Hiratsuka | leaf of Castanopsis sieboldii | SH1155844.08FU | SH3597461.08FU | VSH97_3 | VSH985_9 |
UDB0779071/LC669459 | 61775 | this study | E. hainanensis (←Lachnum hainanense) | - | - | JAPAN, Kanagawa, Hiratsuka | leaf of Quercus myrsinifolia | †SH1155844.08FU | †SH3597461.08FU | VSH97_3 | VSH985_9 |
UDB0779050/LC669438 | 26492 | this study | E. sclerotii | - | - | JAPAN, Tokyo, Hahajima Island | wood of unidentified tree | SH1155848.08FU | SH1523429.08FU | VSH97_5 | VSH985_6 |
JF937584 |
|
E. sclerotii | Lachnum sclerotii | Lachnum sclerotii | CHINA | (unspecified) | SH1155848.08FU | SH1523429.08FU | VSH97_5 | VSH985_6 | |
MK584951 |
|
E. sclerotii | E. sclerotii | E. sclerotii | THAILAND, Chiang Rai | (unspecified) | SH1155848.08FU | SH1523429.08FU | VSH97_5 | VSH985_6 | |
UDB0779070/LC669458 | 38480 | this study | E. sclerotii | - | - | TAIWAN, Wulai | twig of unidentified tree | SH1155848.08FU | SH1523429.08FU | VSH97_5 | VSH985_6 |
MK584969 |
|
E. sclerotii | E. sclerotii | E. sclerotii | THAILAND, Chiang Rai | (unspecified) | †SH1155848.08FU | †SH1523429.08FU | VSH97_5 | VSH985_6 | |
AB481271 | 16642 |
|
Lachnum novoguineense var. yunnanicum | Lachnum sp. | Lachnum sp. (Lachnum sp. FC-2211) | JAPAN, Ibaraki, Mt. Tsukuba | culm of unidentified bamboo | SH1236904.08FU | SH1648536.08FU | VSH97_10 | VSH985_12 |
AB481270 | 16442 |
|
Lachnum novoguineense var. yunnanicum | Lachnum sp. | Lachnum sp. (Lachnum sp. FC-2117) | JAPAN, Nagano, Ueda, Sugadaira Montane Research Center | culm of unidentified bamboo | †SH1236904.08FU | †SH1648536.08FU | VSH97_10 | VSH985_12 |
MK584965 |
|
E. alba | E. alba | E. alba | THAILAND, Chiang Mai | (unspecified) | †SH2596405.08FU | †SH2712425.08FU | VSH97_22 | VSH985_25 | |
AB267647 |
|
Lachnum palmae sensu lato | Lachnum palmae | Lachnum palmae | JAPAN, Oita | leaf of Livistona chinensis | SH1149764.08FU | SH1515235.08FU | VSH97_7 | VSH985_8 | |
LC425039 (duplicate; UDB0779046) | 13500 |
|
Lachnum palmae sensu lato | Lachnum palmae | Lachnum palmae | JAPAN, Kagoshima, Yakushima Island | leaf of Livistona chinensis var. subglobosa | SH1149764.08FU | SH1515235.08FU | VSH97_7 | VSH985_8 |
UDB0779066/LC669454 | 39729 | this study | Lachnum palmae sensu lato | - | - | JAPAN, Okinawa, Iriomote Island | leaf of Livistona chinensis var. subglobosa | SH1149764.08FU | SH1515235.08FU | VSH97_7 | VSH985_8 |
MG283320 |
|
Lachnum palmae sensu lato | Lachnum palmae | Lachnum palmae | CHINA, Linzhou | root of Przewalskia tangutica (endophyte) | †SH1149764.08FU | †SH1515235.08FU | VSH97_7 | VSH985_8 | |
UDB0779089/LC669477 | 17567 | this study | Lachnum palmae sensu lato | - | - | NEW ZEALAND | leaf of unidentified palm | SH2594271.08FU | SH2709065.08FU | VSH97_15 | VSH985_16 |
MH921862 | unpublished | Lachnum palmae sensu lato | Lachnum palmae | Lachnum palmae | NEW ZEALAND | unidentified part of Rhopalostylis sapida | †SH2594271.08FU | †SH2709065.08FU | VSH97_15 | VSH985_16 | |
UDB0779052/LC669440 | 24588 | this study | Lachnum palmae sensu lato | - | - | JAPAN, Kagoshima, Amami-Oshima | leaf of Livistona chinensis var. subglobosa | SH3569651.08FU | SH3597456.08FU | VSH97_9 | VSH985_17 |
UDB0779047/LC669435 | 11197 | this study | Lachnum palmae sensu lato | - | - | JAPAN, Shizuoka, Shimoda | leaf of Livistona chinensis var. subglobosa | †SH3569651.08FU | †SH3597456.08FU | VSH97_9 | VSH985_17 |
UDB0779048/LC669436 | 26161 | this study | Lachnum palmae sensu lato | - | - | JAPAN, Tokyo, Chichijima Island | leaf of Livistona boninensis | SH3569651.08FU | SH3597457.08FU | VSH97_9 | VSH985_11 |
UDB0779058/LC669446 | 26172 | this study | Lachnum palmae sensu lato | - | - | JAPAN, Tokyo, Kita-Iwojima Island | leaf of Livistona chinensis var. subglobosa | SH3569651.08FU | SH3597457.08FU | VSH97_16 | VSH985_11 |
UDB0779059/LC669447 | 26185 | this study | Lachnum palmae sensu lato | - | - | JAPAN, Tokyo, Kita-Iwojima Island | leaf of Livistona chinensis var. subglobosa | SH3569651.08FU | †SH3597457.08FU | VSH97_16 | VSH985_11 |
UDB0779056/LC669444 | 24600 | this study | Lachnum palmae sensu lato | - | - | JAPAN, Kagoshima, Amami-Oshima | leaf of Livistona chinensis var. subglobosa | †SH3569653.08FU | †SH3597459.08FU | VSH97_25 | VSH985_28 |
U58640 |
|
E. euterpes | Lachnum euterpes | Lachnum euterpes | PUERTO RICO | (unspecified) | †SH1236906.08FU | †SH1648538.08FU | VSH97_21 | VSH985_24 | |
KT384413 |
|
E. fusiformis | Lachnum fusiforme | Lachnum fusiforme | THAILAND | dead stems | ‡SH1236907.08FU | ‡SH1648539.08FU | VSH97_11 | VSH985_13 | |
MK584948 |
|
E. fusiformis | Lachnum fusiforme | Lachnum fusiforme | CHINA | dead stems | SH1236907.08FU | SH1648539.08FU | VSH97_11 | VSH985_13 | |
UDB0779049/LC669437 | 26520 | this study | E. boninensis | - | - | JAPAN, Tokyo, Hahajima Island | wood of unidentified tree | †SH3569652.08FU | †SH3597458.08FU | VSH97_20 | VSH985_21 |
UDB0779060/LC669448 | 26500 | this study | E. insulae | - | - | JAPAN, Tokyo, Hahajima Island | wood of unidentified tree | SH3569654.08FU | SH3597460.08FU | VSH97_14 | VSH985_15 |
UDB0779063/LC669451 | 39720 | this study | E. insulae | - | - | JAPAN, Okinawa, Iriomote Island | bark of unidentified tree | †SH3569654.08FU | †SH3597460.08FU | VSH97_14 | VSH985_15 |
UDB0779075/LC669463 | 61920 | this study | E. paralushanensis | - | - | JAPAN, Shizuoka, Atami | culm of Pleioblastus argenteostriatus | †SH3569655.08FU | †SH3597462.08FU | VSH97_19 | VSH985_20 |
AF505515 | E. lushanensis | Lachnum lushanense | Lachnum lushanense | (unspecified) | (unspecified) | †SH1155706.08FU | †SH1523143.08FU | VSH97_8 | VSH985_10 | ||
JF937582 |
|
E. lushanensis | Lachnum lushanense | Lachnum lushanense | CHINA | (unspecified) | SH1155706.08FU | SH1523143.08FU | VSH97_8 | VSH985_10 | |
MG434782 | unpublished | E. lushanensis | Erioscyphella sp. | E. lushanensis | INDIA, Tangmarg | root tips of Pinus wallichiana (ectomycorrhiza) | (unassigned) | (unassigned) | VSH97_8 | VSH985_10 | |
UDB0779081/LC669469 | 81272 | this study | E. papillaris | - | - | JAPAN, Gunma, Minakami | leaf of unidentified bamboo | †SH3569656.08FU | †SH3597463.08FU | VSH97_23 | VSH985_26 |
UDB0779084/LC669472 | 81401 | this study | E. sasibrevispora | - | - | JAPAN, Hokkaido, Tomakomai | culm of Sasa nipponica | SH3569657.08FU | SH3597464.08FU | VSH97_13 | VSH985_23 |
UDB0779082/LC669470 | 80399 | this study | E. sasibrevispora | - | - | JAPAN, Gunma, Higashi-Agatsuma | sheath of Sasa veitchii | †SH3569657.08FU | †SH3597464.08FU | VSH97_13 | VSH985_22 |
UDB0779085/LC669473 | 81472 | this study | E. otanii | - | - | JAPAN, Hokkaido, Horonobe, Teshio Experimental Forest, Hokkaido University | leaf of Sasa senanensis | †SH3569658.08FU | †SH3597465.08FU | VSH97_24 | VSH985_27 |
UDB0779087/LC669475 | 17245 | this study | Lachnum mapirianum | - | - | MALAYSIA, Gerik | leaf of unidentified tree | †SH3569659.08FU | †SH3597466.08FU | VSH97_17 | VSH985_18 |
UDB0779088/LC669476 | 17249 | this study | Lachnum mapirianum | - | - | MALAYSIA, Gerik | leaf of unidentified tree | SH3569659.08FU | SH3597466.08FU | VSH97_17 | VSH985_18 |
The extracted and aligned ITS sequences were composed of three partitions, ITS1 (162 bp), 5.8S (157 bp), and ITS2 (142 bp). The concatenated ITS sequence matrix was registered in TreeBase (http://purl.org/phylo/treebase/phylows/study/TB2:S28473). In the ASAP analysis, the concatenated dataset of these partitions (461 bp) was input, and 87 ITS sequences were clustered into 18 SHs with the lowest asap-score, reflecting better partitioning (Suppl. material
Comparing the number of SHs generated by different clustering methods and applied thresholds, 18 SHs by ASAP, and 23 SHs by UNITE SH at 3% threshold represented the lowest SH numbers (Fig.
Comparing the results of seven species delimitation methods (UNITE SH at 3% threshold, UNITE SH at 1.5% threshold, VSEARCH 97% similarity, VSEARCH 98.5% similarity, ASAP, GMYC, and PTP), sequences labeled as E. alba, E. brasiliensis, E. curvispora, E. euterpes, E. fusiformis, E. lunata, E. sclerotii, L. mapirianum, L. mapirianum var. sinense, L. novoguineense var. yunnanica, and six new species candidates were distinguished as separate clusters by more than four delimitation methods (Fig.
Erioscyphella abnormis, E. aseptate, and L. palmae did not form separate clusters supported by majority of four species delimitation analyses (Fig.
We accepted Clade A as a monophyletic unit for Erioscyphella which is supported by morphology. Although Clade B comprised Clade A together with P. alboviridis, Clade B should not be regarded as a genus delimitation of Erioscyphella, because Proliferodiscus differs from members of Clade A in having apothecia proliferating from the margins continuously and thick-walled and coarsely warted hairs (
In summary, Erioscyphella is still difficult to define solely based on morphology because of multiple exceptional characters continuous to other genera, but its typical members could be recognizable mainly by the hair structures and ascospore length. Based on members of Clade A, Erioscyphella is tentatively described as follows: apothecia occurring on dead hardwood leaves, rotten wood, bamboo sheaths, bamboo leaves or palm leaves; asci mostly arising from simple septa, but occasionally from croziers; ascospores fusiform to long needle-shaped, aseptate to multi-septate; paraphyses filiform to narrowly lanceolate, shortly exceeding the asci, but rarely lanceolate and long exceeding the asci; hairs straight or irregularly curved, usually not swollen at the apices, thin-walled, hyaline, but sometimes brown, totally and densely granulated, usually distantly septate, without needle-like or three-dimensional shaped crystals but mostly equipped with hyaline to brown apical amorphous materials, and/or resinous materials at any part of hairs; walls of ectal excipulum cells smooth but granulate in one species.
In Erioscyphella, the tendency of selectivity of species to host plants or parts occurs across the genus. Each subclade within Erioscyphella (Clade I–V) generally shared tendencies toward host selectivity as follows: Clade I on leaves of broad-leaved trees, except for E. paralushanensis occurring on bamboo sheaths, Clade II on palm leaves, Clade III on bamboo leaves, Clade IV on bamboo sheaths, and Clade V on rotten wood (Fig.
Erioscyphella (long-spored Lachnum) has long been known as the tropical genus in Lachnaceae (
Iodine reactions of the ascus apical apparatus have been classified into several types (inamyloid, hemiamyloid [Type RB and RR, and euamyloid Type BB]) (
In this study, we carried out taxonomic treatment for species which were distinguished by morphology/ecology and phylogenetic analyses, and formed single clusters in species delimitation analyses. Based on this criteria, six undescribed species of Erioscyphella have been proposed as new species of Erioscyphella [E. boninensis, E. insulae, E. otanii, E. papillaris, E. paralushanensis, and E. sasibrevispora], and Lachnum hainanense and L. mapirianum var. sinense have been proposed as new members of Erioscyphella. Interpretation of species boundaries of L. hainanense was discussed in the taxonomy chapter. For new species and new combinations, Japanese names were also denominated for wider use of Japanese mycologists or amateurs.
In the phylogenetic analyses, Malaysian materials of L. mapirianum (
Taxonomic assessments of E. abnormis, L. aseptate, and L. palmae, which were not accepted as independent species in species delimitation analyses, are discussed below.
In the species delimitation analyses, sequences labeled as E. abnormis formed a single SH at UNITE SH 3% threshold (DOI: SH1155612.08FU) and divided into two to four SHs at UNITE SH 1.5% threshold, VSEARCH, and GMYC (Fig.
In ASAP, sequences labeled as E. abnormis belong to a single SH, but the SH also contained sequences labeled as Chapsa patens, E. aseptata, E. brasiliensis, E. curvispora, and E. sclerotii (Fig.
Erioscyphella aseptata was originally described in Thailand and characterized by having aseptate ascospores, unlike E. abnormis or E. sclerotii with septate ascospores (
Although two ITS sequences of C. patens (MT995055 = specimen no. FJ19131 and MW007918 = specimen no. FJ19049) were positioned in SHs dominated by E. abnormis, LSU and mtSSU sequences of FJ19131 and LSU sequence of FJ19049 were closely related to Chapsa spp. [Graphidaceae, Ostropales]. Since Lachnaceae and Graphidaceae are phylogenetically distant, the two ITS sequences MT995055 and MW007918 have been misidentified.
Considering that the monophyly of E. abnormis is strongly supported (Fig.
Lachnum palmae formed a strongly supported clade in the phylogenetic analyses (Clade II in Fig.
Differs from all other Erioscyphella species by the granulate walls of the ectal excipular cells.
Erioscyphella boninensis
Japan, Bonin Islands, Chichijima Island, Mt. Tsutsujiyama, 27.060556, 142.222500, ca 270 m, 28 Jun. 2009, on fallen leaves of Pittosporum boninense, T.Hosoya (
LC669437/UDB0779049 (ITS), LC533151 (LSU), LC533254 (mtSSU), LC533196 (RPB2).
Referring to the type locality Bonin Islands.
Ogasawara-cha-hina-no-chawantake.
Apothecia scattered, superficial, 0.5–1.0 mm in diameter, having well-developed stipes, up to 1.5 mm high, cream to pale brown, externally covered with short and shiny hairs. Disc concave, cream to pale yellow. Ectal excipulum textura prismatica composed of long elongated cells to textura angularis, 6–25 × 5–13 µm, hyaline to relatively brown colored, somewhat thick-walled; cell walls covered by granules with a similar appearance to those on hairs. Stipe composed of textura prismatica with a granulate surface as ectal excipular cells. Medullary excipulum textura intricata of hyaline hyphae up to 3 µm wide. Hairs straight, cylindrical, 38–62 × 2.5–4.0 µm, hyaline, completely covered by brown granules, 2–3-septate, thin-walled, arising from swelling cells completely covered by granules; apex lacking crystals or apical amorphous materials, equipped with amber-colored resinous materials dissolvable with CB/LA at a little below the apex. Asci (36–)37.7–44(–46) × (3.5–)3.6–4.2(–4.5) µm (av. 41 ±3.2 × 3.9 ± 0.3 µm, n = 16), 8-spored, cylindrical-clavate; pore blue in MLZ without 3% KOH pretreatment; croziers absent at the basal septa. Ascospores (9–)10–12.3(–13) × 1.2–1.7(–1.8) µm (av. 11 ± 1.2 × 1.5 ± 0.2 µm, n = 16), Q = (6.3–)6.9–9.2(–10) (av. 7.8 ± 1.5, n = 16), fusiform, aseptate. Paraphyses straight, up to 2.5 µm wide, septate, exceeding the asci up to 5 µm, narrowly lanceolate.
Colony of
Japan. (Bonin Islands). Known only from the type locality.
Granulation on the surface of the ectal excipular cells has been observed only in Incrucipulum in Lachnaceae (
≡ Lachnum hainanense W.Y. Zhuang & Zheng Wang, Mycotaxon 67: 25 (1998).
Forming apothecia with long stipes and long hairs. Differing E. sinensis in much shorter ascospores.
Shii-Kashi-hina-no-chawantake.
Japan, Niigata, Minamiuonuma, 37.056808, 138.80705, ca 720 m, 14 May 2010, on fallen leaves of Quercus glauca, T.Hosoya (
China (Hainan), Japan (Honshu: Kanto region).
Based on the UNITE SH system at a 3% threshold, ITS sequences of this species were integrated into a single SH (DOI: SH1155844.08FU). SH1155844.08FU included sequences labeled as ‘Hyaloscyphaceae’ (JX984680) in UNITE and ‘L. albidulum’ (MK282242) in INSDC (Table
Erioscyphella hainanensis resembles E. sinensis in occurring on dead leaves of Quercus spp. or Castanopsis spp. However, E. hainanensis has much shorter ascospores than E. sinensis. In this study, presence of minute, hyaline apical amorphous materials and absence of any crystals or resinous materials were confirmed in both species (Suppl. material
Characterized by pure white apothecia unlike related species Lachnum nothofagi, and two-layered ectal excipulum.
Japan, Okinawa, Yaeyama, Taketomi, Iriomote Island, Otomi, 24.297458, 123.866128, ca 50 m, 12 Jun. 2011, on fallen bark of unidentified tree, T.Fukiharu (
LC669451/UDB0779063 (ITS), LC533177 (LSU), LC533261 (mtSSU), LC533207 (RPB2).
Japan, Bonin Islands, Hahajima Island, Sekimon, 26.666686, 142.152222, ca 260 m, 24 Jun. 2009, on fallen bark of unidentified tree, T.Hosoya (
Referring to the occurrence of the species on remote islands in Japan.
Shima-hina-no-chawantake.
Apothecia gregarious, superficial, 0.7–1.4(–2.5) mm in diameter, short- and thick-stipitate, up to 0.8 mm high, externally white to cream throughout but sometimes pale brown in the lower parts, covered with white hairs. Disc concave, cream to pale yellow (fresh state not observed). Ectal excipulum composed of two layers: outer layer textura angularis, up to 20 µm thick, 3–28 × 2–8 µm, hyaline, thin to relatively thick-walled, with cell walls smooth; inner layer up to 15 µm thick, textura porrecta composed of hyaline hyphae up to 5 µm wide. Medullary excipulum up to 100 µm thick, composed of hyaline hyphae forming textura intricata; hyphae up to 3 µm wide. Hairs straight or irregularly curved, cylindrical, sometimes branched, up to 125 × 2.5–3.0 µm, hyaline, completely granulate, thin-walled; lacking crystals or resinous materials; apex usually equipped with hyaline apical amorphous materials. Asci (88–)92–101(–106) × 6–7.3(–8) µm (av. 96 ± 4.5 × 6.7 ± 0.6 µm, n = 18), 8-spored, thick-walled, cylindrical-clavate, arising from ascogenous hyphae branching several times; pore blue in MLZ without 3% KOH pretreatment; croziers absent at the basal septa. Ascospores (24–)26.7–34.5(–39) × (1.8–)1.9–2.3(–2.5) µm (av. 31 ± 3.9 × 2.1 ± 0.2 µm, n = 18), Q = (11–)12.5–17(–20) (av. 14.7 ± 2.3, n = 18), showing various shapes and lengths, usually long fusiform and sometimes hypsiloid or sigmoid due to bending of both ends, sometimes swelling or constricted irregularly, aseptate or one- to three-septate (usually one-septate). Paraphyses straight, narrowly lanceolate, up to 2.5 µm wide, septate, exceeding the asci up to 7.5 µm.
Colony of
Japan (Bonin Islands, Yaeyama Islands).
This fungus resembles Lachnum nothofagi (Dennis) Spooner in the size and shape of apothecia, ascospores, asci, and hairs. However, E. insulae has completely hyaline hairs and ectal excipulum, and hairs are equipped with apical materials (Fig.
Erioscyphella insulae
Characterized by pure white minute apothecia (< 0.3 mm in diameter) unlike L. diminutum with rather colored apothecia, and smaller asci compared to similar species Lachnum minutum.
Holotype. Japan, Hokkaido, Horonobe, Toikambetsu, Teshio Experimental Forest, Field Science Center for Northern Biosphere, Hokkaido University, 44.993978, 142.130125, ca 400 m, 11 Jul. 2018, on fallen leaves of Sasa senanensis, Y.Tochihara & K.Kaneko (
LC669471/UDB0779083 (ITS), LC533179 (LSU), LC533286 (mtSSU), LC533226 (RPB2).
Japan, Hokkaido, Sapporo, Mt. Moiwa, 43.024718, 141.318427, ca 530 m, 21 Jun. 1965, on fallen leaves of Sasa kurilensis, Y.Otani (
Referring to the name of Dr Yoshio Otani, the first discoverer of this species.
Kita-sasaba-hina-no-chawantake.
Apothecia scattered, superficial, minute, 0.1–0.3 mm in diameter, at first spherical and later urceolate, having well-developed stipes, up to 0.3 mm high, pure white, externally covered with short white hairs, never colored brown. Disc concave, almost enclosed by an incurving margin when fresh and dry, cream to pale yellow when dry (not observed when fresh). Ectal excipulum textura prismatica like stone pavings arranged in rows, 3–25 × 3–8 µm, hyaline, relatively thick-walled; cell walls smooth. Medullary excipulum textura intricata; hyphae up to 2.5 µm wide. Hairs straight, cylindrical or tapering toward the apices, up to 60 µm long, up to 5 µm wide near the bases and 2.5–3.0 µm wide near the apices, arising from swollen ectal excipular cells, hyaline, up to 3-septate (usually 1- or 2-septate), thin-walled, completely granulated; granules dense near the apices and coarse toward the bases; apex sometimes with a hyaline and inconspicuous apical amorphous materials not dissolved with CB/LA, lacking any crystals or resinous materials. Asci (33–)34–38.8(–41) × 4–5 µm (av. 37 ± 2.2 × 4.4 ± 0.4 µm, n = 15), 8-spored, cylindrical-clavate, relatively thick-walled; pore blue in MLZ without 3% KOH pretreatment; croziers absent at the basal septa. Ascospores (11.5–)12.3–14.6(–15) × (1.2–)1.36–1.7(–1.8) µm (av. 13.4 ± 1.2 × 1.6 ± 0.2 µm, n = 15), Q = (6.7–)7.8–9.6(–10.8) (av. 8.7 ± 0.9, n = 15), fusiform, aseptate. Paraphyses straight, narrowly lanceolate to lanceolate, up to 2.5 µm wide, septate, exceeding the asci up to 10 µm.
Colony of
Japan (Hokkaido; subarctic zone).
Erioscyphella otanii was first collected and documented by
Erioscyphella otanii
The appearance of E. otanii is also similar to that of the graminicolous species Lachnum minutum W.Y. Zhuang and M. Ye documented in China (
Characterized by protruding papillary hairs with hyaline apical amorphous materials.
Japan, Gunma, Minakami, Yubiso, Mt. Tanigawadake, 36.064014, 141.344653, ca 710 m, 16 Jul. 2017, on both sides of a fallen leaf of bamboo, Y.Tochihara (
LC669473/UDB0779085 (ITS), LC533161 (LSU), LC533285 (mtSSU), LC533204 (RPB2).
Referring to papillate hair apices.
Sasaba-hina-no-chawantake.
Apothecia gregarious, superficial, minute, 0.1–0.3 mm in diameter, short-stipitate, up to 0.25 mm high, externally densely covered with pure white short hairs. Disc concave, white to lemon yellow when fresh and dry. Ectal excipulum textura prismatica composed of cuboid cells, 3–13 × 2.5–7 µm, hyaline, thin-walled, lacking carotenoid pigments; cell walls smooth. Medullary excipulum textura intricata of hyaline hyphae up to 3 µm wide. Hairs straight, cylindrical, 45–75 × 3–5 µm, 2–3-septate, hyaline, totally granulate, thin-walled, arising from swollen cells; apical cells rather longer than other cells, 30–40 µm long, with papillate at the apex, sometimes swelling, equipped with hyaline and globose apical amorphous materials not dissolved with CB/LA, lacking any crystals or resinous matters. Asci (59–)59.8–66(–69) × (7.5–)7.6–8.3(–9) µm (av. 63 ± 2.9 × 8.0 ± 0.4 µm, n = 16), 8-spored, cylindrical-clavate; pore inamyloid with MLZ without 3% KOH pretreatment, faint blue with MLZ with 3% KOH pretreatment, dark blue with IKI with and without KOH pretreatment; vesicle apparatus inverted-v-shaped present near the apices; croziers absent at the basal septa; base sympodially branched. Ascospores (16–)17.5–21.7(–24) × (2–)2.3–2.8(–3) µm (av. 20 ± 2.1 × 2.6 ± 0.3 µm, n = 20), Q = (6.4–)6.8–8.9(–9.8) (av. 7.8 ± 1.0, n = 20), fusiform, aseptate, or one-septate (rarely two-septate), filled with hyaline oil drops. Paraphyses straight, cylindrical, up to 3 µm wide, septate, containing small hyaline lipid bodies, equal or scarcely exceeding the asci.
Colony of
Japan (Mt. Tanigawa). Currently known only from the type locality.
This species is similar to Lachnum sclerotii var. microascum in the dimension and shape of asci and ascospores, habitats, and inconspicuous ascus apex reaction in MLZ (
Erioscyphella papillaris
Papillate hairs are also shown in the line drawings of Lachnum gahniae Spooner (
Characterized by throughout red apothecia occurring on bamboo sheaths. Similar to E. lushanensis in macro- and micromorphology and habitats, but has larger asci and ascospores.
Japan, Shizuoka, Atami, Izusan, 35.128834, 139.051194, ca 620 m, 8 Jun. 2015, on fallen sheaths of Pleioblastus argenteostriatus, M.Nakajima (
LC669463/UDB0779075 (ITS), LC533141 (LSU), LC533267 (mtSSU), LC533220 (RPB2).
Referring to the similarity with E. lushanensis.
Akage-hina-no-chawantake.
Apothecia scattered, superficial, 0.7–1.5 mm in diameter, long-stipitate, up to 2.0 mm high, externally covered with dark-red hairs. Disc concave, cream to pale yellow. Ectal excipulum well-developed textura prismatica and partly t. angularis, 6–13 × 2.0–2.5 µm, hyaline, relatively thick-walled, with smooth walls. Medullary excipulum textura intricata of hyaline hyphae up to 2 µm wide. Hairs straight, cylindrical, up to 160 µm long, 2.0–3.0 µm wide, pale brown but hyaline near the bases; hair cells narrowly septate, > 7 µm long, covered by big and amber-colored granules; granules big and dense near the apices and smaller and sparse near the bases, up to 2 µm in diameter near the apices, equipped with amber-colored resinous materials that dissolves in CB/LA at any position of hairs; apices with amber-colored apical amorphous materials, lacking any crystals. Asci (59–)61.4–70.2(–73) × (4.5–)4.7–5.6(–6) µm (av. 65.8 ± 4.4 × 5.2 ± 0.4 µm, n = 15), Q = (11.5–)12–13.6(–14.6) (av. 12.8 ± 0.8, n = 15), 8-spored, cylindrical-clavate; pore faintly blue in MLZ without 3% pretreatment, clear blue in MLZ with 3% KOH pretreatment and IKI without 3% KOH pretreatment. Ascospores (14–)15.8–20.7(–22) × (1.5–)1.7–2.0 µm (av. 18.2 ± 2.5 × 1.8 ± 0.2 µm, n = 15), Q = (7.5–)8.7–11.2(–12.6) (av. 9.9 ± 1.3, n = 15), septate, sometimes bent to U-shaped or S-shaped, containing conspicuous guttules; guttules hyaline but sometimes red. Paraphyses straight, up to 2 µm wide, septate, exceeding the asci 5–10 µm, initially cylindrical to clavate, later becoming narrowly lanceolate.
Colony of
Japan (Shizuoka). Currently known only from the type locality.
Erioscyphella paralushanensis
Erioscyphella paralushanensis is closely related to E. lushanensis in having red hairs (Fig.
Characterized by wooly appearance and yellow to orange discs, and distinguished from similar species Lachnum novoguineense var. yunnanicum in having shorter ascospores.
Japan, Hokkaido, Tomakomai, Utonai, 42.705314, 141.7346, ca 10 m, 16 Jun. 2018, on fallen sheaths of Sasa nipponica, Y.Tochihara & T.Hosoya (
LC669470/UDB0779082 (ITS), LC533174 (LSU), LC533269 (mtSSU), LC533217 (RPB2).
Japan, Gunma, Higashiagatsuma, 36.562253, 138.724139, ca 1330 m, 6 Jun. 2017, on fallen sheaths of Sasa veitchii, Y.Tochihara & T.Hosoya (
“sasi” means bamboo [host plants] and “brevispora” means shorter ascospores compared to L. novoguineense var. yunnanicum.
Sasa-no-youmou-chawantake.
Apothecia gregarious, superficial, 0.6–1.3 mm in diameter, short-stipitate, up to 0.8 mm high, pure white, externally covered with long white hairs. Disc concave, yellow to pale orange when fresh and dry. Ectal excipulum textura prismatica to t. angularis, 3–16 × 2–10 µm, hyaline, thin-walled; surface smooth. Medullary excipulum textura intricata of hyaline hyphae up to 2 µm wide. Hairs straight, delicate, cylindrical with relatively acute apices, up to 190 × 2–3 µm, hyaline, totally granulate, thin-walled; apical cell a little longer than other cells, lacking any crystals, resinous materials, or apical amorphous materials. Asci (79–)82.5–90(–95) × (6–)6.6–8.1(–9) µm (av. 86 ± 4.0 × 7.4 ± 0.8 µm, n = 15), 8-spored, cylindrical-clavate; lateral parts sometimes swelling irregularly; pore blue in MLZ without 3% KOH pretreatment; croziers with perforation present at the basal septa. Ascospores (26–)27.9–36.1(–39) × (1.5–)1.7–2 µm (av. 32 ± 4.1 × 1.8 ± 0.2 µm, n = 17), Q = (13–)15–19.7(–21) (av. 17.5 ± 2.3, n = 17), long fusiform, usually 3-septate, rarely 0- to 2-septate (only observed in
Colony of
Japan (cool-temperate zone, subarctic zone).
Erioscyphella sasibrevispora is closely related to L. novoguineensis var. yunnanicum (
Erioscyphella sasibrevispora
The tropical species E. bambusina and Lachnum albidum var. americanum (Dennis) W.Y. Zhuang also occur on bamboo sheaths. However, compared with the present fungus, the former has smaller ascospores and filiform paraphyses (
Erioscyphella sasibrevispora
The wooly appearance and yellow disc of this species (Fig.
≡ Lachnum mapirianum var. sinense Z.H. Yu and W.Y. Zhuang, Nova Hedwigia 74(3-4): 422 (2002).
Occurring on fallen leaves of of Quercus spp. or Castanopsis spp. in early summer and having needle-like ascospores.
Shii-Kashi-hina-no-chawantake-modoki.
Japan, Ibaraki, Tsukuba, Mt. Tsukuba, 36.228539, 140.103504, ca 870 m, 23 Jun. 2007, on fallen leaves of Castanopsis sieboldii, R.Sasagawa (
China (Hainan, Yunnan; Yu and Zhuang 2003). Japan (warm-temperate zone).
The present fungus was treated as Lachnum sp. 13 by
In the present study, we transferred this fungus to Erioscyphella and upgraded it from variety to species level, because this fungus is not phylogenetically related to ‘L’. mapirianum (Fig.
We thank Dr Shimpei Hiruta at the National Museum of Nature and Science for his kind support in the species delimitation analyses. We also thank Dr Toshimitsu Fukiharu at the Natural History Museum and Institute, Chiba, Ms Michiru Fujisaki and Rei Sasagawa at the Faculty of Life and Environmental Sciences, University of Tsukuba, and Mr Minoru Nakajima at Kanagawa Kinoko no Kai for collecting and donating their significant fungal specimens to
Figure S1. ML trees
Data type: Image.
Explanation note: ML trees based on ITS (A), LSU (B), mtSSU (C) and RPB2 (D) constructed using MEGA X. Bootstrap values > 50% are indicated on branches and branches with MLBS > 70% are shown bold.
Figure S2. Hair apices
Data type: Image.
Explanation note: Hair apices of members of Clade A Erioscyphella abnormis TNS-F-32163 B E. abnormis TNS-F-61773 C E. brasiliensis TNS-F-46419 D E. sclerotii TNS-F-26492 E ‘Lachnum’ mapirianum TNS-F-17245 F ‘Lachnum’ palmae TNS-F-17567 F1 Hair with resinous matters F2 Hair with apical amorphous material G ‘Lachnum’ palmae TNS-F-24600 G1 Hair with a resinous matter G2 Hair with apical amorphous materials H E. hainanensis TNS-F-80371 I E. sinensis TNS-F-80354. Mounted in CB/LA. Scale bars: 10 mm. Arrowheads show hair apical materials.
Figure S3. Result of the ASAP species delimitation analysis
Data type: Image.
Explanation note: The graph shows the distribution of ASAP scores according to partitioning results, and the phylogenetic tree shows the way of partitioning.
Figure S4. Result of the GMYC species delimitation analysis
Data type: Image.
Explanation note: Number with each node shows the support value that each cluster is an independent species.
Figure S5. ML best-scored phylogenetic tree based on concatenated dataset of ITS1, 5.8S, and ITS2 constructed by RAxML-NG
Data type: Image.
Explanation note: GenBank/UNITE accession number and TNS specimen number (if any) is shown for each taxon. MLBP > 50% were attached on branches.
Figure S6. Results of PTP species delimitation analyses
Data type: Image.
Explanation note: Number with each node shows the probability of the likelihood that each cluster is an independent species. Clusters showed by red branches are regarded as species.