Research Article
Print
Research Article
Multiple-marker phylogeny and morphological evidence reveal two new species in Steccherinaceae (Polyporales, Basidiomycota) from Asia
expand article infoTing Cao‡§, Jia-Rui Yu§‡, Trang Thị Thu Nguyễn|, Hai-Sheng Yuan‡
‡ Institute of Applied Ecology, Chinese Academy of Sciences, Shenyang, China
§ University of the Chinese Academy of Sciences, Beijing, China
| Vietnam National University, Ho Chi Minh, Vietnam

Corresponding author: Hai-Sheng Yuan ( hsyuan@iae.ac.cn )

Academic editor: Alfredo Vizzini
© 2021 Ting Cao, Jia-Rui Yu, Trang Thị Thu Nguyễn, Hai-Sheng Yuan.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Cao T, Yu J-R, Nguyễn TTT, Yuan H-S (2021) Multiple-marker phylogeny and morphological evidence reveal two new species in Steccherinaceae (Polyporales, Basidiomycota) from Asia. MycoKeys 78: 169-186. https://doi.org/10.3897/mycokeys.78.57823
Open Access

Abstract

Two new wood-inhabiting fungi, Mycorrhaphium subadustum sp. nov. and Trullella conifericola sp. nov., are proposed and described from Asia based on ITS, nrLSU and tef1 molecular phylogeny and morphological characteristics. Mycorrhaphium subadustum is characterized by a stipitate basidiocarp, velutinate pileal surface concentrically zoned, hydnoid hymenophore, a dimitic hyphal system in spine trama and monomitic in context, absence of gloeocystidia, presence of cystidioles and the non-amyloid, cylindrical to ellipsoid basidiospores. Trullella conifericola is characterized by a laterally stipitate basidiocarp with flabelliform to semicircular pileus, hirtellous pileal surface with appressed coarse hair and concentrically zoned and sulcate, tiny pores (10–12 per mm), a dimitic hyphal system, absence of any type of cystidia, short clavate basidia and thin-walled, smooth, cylindrical to allantoid basidiospores. Phylogenetic analyses based on a three-marker dataset were performed using maximum likelihood and Bayesian inference methods. The two new species formed isolated lineages with full support in Steccherinaceae. The distinguishing characters of the two new species as well as allied species are discussed, and a key to species of Mycorrhaphium is provided.

Keywords

Hydnaceous fungus, molecular phylogeny, polypores, taxonomy, wood-inhabiting fungi

Introduction

Steccherinaceae Parmasto was typified by the genus Steccherinum Gray (1968). It belongs to the residual polyporoid clade of the Polyporales Gäum. (Basidiomycota). It is a distinct and well-defined group based on phylogenetic evidence (Miettinen et al. 2012; Binder et al. 2013). Steccherinaceae includes around 23 genera according to Zmitrovich (2018). The taxa in this family show highly variable morphological and anatomical features. For instance, the basidiocarps range from resupinate (e.g. Junghuhnia Corda.) to pileate (e.g. Austeria Miettinen and Flabellophora G. Cunn.), and the hymenophore can be poroid (e.g. Citripora Miettinen) or hydnoid (e.g. Mycorrhaphium Maas Geest. and Steccherinum Gray). The hyphal system ranges from monomitic (e.g. Caudicicola Miettinen, M. Kulju & Kotir. and Elaphroporia Z.Q. Wu & C.L. Zhao), dimitic (e.g. Antrodiella Ryvarden & I. Johans.) to trimitic (e.g. Metuloidea G. Cunn.). Any type of cystidia can be absent (e.g. Frantisekia Spirin & Zmitr.) or take the form of gloeocystidia (e.g. Antella Miettinen and Butyrea Miettinen) or encrusted cystidia (e.g. Flaviporus Murrill). The basidiospores are typically cylindrical, allantoid (e.g. Nigroporus Murrill and Trullella Zmitr.) or ellipsoid (e.g. Steccherinum Gray). Nevertheless, the members of the family also share several characters including the white-rot nutritional mode, small pores or densely arranged spines, smooth and relatively small basidiospores, and mainly cyanophilic but inamyloid hyphae (Gray 1821; Corda 1842; Murrill 1905; Maas Geesteranus 1962; Cunningham 1965; Ryvarden and Johansen 1980; Spirin et al. 2007; Yuan and Dai 2009; Yuan and Wu 2012; Yuan et al. 2012; Yuan 2014; Miettinen and Ryvarden 2016; Kotiranta et al. 2017; Wu et al. 2018; Zmitrovich 2018).

Morphological and phylogenetic analyses have provided more accurate identification and contributed to the definition of the taxonomic status of the genera in Steccherinaceae. In recent years, phylogenetic analysis based on multi-marker data has been widely used in the taxonomy of these fungi (He and Dai 2012; Miettinen et al. 2012; Binder et al. 2013; Dai et al. 2014; Miettinen and Ryvarden 2016; Justo et al. 2017; Kotiranta et al. 2017; Westphalen et al. 2018; Yuan et al. 2018; Yuan et al. 2020).

The species of the Steccherinaceae are widely distributed all over the world. During the investigation of specimens in Steccherinaceae from Asia, several specimens which represent two undescribed species were found. The morphological and molecular features showed that they belong to the genus Mycorrhaphium and Trullella. In this study, we describe them as two new species based on morphological characteristics and three-marker phylogenetic analyses.

Material and methods

Morphological studies

The studied specimens were deposited at the herbarium of the Institute of Applied Ecology, Chinese Academy of Sciences (IFP). Microscopic procedures followed Yuan and Qin (2018). Microscopic observations were made on tissue sections mounted in cotton blue and Melzer’s reagent to test for any amyloid and/or dextrinoid reactions (cotton blue: 0.1 mg Methyl blue (SIGMA, PCode: 1001545602) dissolved in 60 g pure lactic acid; Melzer’s reagent: 1.5 g KI (potassium iodide), 0.5 g I (crystalline iodine), 22 g chloral hydrate, distilled water 20 mL). The following abbreviations are used in the text: KOH = 2.5% potassium hydroxide; CB = cotton blue; CB+/– = cyanophilous/acyanophilous; IKI = Melzer’s reagent; IKI– = neither amyloid nor dextrinoid; Lm = mean spore length (arithmetic average of all spores); Wm = mean spore width (arithmetic average of all spores); Q = variation in the ratios of Lm/Wm between specimens studied, and n = total number of spores measured from a given number of specimens. Sections were studied at magnifications up to ×1000 using a Nikon Eclipse E600 microscope (Tokyo, Japan) with phase-contrast illumination, and dimensions were estimated subjectively with an accuracy of 0.1 μm. Microscopic drawings were made with the aid of a drawing tube. The spores’ measurements excluded the apiculus, and 5% of the measurements at each end of the range are given in parentheses. The spores’ measurements were made with a Nikon SMZ 645 stereomicroscope. Special colour terms are from Kornerup and Wanscher (1981).

Molecular procedures and phylogenetic analyses

DNA was extracted from dried herbarium specimens with a Thermo Scientific Phire Plant Direct PCR kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to the manufacturer’s instructions and was used for the polymerase chain reaction (PCR). Nuclear ribosomal RNA markers were used to determine the phylogenetic position of the new species. The internal transcribed spacer (ITS) was amplified with the primers ITS4 (5' TCCTCCGCTTATTGATATGC 3') and ITS5 (5' GGAAGTAAAAGTCGTAACAAGG 3'); LR0R (5' ACCCGCTGAACTTAAGC 3') and LR7 (5' TACTACCACCAAGATCT 3') for partial nrLSU; 983F (5' GCYCCYGGHCAYCGTGAYTTYAT 3') and 2218R (5' ATGACACCRACRGCRACRGTYTG 3') for tef1 (White et al.1990; Gardes and Bruns 1993; Rehner and Buckley 2005; Matheny et al. 2007).

PCR reactions were performed in 30 μL reaction mixtures containing 15 μL of 2×Phire Plant PCR buffer, 0.6 μL Phire Hot Start II DNA Polymerase, 1.5 μL of each PCR primer (10 μM), 10.5 μL double deionized H2O (ddH2O), and 0.9 μL template DNA. The PCR thermal cycling program condition was set as follows: initial denaturation at 95 °C for 5 min, followed by 34 cycles at 95 °C for 30 s, the annealing temperatures were as follows: 58.9 °C for ITS4/ITS5, 47.2 °C for LR0R/LR7, 57.6 °C for 983F/2218R, then 72 °C for 20 s, and a final extension at 72 °C for 7 min. PCR amplification was confirmed on 1% agarose electrophoresis gel stained with ethidium bromide (Stöger et al. 2006) and sequenced at the Beijing Genomics Institute (BGI) with the same primers as used in PCR. The newly generated DNA sequences were assembled and manually modified with the software DNAMAN8 (Lynnon Biosoft, Quebec, Canada). The sequences quality control followed the guidelines by Nilsson et al. (2012). All newly obtained sequences were submitted to GenBank (Sayers et al. 2020). Sequences from allied genera were based on the studies of Miettinen et al. (2012), Yuan (2014) and Westphalen et al. (2019) or found in GenBank (http://www.ncbi.nlm.gov) using the BLAST option and downloaded (Table 1). DNA alignments were performed using the MAFFT v.7.471 online service (https://mafft.cbrc.jp/alignment/server/index.html; Katoh et al. 2019). Intron regions of tef1 as well as low-homology regions of ITS1 and ITS2 were removed before phylogenetic analyses, and the sequence datasets were combined using BioEdit v 7.2.6 (Hall 2005).

Table 1.
Download as
CSV
XLSX

Specimens and sequences used in this study. Type specimens are indicated as superscript T and the newly generated sequences in this study are in bold.

Species GenBank No. Specimen/culture voucher Locality References
ITS nrLSU tef1
Antella americana (Ryvarden & Gilb.) Ryvarden JN710509 JN710509 JN710711 KHL 11949 Sweden Miettinen et al. 2012
A. americana EU232186 EU232270 – HHB 4100-Sp USA GenBank Database
A. chinensis (H.S. Yuan) Miettinen JX110844 KC485542 – Dai 9019T China Yuan 2013
chinensis JX110843 KC485541 – Dai 8874T China Yuan 2013
A. niemelaei (Vampola & Vlasák) Miettinen AF126876 – – Renvall 3218 Finland Johannesson et al. 2000
A. niemelaei AF126877 – – Haikonen 14727 Finland Johannesson et al. 2000
A. lactea H.S. Yuan KC485530 KC485548 – Yuan 5720T China Yuan 2014
A. lacteal KC485532 KC485550 – Yuan 5757T China Yuan 2014
A. semisupina (Berk. & M.A. Curtis) Ryvarden JN710521 JN710521 – X242 Canada Miettinen et al. 2012
Antrodiella sp. JN710523 JN710523 – Núñez 1040 Japan Miettinen et al. 2012
A. stipitata H.S. Yuan & Y.C. Dai KC485525 KC485544 – Yuan 5640 China Yuan 2014
Atraporiella neotropica Ryvarden HQ659221 HQ659221 – Miettinen X1021 Belize Miettinen et al. 2012
Austeria citrea (Berk.) Miettinen JN710511 JN710511 – X1171 New Zealand Miettinen et al. 2012
Butyrea luteoalba (P. Karst.) Miettinen JN710558 JN710558 JN710719 isolate 5403 Estonia Miettinen et al. 2012
B. japonica (Núñez & Ryvarden) Miettinen & Ryvarden JN710556 JN710556 JN710718 isolate 10202T Japan Miettinen et al. 2012
B. japonica KC485536 KC485553 – Li 1648 China Yuan 2014
Cabalodontia queletii (Bourdot & Galzin) Piątek AF141626 AF141626 – FCUG 722 Sweden GenBank Database
Citripora bannaensis Miettinen JN710526 JN710526 – OM9999T China Miettinen et al. 2012
Climacocystis borealis (Fr.) Kotl. & Pouzar JN710527 JN710527 – KHL 13318 Estonia Miettinen et al. 2012
Elaphroporia ailaoshanensis Z.Q. Wu & C.L. Zhao MG231568 MG748854 – CLZhao 595T China Wu et al. 2018
ailaoshanensis MG231572 MG748855 – CLZhao 596 China Wu et al. 2018
Etheirodon fimbriatum (Pers.) Banker JN710530 JN710530 – KHL 11905 Sweden Miettinen et al. 2012
Flabellophora sp1 JN710533 JN710533 – Miettinen 14305 Indonesia Miettinen et al. 2012
Flabellophora sp2 JN710534 JN710534 – Miettinen 11443 Indonesia Miettinen et al. 2012
Flabellophora sp3 JN710535 JN710535 – Syamsi NOM677 Indonesia Miettinen et al. 2012
Flabellophora sp4 JN710536 JN710536 – Ryvarden 34508 USA Miettinen et al. 2012
Flabellophora sp. MT269765 MT259330 MT793111 Yuan 12794 China This study
F. sp. MT269766 MT259331 MT793112 Yuan 12796 China This study
Flaviporus brownii (Humb.) Donk KY175008 KY175008 KY175022 MCW 362/12 Ecuador Westphalen et al. 2018
F. brownie JN710538 JN710538 – X462 Australia Miettinen et al. 2012
liebmannii (Fr.) Ginns JN710539 JN710539 – X249 China Miettinen et al. 2012
F. liebmannii KC502914 – – Yuan 1766 China Yuan 2014
Frantisekia mentschulensis (Pilát ex Pilát) Spirin FJ496670 FJ496728 – BRNM 710170 Czech Republic Tomšovský et al. 2010
F. mentschulensis JN710544 JN710544 – isolate 1377 Australia Miettinen et al. 2012
F. ussurii Y.C. Dai & Niemelä KC485526 – – Dai 8249 China Yuan 2014
F. ussurii KC485527 KC485545 – Wei 3081 China Yuan 2014
Junghuhnia crustacea (Jungh.) Ryvarden JN710553 JN710553 – X626 Indonesia Miettinen et al. 2012
J. micropora Spirin, Zmitr. & Malysheva JN710559 JN710559 JN710720 Spirin 2652 Russia Miettinen et al. 2012
Lamelloporus americanus JN710567 JN710567 Læssœ 10119 Ecuador Miettinen et al. 2012
Loweomyces fractipes (Berk. & M.A. Curtis) Jülich KX378866 KX378866 – MT 13/2012 Brazil Westphalen et al. 2016
L. spissus Westph., Tomšovský & Rajchenb. KX378869 KX378869 – MCW 488/14 Brazil Westphalen et al. 2016
L. tomentosus Westph., Tomšovský & Rajchenb. KX378870 KX378870 – MCW 366/12T Brazil Westphalen et al. 2016
L. wynneae (Berk. & Broome) Jülich JN710604 JN710604 – X1215 Denmark Miettinen et al. 2012
Metuloidea cinnamomea (Iturr. & Ryvarden) Miettinen & Ryvarden KU926963 – – X1228T Venezuela Miettinen and Ryvarden 2016
M. fragrans (A. David & Tortic) Miettinen KC858281 – – LE295277 Russia GenBank Database
M. murashkinskyi (Burt) Miettinen & Spirin JN710588 JN710588 – X449 Russia Miettinen et al. 2012
M. rhinocephala (Berk.) Miettinen JN710562 JN710562 – X460 Australia Miettinen et al. 2012
Mycorrhaphium adustum (Schwein.) Maas Geest. JN710573 JN710573 JN710727 KHL12255 USA Miettinen et al. 2012
M. hispidum Westph. & Miettinen MH475306 MH475306 MH475317 MCW 363/12T Brazil Westphalen et al. 2019
M. hispidum MH475307 MH475307 MH475318 MCW 429/13 Brazil Westphalen et al. 2019
M. subadustum KC485537 KC485554 – Dai 10173T China Yuan 2014
M. subadustum MW491378 MW488040 MW495253 Yuan 12976T China This study
Nigroporus vinosus (Berk.) Murrill JX109857 JX109857 JX109914 BHS2008-100 USA Binder et al. 2013
N. vinosus JN710575 JN710575 – X839 Indonesia Miettinen et al. 2012
N. cf. vinosus MT681923 MT675108 MT793113 Yuan 12916 China This study
N. stipitatus Douanla-Meli & Ryvarden JN710574 JN710574 – X546T Cameroon Miettinen et al. 2012
Skeletocutis novae-zelandiae (G. Cunn.)P.K. Buchanan & Ryvarden JN710582 JN710582 – Ryvarden 38641 New Zealand Miettinen et al. 2012
Steccherinum aridum Svrček JN710583 JN710583 – Bureid 110510 Norway Miettinen et al. 2012
S. cf. ciliolatum JN710585 JN710585 – Ryvarden 47033 Estonia Miettinen et al. 2012
S. meridionale (Rajchenb.) Westphalen, Tomšovský & Rajchenberg KY174992 KY174992 KY175019 MR 284 Chile Westphalen et al. 2018
S. neonitidum Westphalen & Tomšovský KY174990 KY174990 KY175017 MCW 371/12T Brazil Westphalen et al. 2018
S. ochraceum (Pers. ex J.F. Gmel.) Gray JN710590 JN710590 JN710730 KHL 11902 Brazil Miettinen et al. 2012
S. robustius (J. Erikss. & S. Lundell) J. Erikss. JN710591 JN710591 – G1195 Sweden Miettinen et al. 2012
S. straminellum (Bres.) Melo JN710597 JN710597 – KH Larsson 13849 France Miettinen et al. 2012
Trullella conifericola MT269764 – – Cui 2851T China This study
T. conifericola MT269760 MT259326 MT793109 Yuan 12655T Vietnam This study
T. conifericola MT269761 MT259327 MT793110 Yuan 12657T Vietnam This study
T. dentipora (Ryvarden & Iturr.) Zmitr. JN710512 JN710512 – X200T Venezuela Miettinen et al. 2012
T. duracina (Pat.) Zmitr. MH475309 MH475309 – MCW 410/13 Brazil Westphalen et al. 2019
T. duracina MH475310 MH475310 – RP 96 Brazil Westphalen et al. 2019
T. meridae (Miettinen & Ryvarden) Zmitr. KY980668 KY980676 – AS 2150 Brazil GenBank Database
T. meridae JN710513 JN710513 – X290T Venezuela Miettinen et al. 2012
T. polyporoides (Ryvarden & Iturr.) Zmitr. JN710602 JN710602 – X510T Venezuela Miettinen et al. 2012
Xanthoporus syringae (Parmasto) Audet JN710607 JN710607 – Jeppson 2264 Sweden Miettinen et al. 2012
X. syringae AY789078 AY684166 DQ059049 AFTOL-ID 774 China Miettinen et al. 2012

Bayesian analysis and Maximum likelihood were applied to the ITS + nrLSU + tef1 dataset. All characters were weighted, and gaps were treated as missing data. Bayesian analysis with MrBayes 3.2.7 (Ronquist et al. 2012) implemented the Markov Chain Monte Carlo (MCMC) technique. The combined dataset was divided into seven partitions: ITS1, 5.8S, ITS2, nrLSU and tef1 1st, 2nd as well as 3rd codon positions. The best-fit models selected were K80+G for ITS1, GTR+I+G for 5.8S, JC+G for ITS2, GTR+I+G for nrLSU, JC for tef1 1st, TrNef+G for tef1 2nd and GTR+I+G tef1 3rd which were determined by the jModelTest 2.1.10 (Darriba et al. 2012) based on the Corrected Akaike Information Criterion (AICc). Four simultaneous Markov chains were run with 10 million generations and starting from random trees and keeping one tree every 100th generation until the average standard deviation of split frequencies was below 0.01. The value of burn-in was set to discard 25% of trees when calculating the posterior probabilities. Bayesian posterior probabilities were obtained from the 50% majority rule consensus of the trees kept. A Maximum Likelihood (ML) analysis uses the seven-partitions’ database which is the same as Bayesian analysis and performed in RAxML v8.2.4 (Stamatakis 2014). The best tree was obtained by performing 1000 rapid bootstrap inferences followed by a thorough search for the most likely tree (Stamatakis et al. 2008). Phylogenetic trees were checked and modified in FigTree 1.4 (Rambaut 2012). The combined dataset and trees were deposited in TreeBASE (No. S27633).

Results

Phylogenetic analyses

Multiple-marker analyses provide an advantage of accurately and promptly discovering a new species or genus (Taylor et al. 2000). Therefore, we used three markers in our dataset which included 75 ITS, 68 nrLSU and 20 tef1. The combined dataset includes two species belonging to the genera Mycorrhaphium and Trullella respectively, and other 69 samples from 23 allied genera. Climacocystis borealis (Fr.) Kotl. & Pouzar was used as the outgroup. The data matrix comprised 163 sequences and had an aligned length of 2121 bases. Bayesian analysis resulted in an average standard deviation of split frequencies = 0.004878. The maximum likelihood and Bayesian analyses produced similar topologies and therefore, only the ML tree is shown in Figure 1.

Figure 1. 

Maximum likelihood tree based on the combined ITS + nrLSU + tef1 sequence dataset illustrating the phylogeny of Mycorrhaphium subadustum and Trullella conifericola and related taxa in Steccherinaceae. The new species are in bold. Branches are labelled with maximum likelihood bootstrap higher than 50% and Bayesian posterior probabilities more than 0.95.

The two new species Mycorrhaphium subadustum and Trullella conifericola were both defined with three markers and they form full-support (100% ML and 1.00 BPP) isolated lineages respectively in this study. The new species M. subadustum clustered together with Mycorrhaphium spp. and form a subclade with American M. adustum. In case of another new species T. conifericola, although the material of T. conifericola Cui 2851 was only provided with ITS sequences, it showed a high similarity of ITS to the other two samples (Yuan 12657 and Yuan 12655) with 99.59% and 98.77% respectively. Furthermore, the morphological and anatomical features, distribution and the coniferous-saprophytic habit suggested it represented an individual which belongs to T. conifericola. Three samples of T. conifericola get together with another six samples from the Trullella clade with support 92% in ML and 1.00 BPP. The phylogenetic tree obtained in this study is similar to that of Miettinen et al. (2012). All the species were divided into 23 main clades which include Antella, Antrodiella, Atraporiella, Austeria, Butyrea, Cabalodontia, Citripora, Elaphroporia, Etheirodon, Flabellophora, Flaviporus, Frantisekia, ‘Glaesia’, Junghuhnia, Lamelloporus, Loweomyces, Metuloidae, Mycorrhaphium, Nigroporus, ‘Scetum’, Steccherinum, Trullella and Xanthoporus. It is notable that the genera Austeria, Flabellophora, Mycorrhaphium, Nigroporus and Trullella formed a large clade in Steccherinaceae with a strong support (85% ML and 1.00 BPP).

Taxonomy

Mycorrhaphium subadustum T. Cao & H.S. Yuan, sp. nov.

MycoBank No: 838509
Figures 2, 3

Diagnosis

Basidiocarps stipitate; pileus semicircular to dimidiate; pileal surface velutinate, concentrically zonate, pileal margin yellowish white; hymenophore hydnoid. Hyphal system dimitic in spine trama and monomitic in context; generative hyphae with clamp connections; cystidia and gloeocystidia absent, cystidiols present. Basidiospores cylindrical to allantoid, CB–, IKI–.

Holotype

China. Liaoning Province, Huanren County, Laotudingzi Nature Reserve, on fallen branch of angiosperm, 4.VIII.2018, Yuan 12976 (holotype IFP 019374).

Etymology

Subadustum (Lat.), referring to the affinity with M. adustum.

Description

Basidiocarps annual, stipitate, solitary or imbricate, corky to soft fibrous, without odor and taste when fresh, light in weight when dry. Pilei semicircular to dimidiate, 2.5–4.5 cm wide and 0.3 cm thick. Pileal surface velutinate, smooth, concentrically zonate, yellowish white to greyish orange (4A2–5B4); margin acute, yellowish white (4A2). Hymenophore hydnoid; spines crowded, evenly distributed, greyish orange (5B4), fibrous, subulate to terete, straight to somewhat flexuous, solitary or confluent, up to 1 mm long, 5–7 per mm; sterile margin smooth, yellowish grey (4B2), up to 2 mm wide. Context yellowish white (3A2), leathery, azonate, homogeneous, up to 0.5 mm thick. Stipe up to 3 cm long, 1 cm wide, straight and base inflated, surface tomentum eventually glabrous, brownish orange (5C4).

Hyphal structure. Hyphal system monomitic in context, dimitic in spine trama; generative hyphae often with clamp connections and simple septate occasionally present; skeletal hyphae thick-walled to subsolid, CB+, IKI–; tissues pale yellow in KOH.

Context. Generative hyphae with clamp connections, colorless, thin- to slightly thick-walled, frequently branched, 3–5 µm diam; skeletal hyphae absent.

Figure 2. 

Basidiocarps of Mycorrhaphium subadustum (IFP 019374, holotype). Scale bar: 10 mm.

Spines. Generative hyphae often with clamp connections, simple-septate occasionally present, colorless, thin- to slightly thick-walled, moderately branched, 2.5–4 µm diam; skeletal hyphae thick-walled to subsolid, unbranched, subparallel along the spine, 3–5 µm diam. Gloeocystidia absent; cystidioles present among the basidia, fusiform, 8–12 × 1.5–3 µm. Basidia clavate, with a basal clamp and four sterigmata, 8–13.5 × 2–3.5 µm; basidioles in shape similar to basidia, but slightly smaller.

Basidiospores cylindrical to ellipsoid, colorless, thin-walled, smooth, CB–, IKI–, (3.5–)3.8–4.0(4.2) × (1.5–)1.8–1.9(–2.0) µm, Lm = 3.89 µm, Wm = 1.83 µm, Q = 2.13–2.17 (n = 60/2).

Type of rot

White rot.

Distribution

In temperate zones.

Additional specimen examined

China. Jilin Province, Antu Country, Changbai Mountain Nature Reserve, Huangsongpu, on fallen branch of angiosperm, 2.VIII.2008, Dai 10173 (IFP 008336).

Figure 3. 

Microscopic structures of Mycorrhaphium subadustum (IFP 019374, holotype) a Basidiospores b Basidia and basidioles c cystidioles d Hyphae from spine trama e Hyphae from context.

Trullella conifericola T. Cao & H.S. Yuan, sp. nov.

MycoBank No: 836287
Figures 4, 5

Diagnosis

Basidiocarps annual, sessile or laterally stipitate; pileus flabelliform to semi-circular; pileal surface hirtellous, with appressed coarse hair, concentrically zonate and sulcate; pores round to angular. Hyphal system dimitic; generative hyphae with clamp connections; skeletal hyphae CB+, IKI–. Basidiospores cylindrical to allantoid, thin-walled.

Holotype

Vietnam. Lam dong Province, Lac Duong District, Lac Duong District, Bidoup Nui Ba National Park, on fallen branch of Pinus kesiya, 15.X.2017, Yuan 12655 (holotype IFP 019372).

Etymology

Conifericola (Lat.), referring to growth on the coniferous substrate.

Description

Basidiocarps annual, sessile or laterally stipitate, solitary to imbricate, without special odor or taste, leathery when fresh, shrinking, hard corky and light in weight upon drying. Pileus flabelliform to semi-circular, applanate, projecting 4–10 cm and 1 cm thick at the base; pileal surface hirtellous, with appressed coarse hair, concentrically zonate and sulcate, alternating white and greyish orange (6A1–6B3) when fresh, yellowish white (2A2/3A2/4A2) and nearly azonate when dry; margin acute, drying involute and wavy. Pore surface light orange (5A4), shiny; pores round to angular, tiny, 10–12 per mm, hardly visible to the naked eye; dissepiments entire; sterile margin ca. 1 mm wide. Context color paler than pores and upper surface, yellowish white (2A2–3A2), soft corky, azonate, 0.5–1.5 mm thick. Tubes non-stratified, concolorous with pore surface, dense, ca. 1.5 mm thick when dry. Stipe round, glabrous and smooth, light yellow to greyish yellow (4A4–4B5), 0.5–2 cm long and 2–4 mm in diam, dense and homogenous.

Figure 4. 

Basidiocarps of Trullella conifericola (IFP 019372, holotype). Scale bar: 10 mm.

Hyphal structure. Hyphal system dimitic: generative hyphae bearing clamp connections, skeletal hyphae CB+, IKI–; tissues unchanged in KOH.

Context. Dominated by generative hyphae, interwoven; generative hyphae hyaline, thin- to slightly thick-walled, clamp connections abundant, frequently branched, 2.5–5.5 μm diam; skeletal hyphae hyaline, thick-walled with a wide lumen, unbranched, 1.5–5 μm diam.

Tubes. Dominated by skeletal hyphae, interwoven; generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, 2–4 µm diam; skeletal hyphae hyaline, thick-walled to semisolid, straight to flexuous, unbranched, 1.5–3.5 µm diam. Cystidia or other sterile hymenial elements absent. Basidia short 8–15 × 4–5.5 µm, clavate, 4-sterigmata of 0.5–1 µm in length, with a clamp connection at base; basidioles similar to basidia in shape, but slightly smaller.

Basidiospores. Cylindrical to allantoid, slightly curved, hyaline, thin-walled, smooth, CB–, IKI–, (4.0–)4.1–5.5(–5.8) × (1.6–)1.8–2.3(–2.5) µm, Lm = 4.94 µm, Wm = 2.09 µm, Q = 2.36–2.45 (n = 60/2).

Ecology

On fallen gymnosperm branch, causing a white rot.

Distribution

In high altitude area of subtropical to tropical zones.

Additional specimens examined

China. Fujian Prov., Wuyishan Forest Park, on fallen trunk of Pinus kesiya, 16.IX.2005, Cui 2851 (IFP 000645). Vietnam. Lam dong Province, Lac Duong District, Bidoup Nui Ba National Park, on fallen branch of Pinus kesiya, 15.X.2017, Yuan 12657 (IFP 019373).

Figure 5. 

Microscopic structures of Trullella conifericola (IFP 019372, holotype) a basidiospores b basidia and basidioles c hyphae from trama d hyphae from context.

Discussion

The phylogenetic profiling showed that the new species Mycorrhaphium subadustum as well as Trullella conifericola are nested in the Steccherinaceae which belongs to the residual polyporoid clade (Miettinen et al. 2012; Binder et al. 2013; Zmitrovich 2018; Westphalen et al. 2019) where they emerge robustly supported isolated lineages. Furthermore, these lineages are supported by morphological characteristics.

Mycorrhaphium was recommended by Maas Geesteranus (1962) and typified by M. adustum. The two samples of the new species M. subadustum (Yuan 12976 and Dai 10173) clustered in Mycorrhaphium clade, were both collected on fallen branches of angiosperm from northeast of China. The similarity of ITS and nrLSU sequences between the two samples of M. subadustum are 99.00% as well as 99.64% respectively, and they form a full-support isolated lineage which is closely related to M. adustum, the type species of the genus. The type material of M. subadustum Yuan 12976 have a 95.56% similarity of ITS sequences with the American M. adustum KHL12255. Morphologically, M. subadustum is similar to M. adustum in having the velutinate and concentrically zonate pileal surface, presence of clamps and simple septa, a dimitic hyphae system in spine trama and monomitic in context, absence of cystidia as well as gloeocystidia and the non-amyloid basidiospores. However, M. adustum often have a dark-colored pileal margin, which is distinctly different from the yellowish white ones of M. subadustum. Anatomically, the new species can be differentiated from M. adustum by the slender generative hyphae in context (3–5 µm vs. 4–6.3 µm), cyanophilous hyphae and presence of cystidiols (Maas Geesteranus 1962; Ryvarden 1989; Westphalen et al. 2019).

Mycorrhaphium embraced nine species (http://www.indexfungorum.org, 2020) and among which there are others two species described from Asia: Mycorrhaphium sessile H.S. Yuan & Y.C and M. stereoides Maas Geest. M. sessile is a species described from China, but the characteristics such as the sessile basidiocarps and presence of gloeocystidia can differentiate it from M. subadustum (Yuan and Dai 2009). Mycorrhaphium stereoides is related to M. subadustum in having stipitate basidiocarps, hydnoid hymenophore, a monomitic hyphal system in context and dimitic in spines, but differs from it by the presence of gloeocystidia and the larger basidiospores (4–6.3 × 2.5–3.8 µm) (Maas Geesteranus 1971). The North Europe Mycorrhaphium pusillum (Brot.) Maas Geest. is closely related to M. subadustum in having the stipitate basidiocarps as well as pale colored and zonate pileal surface, but differs it by the presence of gloeocystidia, absence of clamps and the broader basidiospores (Q = 1.52 in M. pusillum vs. 2.13–2.17 in M. subadustum) (Tervonen et al. 2015). Mycorrhaphium ursinum Decock & Ryvarden is a new species from African; its habit of growing on the soil can be distinguished from M. subadustum. Ryvarden (1989) as well as Mossebo and Ryvarden (2003) have provided keys to a part of species in Mycorrhaphium and after which several new taxa have been described. We provide a new key to the whole described species (except M. ursinum) of the genus in this study.

In the phylogenetic tree, nine samples of Trullella species which include the new species T. conifericola form the clade with strong support (92% ML and 1.00 BPP). Trullella is agenus which was originally proposed as ‘Trulla’ by Miettinen and Ryvarden (2016) and renamed by Zmitrovich (2018). Trullella conifericola is quite an extraordinary species in the genus because of its coniferous-saprophytic habit. The type species of Trullella, T. dentipora (Ryvarden & Iturr.) Zmitr., was described from South America. Trullella dentipora, together with the other species of the genus, inhabits dead angiosperm trees (e.g. Quercus and Cecropia peltata) (Patouillard 1902; Murrill 1907; Miettinen and Ryvarden 2016). Morphologically and anatomically, T. conifericola resembles others Trullella spp. in having sessile or laterally stipitate basidiocarps, mostly small and regular pores, a dimitic hyphal structure, nearly monomitic in the context, and curved cylindrical spores. However, the new species can be distinctly differentiated from others species by having a hirtellous pileal surface with appressed coarse hair, larger spores than those of previous Trullella species (Lm = 4.94 µm and Wm = 2.09 µm in T. conifericola vs Lm = 4.00–4.77 µm and Wm = 1.39–1.91 µm in others Trullella spp.), and inhabiting fallen gymnosperm branches. Trullella composed of six species as of now, and the key to these species was provided by Miettinen and Ryvarden (2016).

Besides, the genera Mycorrhaphium and Trullella together with Austeria, Flabellophora and Nigroporus form a large clade in the phylogenetic tree with strong support (85% ML and 1.00 BPP), and share similar morphological features, including zonate or sulcate pileal surfaces, tiny pores or dense spines and a context that is entirely or almost monomitic. They form a distinct subgroup in the Steccherinaceae.

Key to species of worldwide Mycorrhaphium

1 Hymenophore hydnoid 2
– Hymenophore poroid M. hispidum Westph. & Miettinen
2 Spores less than 3.5 µm long 3
– Spores more than 3.5 µm long 4
3 Stipe present, spines less than 2 mm long M. adustulum (Banker) Ryvarden
– Stipe absent, spines up to 4 mm long M. sessile
4 Spines less than 5 mm long, spores less than 5 µm long 5
– Spines up to 10 mm long, spores up to 6.3 µm long M. stereoides
5 Pileal less than 2 cm wide, gloeocystidia present M. pusillum (Brot.) Maas Geest.
– Pileal more than 2 cm wide, gloeocystidia absent 6
6 Habit on the ground 7
– Habit on the fallen branch of hard wood 8
7 Spines more than 3 mm long M. africanum Mossebo & Ryvarden
– Spines less than 3 mm long M. citrinum Ryvarden
8 Pileal margin black, hyphae acyanophilous M. adustum
– Pileal margin yellowish white, hyphae cyanophilous M. subadustum

Acknowledgements

This research was financed by the National Natural Science Foundation of China (Project Nos. 31770028, 31970017 & 31470148) and the Special Funds for the Young Scholars of Taxonomy of the Chinese Academy of Sciences (Project No. ZSBR-015).

References

  • Binder M, Justo A, Riley R, Salamov A, Lopez-Giraldez F, Sjökvist E, Copeland A, Foster B, Sun H, Larsson E, Larsson KH, Townsend J, Grigoriev IV, Hibbett DS (2013) Phylogenetic and phylogenomic overview of the Polyporales. Mycologia 105: 1350–1373. https://doi.org/10.3852/13-003
  • Corda ACJ (1842) Anleitung zum Studium der Mykologie. Prague, 384 pp.
  • Cunningham GH (1965) Polyporaceae of New Zealand. New Zealand Department of Scientific and Industrial Research Bulletin 164: 1–304.
  • Dai YC, Xue HJ, Vlasák J, Rajchenberg M, Wang B, Zhou LW (2014) Phylogeny and global diversity of Polyporus group Melanopus (Polyporales, Basidiomycota). Fungal Diversity 64: 133–144. https://doi.org/10.1007/s13225-013-0248-3
  • Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: e772. https://doi.org/10.1038/nmeth.2109
  • Gray SF (1821) A natural arrangement of British plants 1: 1–824.
  • Hall T (2005) BioEdit: biological sequence alignment editor for Win95/98/NT/2K/XP. Ibis Therapeutic, Carlsbad.
  • Justo A, Miettinen O, Floudas D, Ortiz-Santana B, Sjökvist E, Lindner D, Nakasone K, Niemelä T, Larsson KH, Ryvarden L, Hibbett DS (2017) A revised family-level classification of the Polyporales (Basidiomycota). Fungal Biology 121: 798–824. https://doi.org/10.1016/j.funbio.2017.05.010
  • Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20: 1160–1166. https://doi.org/10.1093/bib/bbx108
  • Kornerup A, Wanscher J (1981) Methuen Handbook of Colour Fletcher. Norwich, 252 pp.
  • Kotiranta H, Kulju M, Miettinen O (2017) Caudicicola gracilis (Polyporales, Basidiomycota), a new polypore species and genus from Finland. Annales Botanici Fennici 54: 159–167. https://doi.org/10.5735/085.054.0325
  • Maas Geesteranus RA (1962) Hyphal structures in Hydnum. Persoonia 2: 377–405.
  • Maas Geesteranus RA (1971) Hydnaceous fungi of the eastern old world. Verhandelingen Koninklijke Nederlandse Akademie van Wetenschappen Afdeling Natuurkunde 60: 1–176.
  • Matheny PB, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH, Hughes KW, Hofstetter V, Ammirati JF, Schoch CL, Langer E, Langer G, McLaughlin DJ, Wilson AW, Froslev T, Ge ZW, Kerrigan RW, Slot JC, Yang ZL, Baroni TJ, Fischer M, Hosaka K, Matsuura K, Seidl MT, Vauras J, Hibbett DS (2007) Contributions of rpb2 and tef1 to the phylogeny of mushrooms and allies (Basidiomycota, Fungi). Molecular Phylogenetics and Evolution 43: 430–451. https://doi.org/10.1016/j.ympev.2006.08.024
  • Miettinen O, Larsson E, Sjökvist E, Larsson KH (2012) Comprehensive taxon sampling reveals unaccounted diversity and morpho logical plasticity in a group of dimitic polypores (Polyporales, Basidiomycota). Cladistics 28: 251–270. https://doi.org/10.1111/j.1096-0031.2011.00380.x
  • Miettinen O, Ryvarden L (2016) Polypore genera Antella, Austeria, Butyrea, Citripora, Metuloidea and Trulla (Steccherinaceae, Polyporales). Annales Botanici Fennici 53: 157–172. https://doi.org/10.5735/085.053.0403
  • Mossebo DC, Ryvarden L (2003) The genus Mycorrhaphium in Africa. Mycotaxon 88: 229–232.
  • Murrill WA (1905) The Polyporaceae of North America: XI. A synopsis of the brown pileate species. Bulletin of the Torrey Botanical Club 32: 353–371. https://doi.org/10.2307/2478499
  • Murrill WA (1907) Polyporaceae, Part 1. North American Flora 9: 1–72.
  • Nilsson RH, Tedersoo L, Abarenkov K, Ryberg M, Kristiansson E, Hartmann M, Schoch CL, Nylander JAA, Bergsten J, Porter TM, Jumpponen A, Vaishampayan P, Ovaskainen O, Hallenberg N, Bengtsson-Palme J, Eriksson KM, Larsson KH, Larsson E, Kõljalg U (2012) Five simple guidelines for establishing basic authenticity and reliability of newly generated fungal ITS sequences. MycoKeys 4: 37–63. https://doi.org/10.3897/mycokeys.4.3606
  • Parmasto E (1968) Conspectus systematis coriciacearum. Institutum Zoologicum & Botanicum Academiae Scientarium R.P.S.S Estonicae, Tartu.
  • Patouillard NT (1902) Champignons de la Guadeloupe, recueillis par le R.P. Duss. Bulletin de la Société Mycologique de France 18: 171–186.
  • Rehner SA, Buckley EP (2005) A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97: 84–98. https://doi.org/10.3852/mycologia.97.1.84
  • Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Ryvarden L (1989) Mycorrhaphium citrinum sp. nov. (Basidiomycetes, Aphyllophorales). Memoirs of the New York Botanical Garden 49: 344–347.
  • Ryvarden L, Johansen I (1980) A preliminary polypore flora of East Africa, 636 pp.
  • Spirin W, Zmitrovich I, Malysheva V (2007) Steccherinum tenuispinum (Polyporales, Basidiomycota), a new species from Russia, and notes on three other species. Annales Botanici Fennici 44: 298–302. https://www.jstor.org/stable/23727802
  • Stöger A, Schaffer J, Ruppitsch W (2006) A rapid and sensitive method for direct detection of Erwinia amylovora in symptomatic and asymptomatic plant tissues by polymerase chain reaction. Journal of Phytopathology 154: 469–473. https://doi.org/10.1111/j.1439-0434.2006.01130.x
  • Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. https://doi.org/10.1006/fgbi.2000.1228
  • Tervonen K, Spirin V, Halme P (2015) Redescription of Mycorrhaphium pusillum, a poorly known hydnoid fungus. Mycotaxon 130: 549–554. https://doi.org/10.5248/130.549
  • Tomšovský M, Menkis A, Vasaitis R (2010) Phylogenetic relationships in European Ceriporiopsis species inferred from nuclear and mitochondrial ribosomal DNA sequences. Fungal Biology 114: 350–358. https://doi.org/10.1016/j.funbio.2010.02.004
  • Westphalen MC, Tomšovský M, Rajchenberg M, Gugliotta MA (2016) Morphological and phylogenetic studies of two new neotropical species of Loweomyces (Polyporales, Basidiomycota). Mycological Progress 15: 967–975. https://doi.org/10.1007/s11557-016-1223-7
  • Westphalen MC, Rajchenberg M, Tomšovský M, Gugliotta AM (2018) A re-evaluation of Neotropical Junghuhnia s.l. (Polyporales, Basidiomycota) based on morphological and multigene analyses. Persoonia 41: 130–141. https://doi.org/10.3767/persoonia.2018.41.07
  • White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR Protocols, a Guide to Methods an Applications. Academic Press, SanDiego, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Yuan HS, Dai YC, Wu SH (2012) Two new species of Junghuhnia (Basidiomycota, Polyporales) from Taiwan and a key to all species known worldwide of the genus. Sydowia 64: 137–145.
  • Yuan HS, Qin WM (2018) Multiple genes phylogeny and morphological characters reveal Dextrinoporus aquaticus gen. et sp. nov. (Polyporales, Basidiomycota) from southern China. Mycological Progress 17: 773–780. https://doi.org/10.1007/s11557-018-1392-7
  • Yuan HS, Lu X, Dai YC, Hyde KD, Kan YH, Kušan I, He SH, Liu NG, Sarma VV, Zhao CL, Cui BK, Yousaf N, Sun GY, Liu SY, Wu F, Lin CG, Dayarathne MC, Gibertoni TB, Conceição LB, Garibay-Orijel R, Villegas-Ríos M, Salas-Lizana R, Wei TZ, Qiu JZ, Yu ZF, Phookamsak R, Zeng M, Paloi S, Bao DF, Abeywickrama PD, Wei DP, Yang J, Manawasinghe IS, Harishchandra D, Brahmanage RS, de Silva NI, Tennakoon DS, Karunarathna A, Gafforov Y, Pem D, Zhang SN, de Azevedo Santiago ALCM, Bezerra JDP, Dima B, Acharya K, Alvarez-Manjarrez J, Bahkali AH, Bhatt VK, Brandrud TE, Bulgakov TS, Camporesi E, Cao T, Chen YX, Chen YY, Devadatha B, Elgorban AM, Fan LF, Du X, Gao L, Gonçalves CM, Gusmão LFP, Huanraluek N, Jadan M, Jayawardena RS, Khalid AN, Langer E, Lima DX, de Lima-Júnior NC, de Lira CRS, Liu JK, Liu S, Lumyong S, Luo ZL, Matočec N, Niranjan M, Oliveira-Filho JRC, Papp V, Pérez-Pazos E, Phillips AJL, Qiu PL, Ren YH, Castañeda-Ruiz RF, Semwal KC, Soop K, de Souza CAF, Souza-Motta CM, Sun LH, Xie ML, Yao YJ, Zhao Q, Zhou LW (2020) Fungal diversity notes 1277–1386: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 104: 1–266. https://doi.org/10.1007/s13225-020-00461-7
  • Zmitrovich IV (2018) Conspectus systematis Polyporacearum v. 1.0. Folia Cryptogamica Petropolitana 6: 3–145.
login to comment