Research Article |
Corresponding author: Hai-Sheng Yuan ( hsyuan@iae.ac.cn ) Academic editor: Alfredo Vizzini
© 2021 Ting Cao, Jia-Rui Yu, Trang Thị Thu Nguyễn, Hai-Sheng Yuan.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Cao T, Yu J-R, Nguyễn TTT, Yuan H-S (2021) Multiple-marker phylogeny and morphological evidence reveal two new species in Steccherinaceae (Polyporales, Basidiomycota) from Asia. MycoKeys 78: 169-186. https://doi.org/10.3897/mycokeys.78.57823
|
Two new wood-inhabiting fungi, Mycorrhaphium subadustum sp. nov. and Trullella conifericola sp. nov., are proposed and described from Asia based on ITS, nrLSU and tef1 molecular phylogeny and morphological characteristics. Mycorrhaphium subadustum is characterized by a stipitate basidiocarp, velutinate pileal surface concentrically zoned, hydnoid hymenophore, a dimitic hyphal system in spine trama and monomitic in context, absence of gloeocystidia, presence of cystidioles and the non-amyloid, cylindrical to ellipsoid basidiospores. Trullella conifericola is characterized by a laterally stipitate basidiocarp with flabelliform to semicircular pileus, hirtellous pileal surface with appressed coarse hair and concentrically zoned and sulcate, tiny pores (10–12 per mm), a dimitic hyphal system, absence of any type of cystidia, short clavate basidia and thin-walled, smooth, cylindrical to allantoid basidiospores. Phylogenetic analyses based on a three-marker dataset were performed using maximum likelihood and Bayesian inference methods. The two new species formed isolated lineages with full support in Steccherinaceae. The distinguishing characters of the two new species as well as allied species are discussed, and a key to species of Mycorrhaphium is provided.
Hydnaceous fungus, molecular phylogeny, polypores, taxonomy, wood-inhabiting fungi
Steccherinaceae Parmasto was typified by the genus Steccherinum Gray (1968). It belongs to the residual polyporoid clade of the Polyporales Gäum. (Basidiomycota). It is a distinct and well-defined group based on phylogenetic evidence (
Morphological and phylogenetic analyses have provided more accurate identification and contributed to the definition of the taxonomic status of the genera in Steccherinaceae. In recent years, phylogenetic analysis based on multi-marker data has been widely used in the taxonomy of these fungi (
The species of the Steccherinaceae are widely distributed all over the world. During the investigation of specimens in Steccherinaceae from Asia, several specimens which represent two undescribed species were found. The morphological and molecular features showed that they belong to the genus Mycorrhaphium and Trullella. In this study, we describe them as two new species based on morphological characteristics and three-marker phylogenetic analyses.
The studied specimens were deposited at the herbarium of the Institute of Applied Ecology, Chinese Academy of Sciences (
DNA was extracted from dried herbarium specimens with a Thermo Scientific Phire Plant Direct PCR kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to the manufacturer’s instructions and was used for the polymerase chain reaction (PCR). Nuclear ribosomal RNA markers were used to determine the phylogenetic position of the new species. The internal transcribed spacer (ITS) was amplified with the primers ITS4 (5' TCCTCCGCTTATTGATATGC 3') and ITS5 (5' GGAAGTAAAAGTCGTAACAAGG 3'); LR0R (5' ACCCGCTGAACTTAAGC 3') and LR7 (5' TACTACCACCAAGATCT 3') for partial nrLSU; 983F (5' GCYCCYGGHCAYCGTGAYTTYAT 3') and 2218R (5' ATGACACCRACRGCRACRGTYTG 3') for tef1 (
PCR reactions were performed in 30 μL reaction mixtures containing 15 μL of 2×Phire Plant PCR buffer, 0.6 μL Phire Hot Start II DNA Polymerase, 1.5 μL of each PCR primer (10 μM), 10.5 μL double deionized H2O (ddH2O), and 0.9 μL template DNA. The PCR thermal cycling program condition was set as follows: initial denaturation at 95 °C for 5 min, followed by 34 cycles at 95 °C for 30 s, the annealing temperatures were as follows: 58.9 °C for ITS4/ITS5, 47.2 °C for LR0R/LR7, 57.6 °C for 983F/2218R, then 72 °C for 20 s, and a final extension at 72 °C for 7 min. PCR amplification was confirmed on 1% agarose electrophoresis gel stained with ethidium bromide (
Specimens and sequences used in this study. Type specimens are indicated as superscript T and the newly generated sequences in this study are in bold.
Species | GenBank No. | Specimen/culture voucher | Locality | References | ||
---|---|---|---|---|---|---|
ITS | nrLSU | tef1 | ||||
Antella americana (Ryvarden & Gilb.) Ryvarden | JN710509 | JN710509 | JN710711 | KHL 11949 | Sweden |
|
A. americana | EU232186 | EU232270 | – | HHB 4100-Sp | USA | GenBank Database |
A. chinensis (H.S. Yuan) Miettinen | JX110844 | KC485542 | – | Dai 9019T | China |
|
chinensis | JX110843 | KC485541 | – | Dai 8874T | China |
|
A. niemelaei (Vampola & Vlasák) Miettinen | AF126876 | – | – | Renvall 3218 | Finland |
|
A. niemelaei | AF126877 | – | – | Haikonen 14727 | Finland |
|
A. lactea H.S. Yuan | KC485530 | KC485548 | – | Yuan 5720T | China |
|
A. lacteal | KC485532 | KC485550 | – | Yuan 5757T | China |
|
A. semisupina (Berk. & M.A. Curtis) Ryvarden | JN710521 | JN710521 | – | X242 | Canada |
|
Antrodiella sp. | JN710523 | JN710523 | – | Núñez 1040 | Japan |
|
A. stipitata H.S. Yuan & Y.C. Dai | KC485525 | KC485544 | – | Yuan 5640 | China |
|
Atraporiella neotropica Ryvarden | HQ659221 | HQ659221 | – | Miettinen X1021 | Belize |
|
Austeria citrea (Berk.) Miettinen | JN710511 | JN710511 | – | X1171 | New Zealand |
|
Butyrea luteoalba (P. Karst.) Miettinen | JN710558 | JN710558 | JN710719 | isolate 5403 | Estonia |
|
B. japonica (Núñez & Ryvarden) Miettinen & Ryvarden | JN710556 | JN710556 | JN710718 | isolate 10202T | Japan |
|
B. japonica | KC485536 | KC485553 | – | Li 1648 | China |
|
Cabalodontia queletii (Bourdot & Galzin) Piątek | AF141626 | AF141626 | – | FCUG 722 | Sweden | GenBank Database |
Citripora bannaensis Miettinen | JN710526 | JN710526 | – | OM9999T | China |
|
Climacocystis borealis (Fr.) Kotl. & Pouzar | JN710527 | JN710527 | – | KHL 13318 | Estonia |
|
Elaphroporia ailaoshanensis Z.Q. Wu & C.L. Zhao | MG231568 | MG748854 | – | CLZhao 595T | China |
|
ailaoshanensis | MG231572 | MG748855 | – | CLZhao 596 | China |
|
Etheirodon fimbriatum (Pers.) Banker | JN710530 | JN710530 | – | KHL 11905 | Sweden |
|
Flabellophora sp1 | JN710533 | JN710533 | – | Miettinen 14305 | Indonesia |
|
Flabellophora sp2 | JN710534 | JN710534 | – | Miettinen 11443 | Indonesia |
|
Flabellophora sp3 | JN710535 | JN710535 | – | Syamsi NOM677 | Indonesia |
|
Flabellophora sp4 | JN710536 | JN710536 | – | Ryvarden 34508 | USA |
|
Flabellophora sp. | MT269765 | MT259330 | MT793111 | Yuan 12794 | China | This study |
F. sp. | MT269766 | MT259331 | MT793112 | Yuan 12796 | China | This study |
Flaviporus brownii (Humb.) Donk | KY175008 | KY175008 | KY175022 | MCW 362/12 | Ecuador |
|
F. brownie | JN710538 | JN710538 | – | X462 | Australia |
|
liebmannii (Fr.) Ginns | JN710539 | JN710539 | – | X249 | China |
|
F. liebmannii | KC502914 | – | – | Yuan 1766 | China |
|
Frantisekia mentschulensis (Pilát ex Pilát) Spirin | FJ496670 | FJ496728 | – | BRNM 710170 | Czech Republic |
|
F. mentschulensis | JN710544 | JN710544 | – | isolate 1377 | Australia |
|
F. ussurii Y.C. Dai & Niemelä | KC485526 | – | – | Dai 8249 | China |
|
F. ussurii | KC485527 | KC485545 | – | Wei 3081 | China |
|
Junghuhnia crustacea (Jungh.) Ryvarden | JN710553 | JN710553 | – | X626 | Indonesia |
|
J. micropora Spirin, Zmitr. & Malysheva | JN710559 | JN710559 | JN710720 | Spirin 2652 | Russia |
|
Lamelloporus americanus | JN710567 | JN710567 | Læssœ 10119 | Ecuador |
|
|
Loweomyces fractipes (Berk. & M.A. Curtis) Jülich | KX378866 | KX378866 | – | MT 13/2012 | Brazil |
|
L. spissus Westph., Tomšovský & Rajchenb. | KX378869 | KX378869 | – | MCW 488/14 | Brazil |
|
L. tomentosus Westph., Tomšovský & Rajchenb. | KX378870 | KX378870 | – | MCW 366/12T | Brazil |
|
L. wynneae (Berk. & Broome) Jülich | JN710604 | JN710604 | – | X1215 | Denmark |
|
Metuloidea cinnamomea (Iturr. & Ryvarden) Miettinen & Ryvarden | KU926963 | – | – | X1228T | Venezuela |
|
M. fragrans (A. David & Tortic) Miettinen | KC858281 | – | – | LE295277 | Russia | GenBank Database |
M. murashkinskyi (Burt) Miettinen & Spirin | JN710588 | JN710588 | – | X449 | Russia |
|
M. rhinocephala (Berk.) Miettinen | JN710562 | JN710562 | – | X460 | Australia |
|
Mycorrhaphium adustum (Schwein.) Maas Geest. | JN710573 | JN710573 | JN710727 | KHL12255 | USA |
|
M. hispidum Westph. & Miettinen | MH475306 | MH475306 | MH475317 | MCW 363/12T | Brazil |
|
M. hispidum | MH475307 | MH475307 | MH475318 | MCW 429/13 | Brazil |
|
M. subadustum | KC485537 | KC485554 | – | Dai 10173T | China |
|
M. subadustum | MW491378 | MW488040 | MW495253 | Yuan 12976T | China | This study |
Nigroporus vinosus (Berk.) Murrill | JX109857 | JX109857 | JX109914 | BHS2008-100 | USA |
|
N. vinosus | JN710575 | JN710575 | – | X839 | Indonesia |
|
N. cf. vinosus | MT681923 | MT675108 | MT793113 | Yuan 12916 | China | This study |
N. stipitatus Douanla-Meli & Ryvarden | JN710574 | JN710574 | – | X546T | Cameroon |
|
Skeletocutis novae-zelandiae (G. Cunn.)P.K. Buchanan & Ryvarden | JN710582 | JN710582 | – | Ryvarden 38641 | New Zealand |
|
Steccherinum aridum Svrček | JN710583 | JN710583 | – | Bureid 110510 | Norway |
|
S. cf. ciliolatum | JN710585 | JN710585 | – | Ryvarden 47033 | Estonia |
|
S. meridionale (Rajchenb.) Westphalen, Tomšovský & Rajchenberg | KY174992 | KY174992 | KY175019 | MR 284 | Chile |
|
S. neonitidum Westphalen & Tomšovský | KY174990 | KY174990 | KY175017 | MCW 371/12T | Brazil |
|
S. ochraceum (Pers. ex J.F. Gmel.) Gray | JN710590 | JN710590 | JN710730 | KHL 11902 | Brazil |
|
S. robustius (J. Erikss. & S. Lundell) J. Erikss. | JN710591 | JN710591 | – | G1195 | Sweden |
|
S. straminellum (Bres.) Melo | JN710597 | JN710597 | – | KH Larsson 13849 | France |
|
Trullella conifericola | MT269764 | – | – | Cui 2851T | China | This study |
T. conifericola | MT269760 | MT259326 | MT793109 | Yuan 12655T | Vietnam | This study |
T. conifericola | MT269761 | MT259327 | MT793110 | Yuan 12657T | Vietnam | This study |
T. dentipora (Ryvarden & Iturr.) Zmitr. | JN710512 | JN710512 | – | X200T | Venezuela |
|
T. duracina (Pat.) Zmitr. | MH475309 | MH475309 | – | MCW 410/13 | Brazil |
|
T. duracina | MH475310 | MH475310 | – | RP 96 | Brazil |
|
T. meridae (Miettinen & Ryvarden) Zmitr. | KY980668 | KY980676 | – | AS 2150 | Brazil | GenBank Database |
T. meridae | JN710513 | JN710513 | – | X290T | Venezuela |
|
T. polyporoides (Ryvarden & Iturr.) Zmitr. | JN710602 | JN710602 | – | X510T | Venezuela |
|
Xanthoporus syringae (Parmasto) Audet | JN710607 | JN710607 | – | Jeppson 2264 | Sweden |
|
X. syringae | AY789078 | AY684166 | DQ059049 | AFTOL-ID 774 | China |
|
Bayesian analysis and Maximum likelihood were applied to the ITS + nrLSU + tef1 dataset. All characters were weighted, and gaps were treated as missing data. Bayesian analysis with MrBayes 3.2.7 (
Multiple-marker analyses provide an advantage of accurately and promptly discovering a new species or genus (
Maximum likelihood tree based on the combined ITS + nrLSU + tef1 sequence dataset illustrating the phylogeny of Mycorrhaphium subadustum and Trullella conifericola and related taxa in Steccherinaceae. The new species are in bold. Branches are labelled with maximum likelihood bootstrap higher than 50% and Bayesian posterior probabilities more than 0.95.
The two new species Mycorrhaphium subadustum and Trullella conifericola were both defined with three markers and they form full-support (100% ML and 1.00 BPP) isolated lineages respectively in this study. The new species M. subadustum clustered together with Mycorrhaphium spp. and form a subclade with American M. adustum. In case of another new species T. conifericola, although the material of T. conifericola Cui 2851 was only provided with ITS sequences, it showed a high similarity of ITS to the other two samples (Yuan 12657 and Yuan 12655) with 99.59% and 98.77% respectively. Furthermore, the morphological and anatomical features, distribution and the coniferous-saprophytic habit suggested it represented an individual which belongs to T. conifericola. Three samples of T. conifericola get together with another six samples from the Trullella clade with support 92% in ML and 1.00 BPP. The phylogenetic tree obtained in this study is similar to that of
Basidiocarps stipitate; pileus semicircular to dimidiate; pileal surface velutinate, concentrically zonate, pileal margin yellowish white; hymenophore hydnoid. Hyphal system dimitic in spine trama and monomitic in context; generative hyphae with clamp connections; cystidia and gloeocystidia absent, cystidiols present. Basidiospores cylindrical to allantoid, CB–, IKI–.
China. Liaoning Province, Huanren County, Laotudingzi Nature Reserve, on fallen branch of angiosperm, 4.VIII.2018, Yuan 12976 (holotype
Subadustum (Lat.), referring to the affinity with M. adustum.
Basidiocarps annual, stipitate, solitary or imbricate, corky to soft fibrous, without odor and taste when fresh, light in weight when dry. Pilei semicircular to dimidiate, 2.5–4.5 cm wide and 0.3 cm thick. Pileal surface velutinate, smooth, concentrically zonate, yellowish white to greyish orange (4A2–5B4); margin acute, yellowish white (4A2). Hymenophore hydnoid; spines crowded, evenly distributed, greyish orange (5B4), fibrous, subulate to terete, straight to somewhat flexuous, solitary or confluent, up to 1 mm long, 5–7 per mm; sterile margin smooth, yellowish grey (4B2), up to 2 mm wide. Context yellowish white (3A2), leathery, azonate, homogeneous, up to 0.5 mm thick. Stipe up to 3 cm long, 1 cm wide, straight and base inflated, surface tomentum eventually glabrous, brownish orange (5C4).
Hyphal structure. Hyphal system monomitic in context, dimitic in spine trama; generative hyphae often with clamp connections and simple septate occasionally present; skeletal hyphae thick-walled to subsolid, CB+, IKI–; tissues pale yellow in KOH.
Context. Generative hyphae with clamp connections, colorless, thin- to slightly thick-walled, frequently branched, 3–5 µm diam; skeletal hyphae absent.
Spines. Generative hyphae often with clamp connections, simple-septate occasionally present, colorless, thin- to slightly thick-walled, moderately branched, 2.5–4 µm diam; skeletal hyphae thick-walled to subsolid, unbranched, subparallel along the spine, 3–5 µm diam. Gloeocystidia absent; cystidioles present among the basidia, fusiform, 8–12 × 1.5–3 µm. Basidia clavate, with a basal clamp and four sterigmata, 8–13.5 × 2–3.5 µm; basidioles in shape similar to basidia, but slightly smaller.
Basidiospores cylindrical to ellipsoid, colorless, thin-walled, smooth, CB–, IKI–, (3.5–)3.8–4.0(4.2) × (1.5–)1.8–1.9(–2.0) µm, Lm = 3.89 µm, Wm = 1.83 µm, Q = 2.13–2.17 (n = 60/2).
White rot.
In temperate zones.
China. Jilin Province, Antu Country, Changbai Mountain Nature Reserve, Huangsongpu, on fallen branch of angiosperm, 2.VIII.2008, Dai 10173 (
Basidiocarps annual, sessile or laterally stipitate; pileus flabelliform to semi-circular; pileal surface hirtellous, with appressed coarse hair, concentrically zonate and sulcate; pores round to angular. Hyphal system dimitic; generative hyphae with clamp connections; skeletal hyphae CB+, IKI–. Basidiospores cylindrical to allantoid, thin-walled.
Vietnam. Lam dong Province, Lac Duong District, Lac Duong District, Bidoup Nui Ba National Park, on fallen branch of Pinus kesiya, 15.X.2017, Yuan 12655 (holotype
Conifericola (Lat.), referring to growth on the coniferous substrate.
Basidiocarps annual, sessile or laterally stipitate, solitary to imbricate, without special odor or taste, leathery when fresh, shrinking, hard corky and light in weight upon drying. Pileus flabelliform to semi-circular, applanate, projecting 4–10 cm and 1 cm thick at the base; pileal surface hirtellous, with appressed coarse hair, concentrically zonate and sulcate, alternating white and greyish orange (6A1–6B3) when fresh, yellowish white (2A2/3A2/4A2) and nearly azonate when dry; margin acute, drying involute and wavy. Pore surface light orange (5A4), shiny; pores round to angular, tiny, 10–12 per mm, hardly visible to the naked eye; dissepiments entire; sterile margin ca. 1 mm wide. Context color paler than pores and upper surface, yellowish white (2A2–3A2), soft corky, azonate, 0.5–1.5 mm thick. Tubes non-stratified, concolorous with pore surface, dense, ca. 1.5 mm thick when dry. Stipe round, glabrous and smooth, light yellow to greyish yellow (4A4–4B5), 0.5–2 cm long and 2–4 mm in diam, dense and homogenous.
Hyphal structure. Hyphal system dimitic: generative hyphae bearing clamp connections, skeletal hyphae CB+, IKI–; tissues unchanged in KOH.
Context. Dominated by generative hyphae, interwoven; generative hyphae hyaline, thin- to slightly thick-walled, clamp connections abundant, frequently branched, 2.5–5.5 μm diam; skeletal hyphae hyaline, thick-walled with a wide lumen, unbranched, 1.5–5 μm diam.
Tubes. Dominated by skeletal hyphae, interwoven; generative hyphae hyaline, thin- to slightly thick-walled, moderately branched, 2–4 µm diam; skeletal hyphae hyaline, thick-walled to semisolid, straight to flexuous, unbranched, 1.5–3.5 µm diam. Cystidia or other sterile hymenial elements absent. Basidia short 8–15 × 4–5.5 µm, clavate, 4-sterigmata of 0.5–1 µm in length, with a clamp connection at base; basidioles similar to basidia in shape, but slightly smaller.
Basidiospores. Cylindrical to allantoid, slightly curved, hyaline, thin-walled, smooth, CB–, IKI–, (4.0–)4.1–5.5(–5.8) × (1.6–)1.8–2.3(–2.5) µm, Lm = 4.94 µm, Wm = 2.09 µm, Q = 2.36–2.45 (n = 60/2).
On fallen gymnosperm branch, causing a white rot.
In high altitude area of subtropical to tropical zones.
China. Fujian Prov., Wuyishan Forest Park, on fallen trunk of Pinus kesiya, 16.IX.2005, Cui 2851 (
The phylogenetic profiling showed that the new species Mycorrhaphium subadustum as well as Trullella conifericola are nested in the Steccherinaceae which belongs to the residual polyporoid clade (
Mycorrhaphium was recommended by
Mycorrhaphium embraced nine species (http://www.indexfungorum.org, 2020) and among which there are others two species described from Asia: Mycorrhaphium sessile H.S. Yuan & Y.C and M. stereoides Maas Geest. M. sessile is a species described from China, but the characteristics such as the sessile basidiocarps and presence of gloeocystidia can differentiate it from M. subadustum (
In the phylogenetic tree, nine samples of Trullella species which include the new species T. conifericola form the clade with strong support (92% ML and 1.00 BPP). Trullella is agenus which was originally proposed as ‘Trulla’ by
Besides, the genera Mycorrhaphium and Trullella together with Austeria, Flabellophora and Nigroporus form a large clade in the phylogenetic tree with strong support (85% ML and 1.00 BPP), and share similar morphological features, including zonate or sulcate pileal surfaces, tiny pores or dense spines and a context that is entirely or almost monomitic. They form a distinct subgroup in the Steccherinaceae.
1 | Hymenophore hydnoid | 2 |
– | Hymenophore poroid | M. hispidum Westph. & Miettinen |
2 | Spores less than 3.5 µm long | 3 |
– | Spores more than 3.5 µm long | 4 |
3 | Stipe present, spines less than 2 mm long | M. adustulum (Banker) Ryvarden |
– | Stipe absent, spines up to 4 mm long | M. sessile |
4 | Spines less than 5 mm long, spores less than 5 µm long | 5 |
– | Spines up to 10 mm long, spores up to 6.3 µm long | M. stereoides |
5 | Pileal less than 2 cm wide, gloeocystidia present | M. pusillum (Brot.) Maas Geest. |
– | Pileal more than 2 cm wide, gloeocystidia absent | 6 |
6 | Habit on the ground | 7 |
– | Habit on the fallen branch of hard wood | 8 |
7 | Spines more than 3 mm long | M. africanum Mossebo & Ryvarden |
– | Spines less than 3 mm long | M. citrinum Ryvarden |
8 | Pileal margin black, hyphae acyanophilous | M. adustum |
– | Pileal margin yellowish white, hyphae cyanophilous | M. subadustum |
This research was financed by the National Natural Science Foundation of China (Project Nos. 31770028, 31970017 & 31470148) and the Special Funds for the Young Scholars of Taxonomy of the Chinese Academy of Sciences (Project No. ZSBR-015).