Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China

Haiyan Zhu; Meng Pan; Jadson D.P. Bezerra; Chengming Tian; Xinlei Fan

doi:10.3897/mycokeys.62.47854

Research Article

Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China

Haiyan Zhu^‡§|, Meng Pan^‡, Jadson D.P. Bezerra^¶, Chengming Tian^‡, Xinlei Fan^‡

‡ Beijing Forestry University, Beijing, China

§ Institute of Microbiology, Chinese Academy of Sciences, Beijing, China

| University of Chinese Academy of Sciences, Beijing, China

¶ Universidade Federal de Goiás, Goiânia, Brazil

Corresponding author: Xinlei Fan ( xinleifan@bjfu.edu.cn )

Academic editor: Nalin Wijayawardene

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation: Zhu H, Pan M, Bezerra JDP, Tian C, Fan X (2020) Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China. MycoKeys 62: 97-121. https://doi.org/10.3897/mycokeys.62.47854

Abstract

Members of Cytospora encompass important plant pathogens, saprobes and endophytes on a wide range of woody hosts with a worldwide distribution. In the current study, we obtained seven representative isolates from six tree hosts of Betulaceae, Juglandaceae, Rosaceae, Tiliaceae and Ulmaceae in Mount Dongling of China. Based on morphological comparison and phylogenetic analyses using partial ITS, LSU, act, rpb2, tef1-α and tub2 gene sequences, we identified two known species (Cytospora leucostoma and C. pruinopsis) and two novel species (C. coryli and C. spiraeicola). These results represent the first study on Cytospora species associated with canker disease from Mount Dongling of China.

Keywords

Cytosporaceae, phylogeny, taxonomy, wood-inhabiting fungi

Introduction

The genus Cytospora was established by Ehrenberg (1818) and belongs to Cytosporaceae, Diaporthales, Sordariomycetes (Wijayawardene et al. 2018, Fan et al. 2020). It is characterised by single or labyrinthine of pycnidial locules, filamentous conidiophores (enteroblastic and phialidic conidiogenous cells) producing hyaline, allantoid conidia in the asexual morph; diaporthalean-like perithecia, clavate to elongate obovoid asci with four or eight hyaline, allantoid ascospores in the sexual morph (Spielman 1983, 1985, Adams et al. 2005). Species of Cytospora contain important pathogens that cause stem canker and dieback disease on more than 100 species of woody and coniferous plants, thereby causing severe commercial and ecological damage and significant losses worldwide (Sinclair et al. 1987, Adams et al. 2005, 2006, Fan et al. 2014a, b, 2015a, b, Lawrence et al. 2018, Pan et al. 2018, Zhu et al. 2018a, Zhang et al. 2019). Previous Cytospora species and their related sexual morphs viz. Leucostoma, Valsa, Valsella and Valseutypella were listed by old fungal literature without any living culture and sufficient evidence for their identification (Fries 1823, Saccardo 1884, Kobayashi 1970, Barr 1978, Sutton 1980, Gvritishvili 1982, Spielman 1983, 1985). Adams et al. (2005) revised the genus Cytospora from Eucalyptus with 28 species and accepted all sexual genera combined under Valsa, either as subgenera or species without additional infrageneric rank. Following the single-name for pleomorphic taxa, Cytospora (1818), the older asexual typified name was proposed as the recommended name against Valsa (1849), the younger sexual typified name (Fan et al. 2015a, b, Rossman et al. 2015).

Currently, 388 species epithets of Cytospora have been recorded in Index Fungorum (2020) (accessed 2 January 2020). However, Kirk et al. (2008) estimated approximately 110 species, but most of them lack herbarium materials, ex-type cultures and DNA sequence data.

Species identification criteria of Cytospora were previously carried out by the host-based method and morphology in China; however, these bases are unreliable due to the uninformative illustrations and descriptions, weak host specificity and overlapping morphological characteristics (Teng 1963, Tai 1979, Wei 1979). Recent studies have been able to use multiphase approaches to solve the taxonomy of Cytospora (Fan et al. 2014a, b, 2015a, b, Yang et al. 2015, Lawrence et al. 2016, Norphanphoun et al. 2017, Pan et al. 2018, Zhu et al. 2018a, Zhang et al. 2019). Fan et al. (2020) summarised 52 species of Cytospora associated with canker and dieback disease in China, using a six gene matrix (ITS, LSU, act, rpb2, tef1-α and tub2), of which 13 species were newly introduced.

Mount Dongling has high plant diversity in western Beijing, including more than 1,000 tree hosts (Ma et al. 1995). As more plant species were recorded in this region, the exploration of fungal diversity gradually increased as most fungi are often linked to particular host plants as pathogens or endophytes. Species of Alternaria, Diaporthe, Leptostroma, Pestalotiopsis and Phoma were the most commonly isolated endophytes from Pinus tabuliformis and later, an additional 38 endophytic taxa were identified from Acer truncatum from Mount Dongling (Guo et al. 2008, Sun et al. 2011). Further, pathogens belonging in Botryosphaeriales have been identified from Mount Dongling, including five species from Aplosporella, Botryosphaeria and Phaeobotryon (Zhu et al. 2018b). Zhu et al. (2019) subsequently introduced six species of diaporthalean fungi residing in four families (viz. Diaporthaceae, Erythrogloeaceae, Juglanconidaceae and Melanconidaceae) from Mount Dongling. For the current understanding, many common host plants represent high fungal diversity causing canker and dieback disease in Mount Dongling. Juglans mandshurica and J. regia (Juglandaceae) were infected by Botryosphaeria dothidea (Botryosphaeriaceae), Diaporthe eres, D. rostrata (Diaporthaceae) and Juglanconis oblonga (Juglanconidaceae). Rhus typhina (Anacardiaceae) was infected by Aplosporella ginkgonis, A. javeedii (Aplosporellaceae), Phaeobotryon rhois and P. rhoinum (Botryosphaeriaceae). Quercus mongolica (Fagaceae) was infected by Dendrostoma donglinensis (Erythrogloeaceae) (Zhu et al. 2018b, 2019).

During the course of cognitive practices to investigate forest pathogens that cause canker or dieback disease in Mount Dongling of China, seven Cytospora strains were obtained from six unrelated hosts, i.e. Corylus mandshurica (Betulaceae), Juglans mandshurica (Juglandaceae), Prunus sibirica, Spiraea salicifolia (Rosaceae), Tilia nobilis (Tiliaceae) and Ulmus pumila (Ulmaceae). Phylogenetic analyses inferred from combined ITS, LSU, act, rpb2, tef1-α and tub2 gene regions were conducted to provide a multi-gene phylogeny for Cytospora, based on a large set of freshly collected specimens in Mount Dongling of China. Thus, the current study aims to clarify the systematics and taxonomy of Cytospora species with detailed descriptions and illustrations and compare it to known species in the genus.

Materials and methods

Sampling and isolation

Seven infected branches of six hosts were collected from Mount Dongling of China (Table 1). Sampled trees expressed general symptoms and signs of canker diseases including elongate, slightly sunken and discoloured areas in the bark, several prominent dark sporocarps immersed in bark, erumpent through the surface of bark when mature (Fig. 1). A total of seven isolates was established by removing a mucoid spore mass from conidiomata or ascomata of fresh material, spreading the suspension on the surface of 1.8 % potato dextrose agar (PDA) and incubating at 25 °C for up to 24 h. Single germinating spores were transferred on to fresh PDA plates. Specimens and isolates were deposited in the Key Laboratory for Silviculture and Conservation of the Ministry of Education in Beijing Forestry University (BJFU) and at the working Collection of X.L. Fan (CF), housed at the BJFU. Axenic cultures are maintained in the China Forestry Culture Collection Centre (CFCC).

Table 1.

Download as

CSV

XLSX

Isolates and GenBank accession numbers used in the phylogenetic analyses of Cytospora.

Species	Strain¹	Host	Origin	GenBank accession numbers
Species	Strain¹	Host	Origin	ITS	LSU	act	rpb2	tef1-α	tub2
Cytospora ailanthicola	CFCC 89970^T	Ailanthus altissima	Ningxia, China	MH933618	MH933653	MH933526	MH933592	MH933494	MH933565
Cytospora ampulliformis	MFLUCC 16-0583^T	Sorbus intermedia	Russia	KY417726	KY417760	KY417692	KY417794	NA	NA
Cytospora ampulliformis	MFLUCC 16-0629	Acer platanoides	Russia	KY417727	KY417761	KY417693	KY417795	NA	NA
Cytospora amygdali	CBS 144233^T	Prunus dulcis	California, USA	MG971853	NA	MG972002	NA	MG971659	MG971718
Cytospora atrocirrhata	CFCC 89615	Juglans regia	Qinghai, China	KR045618	KR045700	KF498673	KU710946	KP310858	KR045659
Cytospora atrocirrhata	CFCC 89616	Juglans regia	Qinghai, China	KR045619	KR045701	KF498674	KU710947	KP310859	KR045660
Cytospora beilinensis	CFCC 50493^T	Pinus armandii	Beijing, China	MH933619	MH933654	MH933527	NA	MH933495	MH933561
Cytospora beilinensis	CFCC 50494	Pinus armandii	Beijing, China	MH933620	MH933655	MH933528	NA	MH933496	MH933562
Cytospora berberidis	CFCC 89927^T	Berberis dasystachya	Qinghai, China	KR045620	KR045702	KU710990	KU710948	KU710913	KR045661
Cytospora berberidis	CFCC 89933	Berberis dasystachya	Qinghai, China	KR045621	KR045703	KU710991	KU710949	KU710914	KR045662
Cytospora bungeana	CFCC 50495^T	Pinus bungeana	Shanxi, China	MH933621	MH933656	MH933529	MH933593	MH933497	MH933563
Cytospora bungeana	CFCC 50496	Pinus bungeana	Shanxi, China	MH933622	MH933657	MH933530	MH933594	MH933498	MH933564
Cytospora californica	CBS 144234^T	Juglans regia	California, USA	MG971935	NA	MG972083	NA	MG971645	NA
Cytospora carbonacea	CFCC 89947	Ulmus pumila	Qinghai, China	KR045622	KP310812	KP310842	KU710950	KP310855	KP310825
Cytospora carpobroti	CMW 48981^T	Carpobrotus edulis	South Africa	MH382812	MH411216	NA	NA	MH411212	MH411207
Cytospora celtidicola	CFCC 50497^T	Celtis sinensis	Anhui, China	MH933623	MH933658	MH933531	MH933595	MH933499	MH933566
Cytospora celtidicola	CFCC 50498	Celtis sinensis	Anhui, China	MH933624	MH933659	MH933532	MH933596	MH933500	MH933567
Cytospora centrivillosa	MFLUCC 16-1206^T	Sorbus domestica	Italy	MF190122	MF190068	NA	MF377600	NA	NA
Cytospora centrivillosa	MFLUCC 17-1660	Sorbus domestica	Italy	MF190123	MF190069	NA	MF377601	NA	NA
Cytospora ceratosperma	CFCC 89624	Juglans regia	Gansu, China	KR045645	KR045724	NA	KU710976	KP310860	KR045686
Cytospora ceratosperma	CFCC 89625	Juglans regia	Gansu, China	KR045646	KR045725	NA	KU710977	KP31086	KR045687
Cytospora ceratospermopsis	CFCC 89626^T	Juglans regia	Shaanxi, China	KR045647	KR045726	KU711011	KU710978	KU710934	KR045688
Cytospora ceratospermopsis	CFCC 89627	Juglans regia	Shaanxi, China	KR045648	KR045727	KU711012	KU710979	KU710935	KR045689
Cytospora chrysosperma	CFCC 89629	Salix psammophila	Shaanxi, China	KF765673	KF765689	NA	KF765705	NA	NA
	CFCC 89981	Populus alba subsp. pyramidalis	Gansu, China	MH933625	MH933660	MH933533	MH933597	MH933501	MH933568
	CFCC 89982	Ulmus pumila	Tibet, China	KP281261	KP310805	KP310835	NA	KP310848	KP310818
*Cytospora coryli*	CFCC 53162^T	*Corylus mandshurica*	Beijing, China	MN854450	MN854661	NA	MN850751	MN850758	MN861120
Cytospora cotini	MFLUCC 14-1050^T	Cotinus coggygria	Russia	KX430142	KX430143	NA	KX430144	NA	NA
Cytospora curvata	MFLUCC 15-0865^T	Salix alba	Russia	KY417728	KY417762	KY417694	KY417796	NA	NA
Cytospora davidiana	CXY 1350^T	Populus davidiana	Inner Mongolia, China	KM034870	NA	NA	NA	NA	NA
Cytospora davidiana	CXY 1374	Populus davidiana	Heilongjiang, China	KM034869	NA	NA	NA	NA	NA
Cytospora elaeagni	CFCC 89632	Elaeagnus angustifolia	Ningxia, China	KR045626	KR045706	KU710995	KU710955	KU710918	KR045667
Cytospora elaeagni	CFCC 89633	Elaeagnus angustifolia	Ningxia, China	KF765677	KF765693	KU710996	KU710956	KU710919	KR045668
Cytospora elaeagnicola	CFCC 52882	Elaeagnus angustifolia	Xinjiang, China	MK732341	MK732338	MK732344	MK732347	NA	NA
	CFCC 52883	Elaeagnus angustifolia	Xinjiang, China	MK732342	MK732339	MK732345	MK732348	NA	NA
	CFCC 52884	Elaeagnus angustifolia	Xinjiang, China	MK732343	MK732340	MK732346	MK732349	NA	NA
Cytospora erumpens	CFCC 50022	Prunus padus	Shanxi, China	MH933627	MH933661	MH933534	NA	MH933502	MH933569
Cytospora erumpens	MFLUCC 16-0580^T	Salix × fragilis	Russia	KY417733	KY417767	KY417699	KY417801	NA	NA
Cytospora eucalypti	CBS 144241	Eucalyptus globulus	California, USA	MG971907	NA	MG972056	NA	MG971617	MG971772
Cytospora euonymicola	CFCC 50499^T	Euonymus kiautschovicus	Shaanxi, China	MH933628	MH933662	MH933535	MH933598	MH933503	MH933570
Cytospora euonymicola	CFCC 50500	Euonymus kiautschovicus	Shaanxi, China	MH933629	MH933663	MH933536	MH933599	MH933504	MH933571
Cytospora euonymina	CFCC 89993^T	Euonymus kiautschovicus	Shanxi, China	MH933630	MH933664	MH933537	MH933600	MH933505	MH933590
Cytospora euonymina	CFCC 89999	Euonymus kiautschovicus	Shanxi, China	MH933631	MH933665	MH933538	MH933601	MH933506	MH933591
Cytospora fraxinigena	MFLUCC 14-0868^T	Fraxinus ornus	Italy	MF190133	MF190078	NA	NA	NA	NA
Cytospora fraxinigena	MFLU 17–0880	Fraxinus ornus	Italy	MF190134	MF190079	NA	NA	NA	NA
Cytospora fugax	CXY 1371	NA	NA	KM034852	NA	NA	NA	NA	KM034891
Cytospora fugax	CXY 1381	NA	NA	KM034853	NA	NA	NA	NA	KM034890
Cytospora gigalocus	CFCC 89620^T	Juglans regia	Qinghai, China	KR045628	KR045708	KU710997	KU710957	KU710920	KR045669
Cytospora gigalocus	CFCC 89621	Juglans regia	Qinghai, China	KR045629	KR045709	KU710998	KU710958	KU710921	KR045670
Cytospora gigaspora	CFCC 50014	Juniperus procumbens	Shanxi, China	KR045630	KR045710	KU710999.	KU710959	KU710922	KR045671
Cytospora gigaspora	CFCC 89634^T	Salix psammophila	Shaanxi, China	KF765671	KF765687	KU711000	KU710960	KU710923	KR045672
Cytospora granati	CBS 144237^T	Punica granatum	California, USA	MG971799	NA	MG971949	NA	MG971514	MG971664
Cytospora hippophaës	CFCC 89639	Hippophaë rhamnoides	Gansu, China	KR045632	KR045712	KU711001	KU710961	KU710924	KR045673
Cytospora hippophaës	CFCC 89640	Hippophaë rhamnoides	Gansu, China	KF765682	KF765698	KF765730	KU710962	KP310865	KR045674
Cytospora japonica	CFCC 89956	Prunus cerasifera	Ningxia, China	KR045624	KR045704	KU710993	KU710953	KU710916	KR045665
Cytospora japonica	CFCC 89960	Prunus cerasifera	Ningxia, China	KR045625	KR045705	KU710994	KU710954	KU710917	KR045666
Cytospora joaquinensis	CBS 144235^T	Populus deltoides	California, USA	MG971895	NA	MG972044	NA	MG971605	MG971761
Cytospora junipericola	BBH 42444	Juniperus communis	Italy	MF190126	MF190071	NA	NA	MF377579	NA
Cytospora junipericola	MFLU 17-0882^T	Juniperus communis	Italy	MF190125	MF190072	NA	NA	MF377580	NA
Cytospora juniperina	CFCC 50501^T	Juniperus przewalskii	Sichuan, China	MH933632	MH933666	MH933539	MH933602	MH933507	NA
	CFCC 50502	Juniperus przewalskii	Sichuan, China	MH933633	MH933667	MH933540	MH933603	MH933508	MH933572
	CFCC 50503	Juniperus przewalskii	Sichuan, China	MH933634	MH933668	MH933541	MH933604	MH933509	NA
Cytospora kantschavelii	CXY 1383	Populus maximowiczii	Jilin, China	KM034867	NA	NA	NA	NA	NA
Cytospora kantschavelii	CXY 1386	Populus maximowiczii	Chongqing, China	KM034867	NA	NA	NA	NA	NA
Cytospora leucosperma	CFCC 89622	Pyrus bretschneideri	Gansu, China	KR045616	KR045698	KU710988	KU710944	KU710911	KR045657
Cytospora leucosperma	CFCC 89894	Pyrus bretschneideri	Qinghai, China	KR045617	KR045699	KU710989	KU710945	KU710912	KR045658
*Cytospora leucostoma*	CFCC 50015	Sorbus aucuparia	Ningxia, China	KR045634	KR045714	KU711002	NA	KU710925	KR045675
	CFCC 50016	Sorbus aucuparia	Ningxia, China	MH820400	MH820393	MH820408	NA	MH820404	MH820389
	CFCC 50017	Prunus cerasifera	Ningxia, China	MH933635	MH933669	MH933542	NA	MH933510	MH933573
	CFCC 50018	Prunus serrulata	Gansu, China	MH933636	MH933670	MH933543	NA	MH933511	MH933574
	CFCC 50019	Rosa helenae	Gansu, China	MH933637	MH933671	MH933544	NA	NA	NA
	CFCC 50020	Prunus persica	Gansu, China	MH933638	MH933672	MH933545	NA	NA	NA
	CFCC 50021	Prunus salicina	Gansu, China	MH933639	MH933673	MH933546	NA	MH933512	MH933575
	CFCC 50023	Cornus alba	Shanxi, China	KR045635	KR045715	KU711003	KU710964	KU710926	KR045676
	CFCC 50024	Prunus pseudocerasus	Qinghai, China	MH933640	MH933674	MH933547	MH933605	NA	MH933576
	CFCC 50467	Betula platyphylla	Beijing, China	KT732948	KT732967	NA	NA	NA	NA
	CFCC 50468	Betula platyphylla	Beijing, China	KT732949	KT732968	NA	NA	NA	NA
	CFCC 53140	*Prunus sibirica*	Beijing, China	MN854445	MN854656	MN850760	MN850746	MN850753	MN861115
	CFCC 53141	*Prunus sibirica*	Beijing, China	MN854446	MN854657	MN850761	MN850747	MN850754	MN861116
	CFCC 53156	*Juglans mandshurica*	Beijing, China	MN854447	MN854658	MN850762	MN850748	MN850755	MN861117
	MFLUCC 16-0574	Rosa sp.	Russia	KY417731	KY417764	KY417696	KY417798	NA	NA
	MFLUCC 16-0589	Salix alba	Russia	KY417732	KY417766	KY417698	KY417800	NA	NA
Cytospora longiostiolata	MFLUCC 16-0628^T	Salix × fragilis	Russia	KY417734	KY417768	KY417700	KY417802	NA	NA
Cytospora longispora	CBS 144236^T	Prunus domestica	California, USA	MG971905	NA	MG972054	NA	MG971615	MG971764
Cytospora lumnitzericola	MFLUCC 17-0508^T	Lumnitzera racernosa	Tailand	MG975778	MH253461	MH253457	MH253453	NA	NA
Cytospora mali	CFCC 50028	Malus pumila	Gansu, China	MH933641	MH933675	MH933548	MH933606	MH933513	MH933577
	CFCC 50029	Malus pumila	Ningxia, China	MH933642	MH933676	MH933549	MH933607	MH933514	MH933578
	CFCC 50030	Malus pumila	Shaanxi, China	MH933643	MH933677	MH933550	MH933608	MH933524	MH933579
	CFCC 50031	Crataegus sp.	Shanxi, China	KR045636	KR045716	KU711004	KU710965	KU710927	KR045677
	CFCC 50044	Malus baccata	Qinghai, China	KR045637	KR045717	KU711005	KU710966	KU710928	KR045678
Cytospora melnikii	CFCC 89984	Rhus typhina	Xinjiang, China	MH933644	MH933678	MH933551	MH933609	MH933515	MH933580
	MFLUCC 15-0851^T	Malus domestica	Russia	KY417735	KY417769	KY417701	KY417803	NA	NA
	MFLUCC 16-0635	Populus nigra var. italica	Russia	KY417736	KY417770	KY417702	KY417804	NA	NA
Cytospora nivea	MFLUCC 15-0860	Salix acutifolia	Russia	KY417737	KY417771	KY417703	KY417805	NA	NA
	CFCC 89641	Elaeagnus angustifolia	Ningxia, China	KF765683	KF765699	KU711006	KU710967	KU710929	KR045679
	CFCC 89643	Salix psammophila	Shaanxi, China	KF765685	KF765701	NA	KU710968	KP310863	KP310829
Cytospora oleicola	CBS 144248^T	Olea europaea	California, USA	MG971944	NA	MG972098	NA	MG971660	MG971752
Cytospora palm	CXY 1276	Cotinus coggygria	Beijing, China	JN402990	NA	NA	NA	KJ781296	NA
Cytospora palm	CXY 1280^T	Cotinus coggygria	Beijing, China	JN411939	NA	NA	NA	KJ781297	NA
Cytospora parakantschavelii	MFLUCC 15-0857^T	Populus × sibirica	Russia	KY417738	KY417772	KY417704	KY417806	NA	NA
Cytospora parakantschavelii	MFLUCC 16-0575	Pyrus pyraster	Russia	KY417739	KY417773	KY417705	KY417807	NA	NA
Cytospora parapistaciae	CBS 144506^T	Pistacia vera	California, USA	MG971804	NA	MG971954	NA	MG971519	MG971669
Cytospora parasitica	MFLUCC 15-0507^T	Malus domestica	Russia	KY417740	KY417774	KY417706	KY417808	NA	NA
Cytospora parasitica	XJAU 2542-1	Malus sp.	Xinjiang, China	MH798884	MH798897	NA	NA	MH813452	NA
Cytospora paratranslucens	MFLUCC 15-0506^T	Populus alba var. bolleana	Russia	KY417741	KY417775	KY417707	KY417809	NA	NA
Cytospora paratranslucens	MFLUCC 16-0627	Populus alba	Russia	KY417742	KY417776	KY417708	KY417810	NA	NA
Cytospora pistaciae	CBS 144238^T	Pistacia vera	California, USA	MG971802	NA	MG971952	NA	MG971517	MG971667
Cytospora platanicola	MFLU 17-0327^T	Platanus hybrida	Italy	MH253451	MH253452	MH253449	MH253450	NA	NA
Cytospora platyclada	CFCC 50504^T	Platycladus orientalis	Yunnan, China	MH933645	MH933679	MH933552	MH933610	MH933516	MH933581
	CFCC 50505	Platycladus orientalis	Yunnan, China	MH933646	MH933680	MH933553	MH933611	MH933517	MH933582
	CFCC 50506	Platycladus orientalis	Yunnan, China	MH933647	MH933681	MH933554	MH933612	MH933518	MH933583
Cytospora platycladicola	CFCC 50038^T	Platycladus orientalis	Gansu, China	KT222840	MH933682	MH933555	MH933613	MH933519	MH933584
Cytospora platycladicola	CFCC 50039	Platycladus orientalis	Gansu, China	KR045642	KR045721	KU711008	KU710973	KU710931	KR045683
Cytospora plurivora	CBS 144239^T	Olea europaea	California, USA	MG971861	NA	MG972010	NA	MG971572	MG971726
Cytospora populicola	CBS 144240^T	Populus deltoides	California, USA	MG971891	NA	MG972040	NA	MG971601	MG971757
Cytospora populina	CFCC 89644^T	Salix psammophila	Shaanxi, China	KF765686	KF765702	KU711007	KU710969	KU710930	KR045681
Cytospora populinopsis	CFCC 50032^T	Sorbus aucuparia	Ningxia, China	MH933648	MH933683	MH933556	MH933614	MH933520	MH933585
Cytospora populinopsis	CFCC 50033	Sorbus aucuparia	Ningxia, China	MH933649	MH933684	MH933557	MH933615	MH933521	MH933586
*Cytospora pruinopsis*	CFCC 50034^T	Ulmus pumila	Shaanxi, China	KP281259	KP310806	KP310836	KU710970	KP310849	KP310819
	CFCC 50035	Ulmus pumila	Jilin, China	KP281260	KP310807	KP310837	KU710971	KP310850	KP310820
	CFCC 53153	*Ulmus pumila*	Beijing, China	MN854451	MN854662	MN850763	MN850752	MN850759	MN861121
Cytospora predappioensis	MFLUCC 17-2458^T	Platanus hybrida	Italy	MG873484	MG873480	NA	NA	NA	NA
Cytospora pruinosa	CFCC 50036	Syringa oblata	Qinghai, China	KP310800	KP310802	KP310832	NA	KP310845	KP310815
Cytospora pruinosa	CFCC 50037	Syringa oblata	Qinghai, China	MH933650	MH933685	MH933558	NA	MH933522	MH933589
Cytospora prunicola	MFLU 17-0995^T	Prunus sp.	Italy	MG742350	MG742351	MG742353	MG742352	NA	NA
Cytospora punicae	CBS 144244	Punica granatum	California, USA	MG971943	NA	MG972091	NA	MG971654	MG971798
Cytospora quercicola	MFLU 17-0881	Quercus sp.	Italy	MF190128	MF190074	NA	NA	NA	NA
Cytospora quercicola	MFLUCC 14-0867^T	Quercus sp.	Italy	MF190129	MF190073	NA	NA	NA	NA
Cytospora ribis	CFCC 50026	Ulmus pumila	Qinghai, China	KP281267	KP310813	KP310843	KU710972	KP310856	KP310826
Cytospora ribis	CFCC 50027	Ulmus pumila	Qinghai, China	KP281268	KP310814	KP310844	NA	KP310857	KP310827
Cytospora rosae	MFLU 17-0885	Rosa canina	Italy	MF190131	MF190076	NA	NA	NA	NA
Cytospora rostrata	CFCC 89909^T	Salix cupularis	Gansu, China	KR045643	KR045722	KU711009	KU710974	KU710932	KR045684
Cytospora rostrata	CFCC 89910	Salix cupularis	Gansu, China	KR045644	KR045723	KU711010	KU710975	KU710933	NA
Cytospora rusanovii	MFLUCC 15-0853	Populus × sibirica	Russia	KY417743	KY417777	KY417709	KY417811	NA	NA
Cytospora rusanovii	MFLUCC 15-0854^T	Salix babylonica	Russia	KY417744	KY417778	KY417710	KY417812	NA	NA
Cytospora salicacearum	MFLUCC 15-0861	Salix × fragilis	Russia	KY417745	KY417779	KY417711	KY417813	NA	NA
	MFLUCC 15-0509^T	Salix alba	Russia	KY417746	KY417780	KY417712	KY417814	NA	NA
	MFLUCC 16-0576	Populus nigra var. italica	Russia	KY417741	KY417775	KY417707	KY417809	NA	NA
	MFLUCC 16-0587	Prunus cerasus	Russia	KY417742	KY417776	KY417708	KY417810	NA	NA
Cytospora salicicola	MFLUCC 15-0866	Salix alba	Russia	KY417749	KY417783	KY417715	KY417817	NA	NA
Cytospora salicicola	MFLUCC 14-1052^T	Salix alba	Russia	KU982636	KU982635	KU982637	NA	NA	NA
Cytospora salicina	MFLUCC 15-0862^T	Salix alba	Russia	KY417750	KY417784	KY417716	KY417818	NA	NA
Cytospora salicina	MFLUCC 16-0637	Salix × fragilis	Russia	KY417751	KY417785	KY417717	KY417819	NA	NA
Cytospora schulzeri	CFCC 50040	Malus domestica	Ningxia, China	KR045649	KR045728	KU711013	KU710980	KU710936	KR045690
Cytospora schulzeri	CFCC 50042	Malus asiatica	Qinghai, China	KR045650	KR045729	KU711014	KU710981	KU710937	KR045691
Cytospora sibiraeae	CFCC 50045^T	Sibiraea angustata	Gansu, China	KR045651	KR045730	KU711015	KU710982	KU710938	KR045692
Cytospora sibiraeae	CFCC 50046	Sibiraea angustata	Gansu, China	KR045652	KR045731	KU711015	KU710983	KU710939	KR045693
Cytospora sophorae	CFCC 50047	Styphnolobium japonicum	Shanxi, China	KR045653	KR045732	KU711017	KU710984	KU710940	KR045694
	CFCC 50048	Magnolia grandiflora	Shanxi, China	MH820401	MH820394	MH820409	MH820397	MH820405	MH820390
	CFCC 89598	Styphnolobium japonicum	Gansu, China	KR045654	KR045733	KU711018	KU710985	KU710941	KR045695
Cytospora sophoricola	CFCC 89595^T	Styphnolobium japonicum var. pendula	Gansu, China	KR045655	KR045734	KU711019	KU710986	KU710942	KR045696
Cytospora sophoricola	CFCC 89596	Styphnolobium japonicum var. pendula	Gansu, China	KR045656	KR045735	KU711020	KU710987	KU710943	KR045697
Cytospora sophoriopsis	CFCC 89600^T	Styphnolobium japonicum	Gansu, China	KR045623	KP310804	KU710992	KU710951	KU710915	KP310817
Cytospora sorbi	MFLUCC 16-0631^T	Sorbus aucuparia	Russia	KY417752	KY417786	KY417718	KY417820	NA	NA
Cytospora sorbicola	MFLUCC 16-0584^T	Acer pseudoplatanus	Russia	KY417755	KY417789	KY417721	KY417823	NA	NA
Cytospora sorbicola	MFLUCC 16-0633	Cotoneaster melanocarpus	Russia	KY417758	KY417792	KY417724	KY417826	NA	NA
Cytospora spiraeae	CFCC 50049^T	Spiraea salicifolia	Gansu, China	MG707859	MG707643	MG708196	MG708199	NA	NA
Cytospora spiraeae	CFCC 50050	Spiraea salicifolia	Gansu, China	MG707860	MG707644	MG708197	MG708200	NA	NA
*Cytospora spiraeicola*	CFCC 53138^T	*Spiraea salicifolia*	Beijing, China	MN854448	MN854659	NA	MN850749	MN850756	MN861118
*Cytospora spiraeicola*	CFCC 53139	*Tilia nobilis*	Beijing, China	MN854449	MN854660	NA	MN850750	MN850757	MN861119
Cytospora tamaricicola	CFCC 50507	Rosa multifolora	Yunnan, China	MH933651	MH933686	MH933559	MH933616	MH933525	MH933587
Cytospora tamaricicola	CFCC 50508^T	Tamarix chinensis	Yunnan, China	MH933652	MH933687	MH933560	MH933617	MH933523	MH933588
Cytospora tanaitica	MFLUCC 14-1057^T	Betula pubescens	Russia	KT459411	KT459412	KT459413	NA	NA	NA
Cytospora thailandica	MFLUCC 17-0262^T	Xylocarpus moluccensis	Thailand	MG975776	MH253463	MH253459	MH253455	NA	NA
Cytospora thailandica	MFLUCC 17-0263^T	Xylocarpus moluccensis	Thailand	MG975777	MH253464	MH253460	MH253456	NA	NA
Cytospora tibouchinae	CPC 26333^T	Tibouchina semidecandra	France	KX228284	KX228335	NA	NA	NA	NA
Cytospora translucens	CXY 1351	Populus davidiana	Inner Mongolia, China	KM034874	NA	NA	NA	NA	KM034895
Cytospora ulmi	MFLUCC 15-0863^T	Ulmus minor	Russia	KY417759	NA	NA	NA	NA	NA
Cytospora vinacea	CBS 141585^T	Vitis interspecific hybrid ‘Vidal’	USA	KX256256	NA	NA	NA	KX256277	KX256235
Cytospora viticola	CBS 141586^T	Vitis vinifera ‘Cabernet Franc’	USA	KX256239	NA	NA	NA	KX256260	KX256218
Cytospora xylocarpi	MFLUCC 17-0251^T	Xylocarpus granatum	Thailand	MG975775	MH253462	MH253458	MH253454	NA	NA
Diaporthe vaccinii	CBS 160.32	Vaccinium macrocarpon	USA	KC343228	NA	JQ807297	NA	KC343954	KC344196

Abbreviations: BBH: BIOTEC Bangkok Herbarium, National Science and Technology Development Agency, Thailand; CBS: Westerdijk Fungal Biodiversity Institute (CBS-KNAW Fungal Biodiversity Centre), Utrecht, The Netherlands; CFCC: China Forestry Culture Collection Centre, Beijing, China; CMW: Culture collection of Michael Wingfield, university of Pretoria, South africa; CPC: Culture collection of Pedro Crous, The Netherlands; MFLU: Mae Fah Luang University herbarium, Thailand; MFLUCC: Mae Fah Luang University Culture Collection, Thailand; XJAU: Xinjiang Agricultural University, Xinjiang, China; NA: not applicable. All the new isolates used in this study are indicated in bold type and the strains from generic type species are marked by a superscript (T).

Figure 1.

Disease symptoms associated with Cytospora species. A Corylus mandshurica B Spiraea salicifolia C Ulmus pumila D Prunus sibirica.

Morphological analysis

Species identification was based on morphological features of the ascomata or conidiomata from infected host materials and micromorphology, supplemented by cultural characteristics. Microscopic photographs (structure and size of stromata; structure and size of ectostromatic disc and ostioles) were captured using a Leica stereomicroscope (M205 FA) (Leica Microsystems, Wetzlar, Germany). Microscopic observations (shape and size of conidiophores, asci and conidia/ascospores) were determined under a Nikon Eclipse 80i microscope (Nikon Corporation, Tokyo, Japan), equipped with a Nikon digital sight DS-Ri2 high definition colour camera, using differential interference contrast (DIC) illumination. The Nikon software NIS-Elements D Package v. 3.00, Adobe Bridge CS v. 6 and Adobe Photoshop CS v. 5 were used for the manual editing. More than 10 conidiomata/ascomata, 10 asci and 30 conidia/ascospores were measured by Nikon software NIS-Elements D Package v. 3.00 to calculate the mean size/length and respective standard deviations (SD). Colony diameters were measured and the colony features were described using the colour charts of Rayner (1970).

DNA extraction, PCR amplification and sequencing

Fungal mycelium grown on the cellophane of PDA was scraped for the extraction of genomic DNA following a modified CTAB method (Doyle and Doyle 1990). The primers and PCR conditions are listed in Table 2. DNA sequencing was performed using an ABI PRISM 3730XL DNA Analyser with a BigDye Terminater Kit v.3.1 (Invitrogen, USA) at the Shanghai Invitrogen Biological Technology Company Limited (Beijing, China). The DNA sequences, obtained from forward and reverse primers, were combined using SeqMan v. 7.1.0 in the DNASTAR Lasergene Core Suite software (DNASTAR Inc., Madison, WI, USA).

Table 2.

Download as

CSV

XLSX

Genes used in this study with PCR primers, primer DNA sequence, optimal annealing temperature and corresponding references.

Locus	Definition	Primers	Primer DNA sequence (5'–3')	Optimal annealing temp (°C)	References of primers used
ITS	internal transcribed spacer of ribosomal RNA	ITS1	TCCGTAGGTGAACCTGCGG	51	White et al. 1990
ITS	internal transcribed spacer of ribosomal RNA	ITS4	TCCTCCGCTTTTGATATGC	51	White et al. 1990
LSU	large subunit of ribosomal RNA	LROR	ACCCGCTGAACTTAAGC	55	Vilgalys and Hester 1990
LSU	large subunit of ribosomal RNA	LR7	TACTACCACCAAGATCT	55	Vilgalys and Hester 1990
act	actin	ACT-512F	ATGTGCAAGGCCGGTTTCGC	61	Carbone and Kohn 1999
act	actin	ACT-783R	TACGAGTCCTTCTGGCCCAT	61	Carbone and Kohn 1999
rpb2	RNA polymerase II second largest subunit	RPB2-5F	GA(T/C)GA(T/C)(A/C)G(A/T)GATCA(T/C)TT(T/C)GG	52	Liu et al. 1999
rpb2	RNA polymerase II second largest subunit	RPB2-7cR	CCCAT(A/G)GCTTG(T/C)TT(A/G)CCCAT	52	Liu et al. 1999
tef-1α	translation elongation factor 1-alpha	EF1-668F	CGGTCACTTGATCTACAAGTGC	55	Alves et al. 2008
tef-1α	translation elongation factor 1-alpha	EF1-1251R	CCTCGAACTCACCAGTACCG	55	Alves et al. 2008
tub2	beta-tubulin	Bt2a	GGTAACCAAATCGGTGCTGCTTTG	55	Glass and Donaldson 1995
tub2	beta-tubulin	Bt2b	ACCCTCAGTGTAGTGACCCTTGGC	55	Glass and Donaldson 1995

Phylogenetic analyses

The current isolates were initially identified as Cytospora species, based on both morphological observations and BLAST results. To clarify their further phylogenetic position, an analysis, based on the combined six genes (ITS, LSU, act, rpb2, tef1-α and tub2), was performed to compare Cytospora species from the current study with other strains in GenBank. Diaporthe vaccinii was selected as the outgroup in all analyses. Subsequent alignments for each gene were generated using MAFFT v.7 (Katoh and Standley 2013) and manually adjusted using MEGA v. 6 (Tamura et al. 2013). Ambiguously aligned sequences were excluded from analysis. Reference sequences were selected, based on ex-type or ex-epitype sequences available from recently published literature (Fan et al. 2014a, b, 2015a, b, 2020, Yang et al. 2015, Lawrence et al. 2016, Norphanphoun et al. 2017, Zhu et al. 2018a, Zhang et al. 2019, Fan et al. 2020) (Table 1). Phylogenetic analyses were performed with PAUP v.4.0b10 for the maximum parsimony (MP) method (Swofford 2003), MrBayes v.3.1.2 for the Bayesian Inference (BI) method (Ronquist and Huelsenbeck 2003) and RAxML for the maximum likelihood (ML) method (Stamatakis 2006).

A partition homogeneity test (PHT) with heuristic search and 1,000 replicates was performed using PAUP v.4.0b10 to test the discrepancy amongst the ITS, LSU, act, rpb2, tef1-α and tub2 sequence datasets in reconstructing phylogenetic trees. MP analysis was performed using a heuristic search option of 1,000 random-addition sequences with a tree bisection and reconnection (TBR) branch swapping algorithm (Swofford 2003). The branches of zero length were collapsed and all equally parsimonious trees were saved. Clade stability was assessed with a bootstrap analysis of 1,000 replicates (Hillis and Bull 1993). Other parsimony scores, such as tree length (TL), consistency index (CI), retention index (RI) and rescaled consistency (RC), were calculated (Swofford 2003). ML analysis was performed with the GTR + G + I model of site substitution following recent studies (Zhu et al. 2018a), including estimation of gamma-distributed rate heterogeneity and a proportion of invariant sites using PhyML v. 3.0 (Guindon et al. 2010). The branch support was evaluated with a bootstrapping method of 1,000 replicates (Hillis and Bull 1993). BI analysis was performed using a Markov Chain Monte Carlo (MCMC) algorithm with Bayesian posterior probabilities (Rannala and Yang 1996). A nucleotide substitution model was estimated by MrModeltest v.2.3 (Posada and Crandall 1998) and a weighted Bayesian analysis was considered. Two MCMC chains were run from random trees for 1,000,000 generations and trees were sampled each 100 generations. The first 25% of trees were discarded as the burn-in phase of each analysis and the posterior probabilities (BPP) were calculated to assess the remaining trees (Rannala and Yang 1996). The branch support from MP and ML analysis was evaluated with a bootstrapping (BS) method of 1,000 replicates (Hillis and Bull 1993). Phylograms were plotted in Figtree v. 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree) and edited in Adobe Illustrator CS6 v.16.0.0 (https://www.adobe.com/cn/products/illustrator.html). Novel sequences, generated in the current study, were deposited in GenBank (Table 1) and the aligned matrices, used for phylogenetic analyses, were submitted in TreeBASE (www.treebase.org; study ID S25564).

Results

Phylogenetic analyses

A combined matrix of six gene sequences of Cytospora was considered. The combined alignments matrix (ITS, LSU, act, rpb2, tef1-α and tub2) included 172 accessions (seven from this study and 165 retrieved from GenBank) and counted 3,652 characters including gaps (665 characters for ITS, 525 for LSU, 337 for act, 730 for rpb2, 771 for tef1-α and 624 for tub2), of which 2,067 characters were constant, 189 variable characters were parsimony-uninformative and 1,396 (38.22%) characters were variable and parsimony-informative. The MP analysis generated 100 parsimonious trees, the first tree of which is presented in Fig. 2 (TL = 8,029, CI = 0.345, RI = 0.804, RC = 0.278). Tree topologies of ML and BI analyses were similar to the MP tree. Based on the multi-locus phylogeny and morphology, seven strains were assigned to four species within Cytospora coryli, C. leucostoma, C. pruinopsis and C. spiraeicola, including two taxa which we describe here as new. The two isolates of C. spiraeicola formed a distinct and strongly supported clade (MP/ML/BI = 100/100/1) with close phylogenetic affinity to C. elaeagnicola and C. spiraeae. The strain of C. coryli from Corylus mandshurica shared a close relationship to Cytospora euonymicola and C. gigalocus with 100% MP, 99% ML, 0.99 BI supports.

Figure 2.

Phylogram of Cytospora, based on combined ITS, LSU, act, rpb2, tef1-α and tub2 genes. The MP and ML bootstrap support values above 50% are shown at the first and second positions, respectively. Thickened branches represent posterior probabilities above 0.95 from the BI. Ex-type strains are in bold. Strains from the current study are in blue.

Taxonomy

Cytospora coryli H.Y. Zhu & X.L. Fan, sp. nov.

MycoBank No: 833820

Fig. 3

Etymology

Named after the host genus on which it was collected, Corylus.

Holotype

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°27'07.00"E, 39°59'26.47"N), from branches of Corylus mandshurica, 17 Aug 2017, H.Y. Zhu & X.L. Fan, holotype CF 2019813, ex-type living culture CFCC 53162.

Description

Necrotrophic on branches of Corylus mandshurica. Sexual morph: not observed. Asexual morph: Conidiomata pycnidial, flat, immersed in the bark, scattered to gregarious, erumpent through the surface of bark, surrounded by conspicuous black stroma walls in the margin, with multiple locules. Conceptacle absent. Ectostromatic disc grey to black, discoid, circular to ovoid, 270–340 µm in diam., with one ostiole per disc. Ostiole grey to black, at the same or above level as the disc surface, inconspicuous. Locules numerous, subdivided frequently by invaginations with common walls, circular to irregular, 1550–1710 µm in diam. Conidiophores hyaline, branched at the base, in the middle, approximately cylindrical with the top end acute, 15.5–18.5 × 1–2 (av. = 17 ± 1.2 × 1.1 ± 0.2, n = 10) µm, sometimes reduced to conidiogenous cells. Conidiogenous cells enteroblastic, phialidic, sub-cylindrical to cylindrical, 7.5–14 × 1–2 (av. = 9.3 ± 1.7 × 1.4 ± 0.2, n = 10) μm. Conidia hyaline, allantoid, smooth, aseptate, thin-walled, 5–7 × 1–2 (av. = 5.6 ± 0.5 × 1.4 ± 0.2, n = 30) μm.

Figure 3.

Cytospora coryli from Corylus mandshurica (CF 2019813). A, B habit of conidiomata on twig C transverse section of conidioma D longitudinal section through conidioma E conidiophores and conidiogenous cells F conidia G colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A); 500 μm (B–D); 10 μm (E, F).

Culture characteristics

Cultures are initially white with hazel at the centre, growing fast up 9 cm in diam. after 3 days, becoming honey to hazel from the edge to centre after 7–10 days. In reverse, the cultures are the same as the upper colour after 3 days, becoming cinnamon from the edge to centre after 7–10 days. Colonies are ﬂat, sparse at the centre and compact to the margin. Pycnidia distributed radially on colony surface.

Habitat and distribution

Known from Corylus mandshurica in Mount Dongling, China.

Notes

Cytospora coryli is associated with canker disease of Corylus mandshurica in China. The only strain CFCC 53162 representing Cytospora coryli clusters as a single lineage and appears mostly related to C. euonymicola from Euonymus kiautschovicus and to Cytospora gigalocus from Juglans regia (Fan et al. 2015a, 2020) (Fig. 2). Cytospora coryli differs from C. euonymicola by its larger locules (1550–1710 vs. 1150–1400 µm) and larger conidia (5–7 × 1–2 vs. 4.5–5 × 1 μm) (Fan et al. 2020), C. coryli differs from C. gigalocus by its smaller locules (1550–1710 vs. 1630–2180 µm) with single ostiole (one to five ostioles in C. gigalocus) and the larger size of conidia (5–7 × 1–2 vs. 4.6–5.6 × 0.8–1.3 μm) (Fan et al. 2015a). Based on morphology and sequence data, we describe it as a new species.

Cytospora leucostoma (Pers.) Sacc., Michelia 2: 264 (1881)

Figs 4, 5

Sphaeria leucostoma Pers., Ann. Bot. 11: 23 (1794)

Valsa leucostoma (Pers.) Fr., Summa Veg. Scand., Section Post. (Stockholm): 411 (1849)

Valsa persoonii Nitschke, Pyrenomyc. Germ. 2: 222 (1870)

Leucostoma persoonii (Nitschke) Höhn., Mitt. Bot. Inst. Tech. Hochsch. Wien 5: 78 (1928)[Additional synonyms in Species Fungorum.]

Description

Necrotrophic on branches of Betulaceae, Juglandaceae and Rosaceae. Sexual morph: Ascostromata immersed in the bark, erumpent through the surface of bark, scattered, 950–2550 µm in diam., with 8–10 perithecia arranged circularly to irregularly. Conceptacle absent. Ectostromatic disc pale grey, fusoid, 600–2150 µm in diam., with 8–10 ostioles arranged irregularly per disc. Ostioles numerous, dark grey to black, at the same or above the level as the disc, concentrated, arranged irregularly in a disc, 60–120 µm in diam. Perithecia beige with a little black when mature, flask-shaped to spherical, arranged circularly to irregularly, 270–560 µm in diam. Paraphyses large, broad and cylindrical with 1–4 septa, 39–78 × 5.8–8.7 (av. = 50.6 ± 13.7 × 7 ± 0.8, n = 10) μm. Asci free, clavate to elongate obovoid, 35–45 × 6–8 (av. = 40.4 ± 3.3 × 6.9 ± 0.5, n = 10) μm, 8-spored. Ascospores uniseriate to biseriate, elongate-allantoid, thin-walled, hyaline, aseptate, 7–10 × 2–3 (av. = 8.3 ± 0.9× 2.6 ± 0.2, n = 30) μm. Asexual morph: Conidiomata pycnidial, immersed in the bark, scattered, erumpent through the surface of bark, with multiple locules and a conspicuous central column. Central column beneath the disc more or less conical, brown. Conceptacle absent. Ectostromatic disc buff, discoid, circular to ovoid, 190–310 µm in diam., with 1–2 ostioles per disc. Ostioles grey to black, at the same or above the level as the disc surface, 60–65 μm in diam. Locules numerous, subdivided frequently by invaginations with common walls, circular to ovoid, 700–1000 µm in diam. Conidiophores hyaline, branched at the base or unbranched, approximately cylindrical, 8–14 × 1–2 (av. = 11.5 ± 1.8 × 1.4 ± 0.2, n = 10) µm, sometimes reduced to conidiogenous cells. Conidiogenous cells enteroblastic phialidic, sub-cylindrical to cylindrical, 7–11 × 1–2 (av. = 9 ± 1.4 × 1.5 ± 0.3, n = 10) μm. Conidia hyaline, elongate-allantoid, smooth, aseptate, 4.5–6 × 1–2 (av. = 5.4 ± 0.3 × 1.5 ± 0.2, n = 30) μm.

Figure 4.

Cytospora leucostoma (Sexual morph) from Prunus sibirica (CF 2019814). A, B habit of ascomata on twig C transverse section of ascoma D longitudinal section through ascoma E asci and ascospores F ascus G ascospores H colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A); 500 μm (B–D); 10 μm (E–G).

Figure 5.

Cytospora leucostoma (Asexual morph) from Juglans mandshurica (CF 2019809). A, B habit of conidiomata on twig C transverse section of conidioma D longitudinal section through conidioma E conidiophores and conidiogenous cells F conidia G colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A); 500 μm (B–D); 10 μm (E, F).

Culture characteristics

Cultures initially are white, growing fast up to 8 cm in diam. after 3 days and entirely covering the 9 cm Petri dish after 4 days, becoming greenish-olivaceous after 7–10 days and grey olivaceous after 30 days. In reverse, the cultures are the same as the upper colour after 7 days, becoming olivaceous grey to iron grey after 30 days. Colonies are ﬂat with a uniform texture; sterile.

Habitat and distribution

Known from several species of Betulaceae, Juglandaceae and Rosaceae around the world.

Materials examined

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°26'47.36"E, 39°56'06.45"N), from branches of Prunus sibirica, 17 Aug 2017, H.Y. Zhu & X.L. Fan, CF 2019814, living culture CFCC 53140; ibid. CF 2019815, living culture CFCC 53141. China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°29'20.52"E, 39°57'47.49"N), from branches of Juglans mandshurica, 17 Aug 2017, H.Y. Zhu & X.L. Fan, CF 2019809, living culture CFCC 53156.

Notes

Cytospora leucostoma is commonly associated with canker disease of Prunoideae of Rosaceae in China (Fan et al. 2020). Morphologically, our taxa are similar to previous descriptions of C. leucostoma in having multi-loculate pycnidial stromata with a conspicuous black conceptacle, producing elongate-allantoid, large conidia (4.5–6 × 1–2 μm) (Teng 1963, Zhuang 2005, Fan et al. 2020). The greenish-yellow of the cultures on PDA medium from Juglans mandshurica is similar to descriptions of those collected from Prunoideae (Fan et al. 2020). Multigene phylogenetic analyses supported the morphological results with high support values (ML/MP/BI = 100/100/1, Fig. 2). By combining morphology and the DNA data, our isolates collected from dead branches of Prunus sibirica and Juglans mandshurica belong to this species. The current study represents a new host record of Juglans mandshurica.

Cytospora pruinopsis C.M. Tian & X.L. Fan, Mycological Progress 14(9): 74 (2015)

Fig. 6

Description

See Yang et al. (2015).

Material examined

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°27'29.37"E, 39°56'47.49"N), from branches of Ulmus pumila, 22 Aug 2017, H.Y. Zhu & X.L. Fan, CF 2019806, living culture CFCC 53153.

Habitat and distribution

Known from Ulmus pumila in Northern China.

Notes

Yang et al. (2015) described Cytospora pruinopsis from cankers of Ulmus pumila in Shannxi Province of China. The strain CFCC 53153 clusters in a well-supported clade with high support value (MP/ML/BI = 100/100/1), based on combined multi-locus gene phylogenetic analyses (Fig. 2). Morphologically, it confirms Cytospora pruinosa in having a single locule and small conidia (2–4 × 1 μm) as per the descriptions of Yang et al. (2015). Phylogenetically, our isolates represent 6/771 nucleotide differences of tef1-α comparing with ex-type strains CFCC 50034 of C. pruinosa. Morphology and sequence data confirmed that our isolates represent this species.

Figure 6.

Cytospora pruinopsis from Ulmus pumila (CF 2019806). A, B habit of conidiomata on twig C transverse section of conidiomata D longitudinal section through conidioma E conidiophores and conidiogenous cells F conidia G colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A); 250 μm (B); 500 μm (C, D); 10 μm (E, F).

Cytospora spiraeicola H.Y. Zhu & X.L. Fan, sp. nov.

MycoBank No: 833821

Fig. 7

Etymology

Named after the host genus on which it was collected, Spiraea.

Holotype

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°28'28.52"E, 39°55'49.42"N), from branches of Spiraea salicifolia, 17 Aug 2017, H.Y. Zhu & X.L. Fan, holotype CF 2019803, ex-type living culture CFCC 53138.

Description

Necrotrophic on branches of Spiraea salicifolia and Tilia nobilis. Sexual morph: Ascostromata immersed in the bark, erumpent through the surface of bark, scattered, with 3–5 perithecia arranged regularly, 660–890 µm in diam. Conceptacle absent. Ectostromatic disc pale grey, usually surrounded by tightly crowded ostiolar necks, quadrangular, 240–350 µm in diam., with 5–8 ostioles arranged regularly per disc. Ostioles numerous, dark grey to black, at the same or above the level as the disc, concentrated, arranged regularly in a disc, 25–40 µm in diam. Perithecia dark grey to black, flask-shaped to spherical, arranged circularly, 210–250 µm in diam. Paraphyses lacking. Asci free, clavate to elongate, obovoid, 26–37 × 7.5–9 (av. = 33 ± 2.5 × 8.3 ± 0.9, n = 10) μm, 8-spored. Ascospores biseriate, elongate-allantoid, thin-walled, hyaline, slightly curved, aseptate, 8.5–12 × 2.5–3.5 (av. = 10 ± 1 × 3 ± 0.3, n = 30) μm. Asexual morph: not observed.

Figure 7.

Cytospora spiraeicola from Spiraea salicifolia (CF 2019803). A, B habit of ascomata on twig C transverse section of ascoma D longitudinal section through ascoma E asci and ascospores F, G ascus H ascospores I colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A, B); 500 μm (C, D); 10 μm (E–H).

Culture characteristics

Cultures are white, growing up to 4 cm in diam. with irregular margin after 3 days, covering the 9 cm Petri dish after 6 days, becoming vinaceous buff to hazel after 7–10 days. In reverse, the cultures are the same as the upper colour after 3 days, becoming isabelline to umber after 7–10 days. Colonies are felty with a heterogeneous texture, lacking aerial mycelium.

Habitat and distribution

Known from Spiraea salicifolia and Tilia nobilis in Mount Dongling, China.

Additional material examined

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°29'20.49"E, 39°57'47.43"N), from branches of Tilia nobilis, 17 Aug 2017, H.Y. Zhu & X.L. Fan, CF 2019804, living culture CFCC 53139.

Notes

Cytospora spiraeicola is associated with canker disease of Spiraea salicifolia and Tilia nobilis in China, with characteristics similar to Cytospora elaeagnicola and C. spiraeae in phylogram (Fig. 2). Morphologically, it differs from C. spiraeae by the smaller perithecia (210–250 vs. 270–400 µm in diam.) and longer ascospores (8.5–12 × 2.5–3.5 vs. 7–8 × 2–2.5 µm) (Zhu et al. 2018a). Phylogenetically, C. spiraeicola (CFCC 53138) differs from C. elaeagnicola (CFCC 52882) by ITS (8/665), rpb2 (44/730), tef1-α (75/771) and tub2 (42/624) and C. spiraeae (CFCC 50049) by ITS (4/665), rpb2 (38/730), tef1-α (63/771) and tub2 (44/624) (Zhu et al. 2018a, Zhang et al. 2019). Therefore, we describe it as a novel species.

Discussion

In the present study, seven specimens were collected from symptomatic branches and twigs associated with canker disease. Four Cytospora species were isolated from six tree hosts of Betulaceae, Juglandaceae, Rosaceae, Tiliaceae and Ulmaceae, which include two known species (Cytospora leucostoma and C. pruinopsis) and two novel species (C. coryli and C. spiraeicola). This study represents an investigation of Cytospora species associated with canker disease in Mount Dongling of China and included a comprehensive analysis of DNA sequence data to compare the novelties with known Cytospora species.

In a previous study, Zhu et al. (2018a) described Cytospora spiraeae from Spiraea salicifolia in Gansu Province of China during an investigation of forest pathogens of three hosts. Compared to the new species Cytospora spiraeicola, C. spiraeae has larger perithecia (270–400 vs. 210–250 µm) in diam. and shorter ascospores (7–8 × 2.5–3.5 × 8.5–12 vs. 2–2.5 µm). These morphological deviations are in line with the combined phylogenetic analyses which resolved C. spiraeicola as a unique lineage, highly supported. Besides this, the only strain of C. coryli, closely related to C. euonymicola and C. gigalocus, was distinguished by its different size of multiple locules and conidia (Fan et al. 2015a, 2020).

This study focused on Cytospora species in Mount Dongling of Beijing (China), which is considered as an attractive location with a high richness of fungal species (Guo et al. 2008, Zhu et al. 2018b, 2019). We hope that the descriptions and molecular data of Cytospora in this study could provide a resource for future studies in this genus and lay the foundation for the future canker disease caused by Cytospora species.

Acknowledgements

This study is financed by the Fundamental Research Funds for the Central Universities (2019ZY23), the National Natural Science Foundation of China (31670647) and the College Student Research and Career-creation Program of Beijing (S201810022005). All authors want to thank the Experimental Teaching Centre (College of Forestry, Beijing Forestry University) for providing installed scientific equipment during the whole process.

References

Adams GC, Roux J, Wingfield MJ (2006) Cytospora species (Ascomycota, Diaporthales, Valsaceae), introduced and native pathogens of trees in South Africa. Australasian Plant Pathology 35: 521–548. https://doi.org/10.1071/AP06058

Adams GC, Roux J, Wingfield MJ, Common R (2005) Phylogenetic relationships and morphology of Cytospora species and related teleomorphs (Ascomycota, Diaporthales, Valsaceae) from Eucalyptus. Studies in Mycology 52: 1–144.

Alves A, Crous PW, Correia A, Phillips AJL (2008) Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae. Fungal Diversity 28: 1–13.

Barr ME (1978) The Diaporthales in North America with emphasis on Gnomonia and its segregates. Mycologia Memoir 7: 1–232.

Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553–556. https://doi.org/10.1080/00275514.1999.12061051

Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12: 13–15. https://doi.org/10.2307/2419362

Ehrenberg CG (1818) Sylvae Mycologicae Berolinenses. Formis Theophili Bruschcke, Berlin, Germany.

Fan XL, Bezerra JDP, Tian CM, Crous PW (2020) Cytospora (Diaporthales) in China. Persoonia 45: 1–45. https://doi.org/10.3767/persoonia.2020.45.01

Fan XL, Hyde KD, Liu M, Liang YM, Tian CM (2015a) Cytospora species associated with walnut canker disease in China, with description of a new species C. gigalocus. Fungal Biology 119: 310–319. https://doi.org/10.1016/j.funbio.2014.12.011

Fan XL, Hyde KD, Yang Q, Liang YM, Ma R, Tian CM (2015b) Cytospora species associated with canker disease of three anti-desertification plants in northwestern China. Phytotaxa 197: 227–244. https://doi.org/10.11646/phytotaxa.197.4.1

Fan XL, Liang YM, Ma R, Tian CM (2014a) Morphological and phylogenetic studies of Cytospora (Valsaceae, Diaporthales) isolates from Chinese scholar tree, with description of a new species. Mycoscience 55: 252–259. https://doi.org/10.1016/j.myc.2013.10.001

Fan XL, Tian CM, Yang Q, Liang YM, You CJ, Zhang YB (2014b) Cytospora from Salix in northern China. Mycotaxon 129: 303–315. https://doi.org/10.5248/129.303

Fries EM (1823) Systema mycologicum. Vol. 2, Greifswald, Germany.

Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61: 1323–1330. https://doi.org/10.1128/AEM.61.4.1323-1330.1995

Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel HO (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology 59: 307–321. https://doi.org/10.1093/sysbio/syq010

Guo LD, Huang GR, Wang Y (2008) Seasonal and Tissue Age Influences on Endophytic Fungi of Pinus tabulaeformis (Pinaceae) in the Dongling Mountains, Beijing. Journal of Integrative Plant Biology 50: 997–1003. https://doi.org/10.1111/j.1744-7909.2008.00394.x

Gvritishvili MN (1982) The fungal genus Cytospora in the USSR. Izdatelstv Sabchota Sakarstvelo, Tbilici, Russia.

Hillis DM, Bull JJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42: 182–192. https://doi.org/10.1093/sysbio/42.2.182

Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular biology and evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010

Kirk PM, Canoon PF, Minter DW, Stalpers JA (2008) Ainsworth & Bisby’s dictionary of the Fungi, 10^rd edn, Wallingford, UK. https://doi.org/10.1079/9780851998268.0000

Kobayashi T (1970) Taxonomic studies of Japanese Diaporthaceae with special reference to their life-histories. Tokyo, Japan.

Lawrence DP, Travadon R, Pouzoulet J, Rolshausen PE, Wilcox WF, Baumgartner K (2016) Characterization of Cytospora isolates from wood cankers of declining grapevine in North America, with the descriptions of two new Cytospora species. Plant Pathology 5: 713–725. https://doi.org/10.1111/ppa.12621

Lawrence DP, Holland LA, Nouri MT, Travadon R, Trouillas FP (2018) Molecular phylogeny of Cytospora species associated with canker diseases of fruit and nut crops in California, with the descriptions of ten new species and one new combination. IMA Fungus 9: 333–369. https://doi.org/10.5598/imafungus.2018.09.02.07

Liu YJ, Whelen S, Hall BD (1999) Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 16: 1799–1808. https://doi.org/10.1093/oxfordjournals.molbev.a026092

Ma KP, Guo XM, Yu SL (1995) On the characteristics of the flora of Mount Dongling area and its relationship with a number of other mountainous floras in China. Bulletin Botanical Research 15: 501–515.

Norphanphoun C, Doilom M, Daranagama DA, Phookamsak R, Wen TC, Bulgakov TS, Hyde KD (2017) Revisiting the genus Cytospora and allied species. Mycosphere 8: 51–97. https://doi.org/10.5943/mycosphere/8/1/7

Pan M, Zhu HY, Tian CM, Alvarez LV, Fan XL (2018) Cytospora piceae sp. nov. associated with canker disease of Picea crassifolia in China. Phytotaxa 383: 181–196. https://doi.org/10.11646/phytotaxa.383.2.4

Posada D, Crandall KA (1998) Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817–818. https://doi.org/10.1093/bioinformatics/14.9.817

Rannala B, Yang Z (1996) Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. Journal of Molecular Evolution 43: 304–311. https://doi.org/10.1007/BF02338839

Rayner RW (1970) A Mycological Colour Chart. Commonwealth Mycological Institute, Kew, UK.

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. https://doi.org/10.1093/bioinformatics/btg180

Rossman AY, Adams GC, Cannon PF, Castlebury LA, Crous PW, Gryzenhout M, Jaklitsch WM, Mejia LC, Stoykov D, Udayanga D, Voglmayr H, Walker M (2015) Recommendations of generic names in Diaporthales competing for protection or use. IMA Fungus 6: 145–154. https://doi.org/10.5598/imafungus.2015.06.01.09

Saccardo PA (1884) Sylloge Fungorum III. Typis Seminarii, Italy.

Stamatakis A (2006) RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690. https://doi.org/10.1093/bioinformatics/btl446

Sinclair WA, Lyon HH, Johnson WT (1987) Diseases of Trees and Shrubs. Coinstock Publishing Associates, Cornell University Press, USA.

Spielman LJ (1983) Taxonomy and biology of Valsa species on hardwoods in North America, with special reference to species on maples, Cornell University, New York, USA.

Spielman LJ (1985) A monograph of Valsa on hardwoods in North America. Canadian Journal of Botany 63: 1355–1378. https://doi.org/10.1139/b85-190

Sun X, Guo LD, Hyde KD (2011) Community composition of endophytic fungi in Acer truncatum and their role in decomposition. Fungal diversity 47: 85–95. https://doi.org/10.1007/s13225-010-0086-5

Sutton BC (1980) The Coelomycetes: Fungi Imperfecti with pycnidia, acervuli and stromata. Kew: Commonwealth Mycological Institute.

Swofford DL (2003) PAUP*: Phylogenetic Analysis Using Parsimony, * and Other Methods, Version 4.0b10, Sinauer Associates, Sunderland.

Tai FL (1979) Sylloge Fungorum Sinicorum. Science Press. Beijing, China.

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729. https://doi.org/10.1093/molbev/mst197

Teng SC (1963) Fungi of China. Science Press. Beijing, China.

Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246. https://doi.org/10.1128/JB.172.8.4238-4246.1990

Wei JC (1979) Identification of Fungus Handbook. Science Press. Shanghai, China.

White TJ, Bruns T, Lee S, Taylor J (1990) Amplifcation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: a guide to methods and applications 18: 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1

Wijayawardene NN, Hyde KD, Lumbsch HT, Liu JK, Maharachchikumbura SSN, Ekanayaka AH, Tian Q, Phookamsak R (2018) Outline of Ascomycota: 2017. Fungal Diversity 88: 167–263. https://doi.org/10.1007/s13225-018-0394-8

Yang Q, Fan XL, Crous PW, Liang YM, Tian CM (2015) Cytospora from Ulmus pumila in Northern china. Mycological Progress 14: 1–12. https://doi.org/10.1007/s11557-015-1096-1

Zhu HY, Pan M, Bonthond G, Tian CM, Fan XL (2019) Diaporthalean fungi associated with canker and dieback of trees from Mount Dongling in Beijing, China. MycoKeys 59: 67–94. https://doi.org/10.3897/mycokeys.59.38055

Zhu HY, Tian CM, Fan XL (2018a) Multigene phylogeny and morphology reveal Cytospora spiraeae sp. nov. (Diaporthales, Ascomycota) in China. Phytotaxa 338: 49–62. https://doi.org/10.11646/phytotaxa.338.1.4

Zhu HY, Tian CM, Fan XL (2018b) Studies of botryosphaerialean fungi associated with canker and dieback of tree hosts in Dongling Mountain of China. Phytotaxa 348: 63–76. https://doi.org/10.11646/phytotaxa.348.2.1

Zhang LX, Alvarez LV, Bonthond G, Tian CM, Fan XL (2019) Cytospora elaeagnicola sp. nov. associated with narrow-leaved oleaster canker disease in China. Mycobiology 47: 319–328. https://doi.org/10.1080/12298093.2019.1633902

Zhuang WY (2005) Fungi of Northwestern China. Mycotaxon, Ltd. New York, USA.