Research Article
Print
Research Article
Lecanicillium cauligalbarum sp. nov. (Cordycipitaceae, Hypocreales), a novel fungus isolated from a stemborer in the Yao Ren National Forest Mountain Park, Guizhou
expand article infoYe-Ming Zhou‡, Jun-Rui Zhi‡, Mao Ye‡, Zhi-Yuan Zhang‡, Wen-Bo Yue‡, Xiao Zou‡
‡ Guizhou University, Guiyang, China

Corresponding author: Jun-Rui Zhi ( jrzhi@gzu.edu.cn )

Corresponding author: Xiao Zou ( xzou@gzu.edu.cn )

Academic editor: Thorsten Lumbsch
© 2018 Ye-Ming Zhou, Jun-Rui Zhi, Mao Ye, Zhi-Yuan Zhang, Wen-Bo Yue, Xiao Zou.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Zhou Y-M, Zhi J-R, Ye M, Zhang Z-Y, Yue W-B, Zou X (2018) Lecanicillium cauligalbarum sp. nov. (Cordycipitaceae, Hypocreales), a novel fungus isolated from a stemborer in the Yao Ren National Forest Mountain Park, Guizhou. MycoKeys 43: 59-74. https://doi.org/10.3897/mycokeys.43.30203
Open Access

Abstract

A new species of entomopathogenic fungi, Lecanicillium cauligalbarum, was discovered from a survey of invertebrate-associated fungi in the Yao Ren National Forest Mountain Park in China. The synnemata of this species emerged from the corpse of a stemborer (Lepidoptera), which was hidden amongst pieces of wood on the forest floor. It differs from morphologically similar Lecanicillium species mainly in its short conidiogenous cells and ellipsoid to ovoid and aseptate conidia. Phylogenetic analysis of a combined data set comprising ITS, SSU, LSU, TEF, RPB1 and RPB2 sequence data supported the inclusion of L. cauligalbarum in the Lecanicillium genus and its recognition as a distinct species.

Keywords

Entomopathogenic fungi, Lecanicillium , multiple genes, phylogeny, new species

Introduction

The entomopathogenic fungal genus Lecanicillium W. Gams & Zare belongs to Ophiocordycipitaceae. It is typified by Lecanicillium lecanii with Torrubiella confragosa as the sexual morph (Zare and Gams 2001, Wijayawardene et al. 2017). Lecanicillium lecaniiwas first named as Cephalosporium lecanii Zimm. by Zimmermann in 1898. Viegas incorporated the species in Verticillium Nees in 1939 (Gams and Zare 2001). The genus Verticillium has a wide host range, including arthropods, nematodes, plants and fungi (Goettel et al. 2008). Zare and Gams (2001) recircumscribed the genus following analyses of morphological data and sequence data for the internal transcribed spacer (ITS) rDNA region (which comprises the ITS1 spacer, 5.8S coding region and ITS2 spacer). All insect pathogens formerly included in Verticillium were reclassified in a newly established genus, Lecanicillium. In more recent studies, a multilocus nuclear DNA dataset combining sequence data for the nuclear small subunit rDNA (SSU), nuclear large subunit rDNA (LSU), translation elongation factor 1α (TEF), DNA-dependent RNA polymerase II largest subunit (RPB1) and DNA-dependent RNA polymerase II second largest subunit (RPB2) genes suggests that the genus Lecanicillium is paraphyletic (Sung et al. 2007). Phylogenetic analysis of ITS sequence data also supports this conclusion (Sukarno et al. 2009). Kepler et al. (2017) revisited the taxonomic affinities of the Cordycipitaceae (Hypocreales) and proposed that Lecanicillium should be rejected because L. lecanii is included within the Akanthomyces clade and the name Akanthomyces Lebert has nomenclatural priority over Lecanicillium (Kepler et al. 2017). However, Kepler et al. (2017) transferred to Akanthomyces only several species for which sufficient information was available. The phylogenetic affinities of the majority of species in the original circumscription of Lecanicillium remain uncertain. Given that there remain unresolved phylogenetic and taxonomic matters concerning Lecanicillium, Huang et al. (2018) and Crous et al. (2018) chose to describe new taxa in Lecanicillium to avoid creating further confusion in the taxonomy (Crous et al. 2018; Huang et al. 2018).

Presently, 29 Lecanicillium species have been formally described and are listed in the Index Fungorum (http://www.indexfungorum.org). Zare and Gams (2001) recognised 14 Lecanicillium species based primarily on morphology and ITS sequence data (Zare and Gams 2001). Subsequently, an additional five new Lecanicillium species, based on ITS sequence data, were described (Kope and Leal 2006, Sukarno et al. 2009, Kaifuchi et al. 2013). In order to add more sequence information with ITS, Zare and Gams (2008) reassessed the genus Verticillium and transferred four species to Lecanicillium based on ITS and SSU sequence data (Zare and Gams 2008). Except for the SSU and ITS gene, more and more researchers have labelled the Lecanicillium genus by TEF gene. Based on this, two new Lecanicillium species were confirmed based on combined with ITS and TEF sequence data (Crous et al. 2018). With combined multigene identification of species gradually becoming the convention, two new Lecanicillium species were identified based on multilocus (TEF, RPB1, RPB2, LSU and SSU) sequence data (Park et al. 2016, Chen et al. 2017). Lecanicillium sabanense was identified based on phylogenetic analysis of combined multilocus and ITS sequences (Chiriví-Salomón et al. 2015). Lecanicillium subprimulinum was identified based on combined analysis of LSU, SSU, TEF and ITS sequence data (Huang et al. 2018).

We carried out a survey of invertebrate-associated fungi in the Yao Ren National Forest Mountain Park near Sandu county in Guizhou province, China. A parasitic fungus was found on a stemborer (Lepidoptera) hiding amongst pieces of wood. Attempting to identify the fungus, we determined it to be a member of Lecanicillium but its morphological traits and gene sequences did not correspond with those of any known Lecanicillium species. On the basis of its morphology and molecular phylogenetic analysis of multilocus nuclear genes (TEF, RPB1, RPB2, LSU and SSU) and ITS sequence data, this fungus was suggested to be an unnamed species of Lecanicillium and is here described and named Lecanicillium cauligalbarum sp. nov.

Materials and methods

Specimen collection and fungus isolation

The specimen was collected from Yao Ren National Forest Mountain Park, Sandu county, Guizhou, China (107°53', 107°58'E; 24°54', 25°59'N, approximately 560–1365 m above sea level), in September 2015 by Yeming Zhou and Xiao Zou. The synnemata of this species emerged from a dead stemborer (Lepidoptera) hidden amongst pieces of wood on the forest floor. The specimen GZUIFR–2015ZHJ and two isolated strains of the fungal asexual stage, GZUIFRZHJ01 and GZUIFRZHJ02, were deposited at the Institute of Fungal Resources of Guizhou University (GZUIFR). The fungal strains were isolated on potato dextrose agar (PDA) medium; one strain was isolated from part of the body and the second strain was isolated from the synnemata.

Strain culture and identification

The isolated strains were inoculated on PDA at 25 °C for 14 d under 12-h light/12-h dark conditions. The fresh hyphae were observed with an optical microscope (OM, BK5000, OPTEC, USA) following pretreatment with lactophenol cotton blue solution or normal saline.

DNA extraction, PCR amplification and sequencing

Genomic DNA was extracted using a previously described method (Chiriví-Salomón et al. 2015, Zou et al. 2016). The primers used for PCR amplification of the ITS region, SSU, LSU, TEF, RPB1 and RPB2 are listed in Table 1. The PCR reaction conditions employed for each genetic region followed those used in the references listed in Table 1.

To conduct phylogenetic analysis of the sequences obtained, sequences for selected taxa based on recent phylogenetic studies of Lecanicillium (Chen et al. 2017, Huang et al. 2018) and Cordycipitaceae (Sung et al. 2007, Kepler et al. 2017, Mongkolsamrit et al. 2018) were downloaded from the National Center for Biotechnology Information GenBank database (https://www.ncbi.nlm.nih.gov/genbank/). A total of 79 accessions of Cordycipitaceae were selected for this study. The sequences used in the study are listed in Table 2.

Table 1.
Download as
CSV
XLSX

Primer information and provenance in this study.

Gene Primer Provenance
ITS F: 5’-TCCGTAGGTGAACCTGCGG-3’ White et al. 1990
R: 5’-TCCTCCGCTTATTGATATGC-3’
SSU F: GTAGTCATATGCTTGTCTC White et al. 1990
R: CTTCCGTCAATTCCTTTAAG
LSU F: GTTTCCGTAGGTGAACCTGC Curran et al. 1994
R: ATATGCTTAAGTTCAGCGGGT
TEF F: 5’-GCCCCCGGCCATCGTGACTTCAT-3’ van den Brink et al. 2011
R: 5’-ATGACACCGACAGCGACGGTCTG-3’
RPB1 F: 5’-CCWGGYTTYATCAAGAARGT-3’ Castlebury et al. 2004
R: 5’-CAYCCWGGYTTYATCAAGAA-3’
RPB2 F: 5’-GACGACCGTG ATCACTTTGG-3’ van den Brink et al. 2011
R: 5’-CCCATGGCCTGTTTGCCCAT-3’
Table 2.
Download as
CSV
XLSX

Specimen information and GenBank accession numbers used in this study.

Species Voucher Information ITS SSU LSU TEF RPB1 RPB2
Akanthomyces waltergamsii TBRC 7250 MF140749 MF140715 MF140835
A. waltergamsii TBRC 7251 MF140747 MF140713 MF140833 MF140781 MF140805
A. sulphureus TBRC 7248 MF140758 MF140722 MF140843 MF140787 MF140812
TBRC 7249 MF140757 MF140721 MF140842 MF140786 MF140734
A. thailandicus TBRC 7246 MF140755 MF140719 MF140840 MF140810
TBRC 7245 MF140754 MF140839 MF140809
A. kanyawimiae TBRC 7242 MF140751 MF140718 MF140838 MF140784 MF140808
TBRC 7244 MF140752 MF140716 MF140836
A. aculeatus HUA 186145 MF416572 MF416520 MF416465
A. pistillariaeformis HUA 186131 MF416573 MF416521 MF416466
A. coccidioperitheciatus NHJ 6709 JN049865 EU369110 EU369042 EU369025 EU369067 EU369086
A. aculeatus TS 772 KC519371 KC519368 KC519370 KC519366
A. tuberculatus BCC16819 MF416600 MF416546 MF416490 MF416647 MF416490
Ascopolyporus villosus ARSEF 6355 AY886544 DQ118750 DQ127241
Asc. polychrous P.C. 546 DQ118737 DQ118745 DQ127236
Beauveria bassiana ARSEF 1564 HQ880761 HQ880974 HQ880833 HQ880905
Bea. brongniartii BCC 16585 JN049867 JF415951 JF415967 JF416009 JN049885 JF415991
Blackwellomyces cardinalis OSC 93610 JN049843 AY184974 AY184963 EF469059 EF469088 EF469106
Bla. cardinalis OSC 93609 AY184973 AY184962 DQ522325 DQ522370 DQ522422
Bla. pseudomilitaris NBRC 101409 JN943305 JN941748 JN941393 JN992482
NBRC 101410 JN943307 JN941747 JN941394 JN992481
Gibellula longispora NHJ 12014 EU369098 EU369017 EU369055 EU369075
Gibellula sp. NHJ 7859 EU369107 EU369064 EU369085
NHJ 10788 EU369101 EU369036 EU369019 EU369058 EU369078
NHJ 5401 EU369102 EU369059 EU369079
G. ratticaudata ARSEF 1915 JN049837 DQ522562 DQ518777 DQ522360 DQ522408 DQ522467
Hevansia nelumboides BCC 41864 JN201871 JN201863 JN201873 JN201867
Hev. novoguineensis NHJ 11923 EU369095 EU369032 EU369013 EU369052 EU369072
Hev. arachnophila NHJ 10469 EU369090 EU369031 EU369008 EU369047
Hev. cinerea NHJ 3510 EU369091 EU369009 EU369048 EU369070
Lecanicillium acerosum CBS418.81 EF641893 KM283762 KM283786 KM283810 KM283832 KM283852
L. antillanum CBS350.85 AJ292392 AF339585 AF339536 DQ522350 DQ522396 DQ522450
L. aphanocladii CBS797.84 KM283763 KM283787 KM283811 KM283833 KM283853
L. aranearum CBS726.73a AJ292464 AF339586 AF339537 EF468781 EF468887 EF468934
L. araneicola BTCC-F35 AB378506
L. araneogenum GZU1031Lea KX845705 KX845703 KX845697 KX845699 KX845701
L. attenuatum CBS402.78 AJ292434 AF339614 AF339565 EF468782 EF468888 EF468935
KACC42493 KM283756 KM283780 KM283804 KM283826 KM283846
L. cauligalbarum GZUIFRZHJ01 MH730663 MH730665 MH730667 MH801920 MH801922 MH801924
GZUIFRZHJ02 MH730664 MH730666 MH730668 MH801921 MH801923 MH801925
L. dimorphum CBS345.37 KM283764 KM283788 KM283812 KM283834 KM283854
L. flavidum CBS300.70D EF641877 KM283765 KM283789 KM283813 KM283855
L. fungicola var. aleophilum CBS357.80 NR_111064 KM283767 KM283791 KM283815 KM283835 KM283856
L. fungicola var. fungicola CBS992.69 NR_119653 KM283768 KM283792 KM283816 KM283857
L. fusisporum CBS164.70 AJ292428 KM283769 KM283793 KM283817 KM283836 KM283858
L. kalimantanense BTCC-F23 AB360356
L. lecanii CBS101247 JN049836 KM283770 KM283794 DQ522359 KM283837 KM283859
CBS102067 KM283771 KM283795 KM283818 KM283838 KM283860
L. longisporum CBS102072 KM283772 KM283796 KM283819 KM283839 KM283861
CBS126.27 KM283773 KM283797 KM283820 KM283840 KM283862
L. muscarium CBS143.62 KM283774 KM283798 KM283821 KM283841 KM283863
L. nodulosum IMI 338014R EF513012 EF513075
L. pissodis CBS118231 KM283775 KM283799 KM283822 KM283842 KM283864
L. primulinum JCM 18525 AB712266 AB712263
JCM 18526 AB712267 AB712264
L. psalliotae CBS532.81 JN049846 AF339609 AF339560 EF469067 EF469096 EF469112
CBS101270 EF469128 EF469081 EF469066 EF469095 EF469113
CBS363.86 AF339608 AF339559 EF468784 EF468890
L. restrictum CCF5252 LT548279 LT626943
L. sabanense JCHA5 KC633232 KC633251 KC875225 KC633266 KC633249
L. saksenae IMI 179841 AJ292432
L. subprimulinum HKAS99548 MG585314 MG585316 MG585315 MG585317
HKAS99549 MG585318 MG585320 MG585319 MG585321
L. testudineum UBOCC-A112180 LT992874 LT992868
UBOCC-A116026 LT992871 LT992867
L. tenuipes CBS309.85 JN036556 KM283778 KM283802 DQ522341 KM283844 KM283866
L. uredinophilum KACC44082 KM283758 KM283782 KM283806 KM283828 KM283848
KACC47756 KM283759 KM283783 KM283807 KM283829 KM283849
L. wallacei CBS101237 EF641891 AY184978 AY184967 EF469073 EF469102 EF469119
Samsoniella inthanonensis TBRC 7915 MF140761 MF140725 MF140849 MF140790 MF140815
Sam. inthanonensis TBRC 7916 MF140760 MF140724 MF140848 MF140789 MF140814
Sam. aurantia TBRC 7271 MF140764 MF140728 MF140846 MF140791 MF140818
TBRC 7272 MF140763 MF140727 MF140845 MF140817
Sam. alboaurantium CBS 240.32 AY624178 JF415958 JF415979 JF416019 JN049895 JF415999
CBS 262.58 MH857775 MH869308 JQ425685 MF416654 MF416448
Simplicillium lamellicola CBS 116.25 AJ292393 AF339601 AF339552 DQ522356 DQ522404 DQ522462
Sim. lanosoniveum CBS 704.86 AJ292396 AF339602 AF339553 DQ522358 DQ522406 DQ522464
CBS 101267 AJ292395 AF339603 AF339554 DQ522357 DQ522405 DQ522463
Sim. obclavatum CBS 311.74 AF339567 AF339517 EF468798

Sequence alignment and phylogenetic analyses

The DNA sequences used in this study were edited using the LASERGENE software (version 6.0; DNASTAR, Madison, WI, USA). Multiple sequence alignments for TEF, RPB1 and RPB2 were performed in MAFFT (Katoh and Standley 2013) with the default settings. Multiple sequence alignments for ITS, LSU and SSU were conducted using MUSCLE algorithm (Edgar 2004) from MEGA 6 (Tamura et al. 2013). The sequences were edited manually. A multiple alignment of the combined partial ITS+SSU+LSU+TEF+RPB1+RPB2 sequences were assembled with MEGA 6 (Tamura et al. 2013) and SEQUENCEMATRIX 1.7.8 (Vaidya et al. 2011). The command ‘hompart’ in PAUP* 4.0b10 was used for assessment of concordance amongst the genes and the ITS region (Swofford 2001). Bayesian inference (BI) was performed using MRBAYES 3.2 (Ronquist et al. 2012) and maximum likelihood (ML) analysis was performed using RAxML (Alexandros 2014) to analyse the combined data which were divided into twelve separate partitions (Kepler et al. 2017; Mongkolsamrit et al. 2018). Two maximum likelihood (ML) analysis and Bayesian inference (BI) analysis were performed. The first analysis was performed as reported by Huang et al. (2018), using the Simplicillium lanosoniveum as the outgroup. The second analysis was performed with Akanthomyces, Samsoniella, Blackwellomyces, Hevansia, Simplicillium, all the lecanicillium and use of Beauveria as outgroup (Mongkolsamrit et al. 2018). Nucleotide substitution models were determined by MrModeltest 2.3 (Nylander 2004). For BI, 10 000 000 generations were performed with one tree selected every 500th generation and the GTR+I+G evolutionary model was used. For ML, the model GTRGAMMA was used and a bootstrap analysis with 500 replicates was performed to assess statistical support for the tree topology. Phylogenetic trees were viewed with TREEGRAPH.

Results

Sequencing and phylogenetic analysis

The first sequence dataset consisted of 3793 bases, including inserted gaps (ITS: 506 bp; SSU: 579 bp; LSU: 490 bp; TEF: 772 bp; RPB1: 561 bp; RPB2: 885 bp). The second sequence dataset consisted of 2944 bases, including inserted gaps (ITS: 526 bp; SSU: 456 bp; LSU: 409 bp; TEF: 386 bp; RPB1: 500 bp; RPB2: 667 bp). No significant differences in topology were observed between the BI and ML phylogenies. The first tree formed with almost all the Lecanicillium species (only Lecanicillium evansii could not be found in the NCBI) and one Simplicillium species (Simplicillium lanosoniveum). The phylogeny was resolved into 4 clades obviously. Lecanicillium cauligalbarum formed an independent branch in a polytomy together with a clade containing L. flavidum and L. fungicola and a major clade consisting of 27 accessions. The L. cauligalbarum lineage received maximum statistical support (BI posterior probabilities 1, ML boostrap 100%), which still remains unnamed (Figure 1). In the second tree, the four Lecanicillium clades were also be supported. Lecanicillium cauligalbarum formed an independent branch in a polytomy together with a clade containing Blackwellomyces cardinalis and Blackwellomyces pseudomilitaris (BI posterior probabilities 1, ML boostrap 85%) (Figure 2).

Figure 1. 

Phylogenetic analysis of the isolated strains GZUIFRZHJ01 and GZUIFRZHJ02 and related species derived from a combined dataset of partial ITS+SSU+LSU+TEF+RPB1+RPB2 sequences. Statistical support values (≥ 0.5/50%) are shown at the nodes for BI posterior probabilities/ML boostrap support.

Figure 2. 

Phylogenetic relationships of the form genus Lecanicillium, Akanthomyces, Samsoniella, Blackwellomyces, Hevansia and related genera in the Cordycipitaceae. Statistical support values (≥ 0.5/50%) are shown at the nodes for BI posterior probabilities/ML boostrap support.

Taxonomy

Lecanicillium cauligalbarum X. Zou, J.R. Zhi & Y.M. Zhou, sp. nov.

MycoBank No: 827984
Figure 3

Diagnosis

Characterised by phialides gradually tapering towards the apex, solitary or 2–3 whorls, 9–14.4 × 1.4–1.8 µm. Conidia cylindric, aseptate, 3.6–6.3 × 0.9–1.8 μm.

Type

CHINA, Guizhou Province, Sandu county (107°53', 107°58'E; 24°54', 25°59'N, approximately 560–1365 m above sea level), September 2015, Yeming Zhou & Xiao Zou. Sequences from isolated strains (GZUIFRZHJ01 and GZUIFRZHJ02) have been deposited in GenBank (accession numbers to be provided).

Description

Colony on PDA 15 mm in diameter after 7 days, 33 mm in diameter after 14 days at 25 °C, colony circular, white, cottony, umbonate, with radiating surface texture from above, with clear radial crack and primrose-yellow from reverse. Mycelium 0.9–1.8 μm wide, hyaline, smooth, septated, branched. Conidiophores usually arising from aerial hyphae, sporulate abundant. Phialides gradually tapering towards the apex, solitary or 2–3 whorls, 9–14.4 × 1.4–1.8 µm. Conidia cylindric, aseptate, 3.6–6.3 × 0.9–1.8 μm. In culture, both phialides and conidia are of similar general shape and size to those found on the host stemborer.

Figure 3. 

Lecanicillium cauligalbarum. a Synnemata emerged from the corpse of a stemborer (Lepidoptera) b Culture plate, showing the front (upper) and the back (lower) of the colony, cultured on PDA medium c–e Phialides solitary or in 2–3 whorls f–g Conidia. Scale bars: 10 mm (b, c, e), 5 μm (d, f, g).

Host

Stemborer (Lepidoptera) hidden amongst wooden sticks.

Habitat and distribution

Hidden amongst pieces of wood in humid forests of southwest China.

Etymology

The epithet ‘cauligalbarum’ refers to the host (stemborer).

Teleomorph

Not known.

Remarks

With regard to phylogenetic relationships, L. cauligalbarum is closely related to the L. fungicola clade and L. fusisporum. The two strains (GZUIFRZHJ01 and GZUIFRZHJ02) formed a distinct lineage. All Lecanicillium species were included in the phylogenetic analysis except for L. evansii for which sequence data could not be located in public databases, although Zare and Gams (2001) published ITS sequences. The morphological features of L. evansii include brownish-cream to brown reverse, phialides solitary or up to 3–4 per node and two types of the conidia, slightly falcate with a pointed end macroconidia 4.5–7.5 × 0.8–1.2 µm and slightly curved microconidia 2.0–3.0 × 0.8–1.2 µm (Zare and Gams 2001). L. evansii is distinct from L. cauligalbarum, which has conidia of 3.6–6.3 × 0.9–1.8 μm and 9–14.4 × 1.4–1.8 µm phialides.

In morphology L. cauligalbarumis is similar to L. aphanocladii, L. attenuatum and L. nodulosum with regard to the short conidiogenous cell (Table 3). However, L. cauligalbarum is distinguished by the pattern of spore production and the frequency of the wheel structure.

Table 3.
Download as
CSV
XLSX

Morphological comparison among Lecanicillium cauligalbarum and the other related species.

Species Colonies Conidiogenous cell Conidia Refrence
Lecanicillium acerosum White, yellow reverse Solitary or up to 4–5, 30–32×1.8–2.2 μm Macroconidia fusiform, straight to slightly falcate, 15–20×1.6–2.2 μm, microconidia fusiform, 4.5–7.5×1.0–1.5 μm Zare and Gams 2001
L. antillanum White, cream-coloured reverse Solitary or up to 6, subulate, 18–31×1 μm (at the top) Macroconidia fusiform, 11–18×0.8–1.5 μm, microconidia ellipsoidal, 3–4×0.8–1.2 μm Zare and Gams 2001
L. aphanocladii White, red, reddish-white to cream-coloured reverse Solitary, in pairs, verticillate, flask-shaped in the beginning, tapering into a thread-like neck, 4.5–11×1.0–1.8 μm Solitary, oval to sub-globose, 2.7–4×1.5–2.2 μm Zare and Gams 2001
L. aranearum White, yellowish-cream reverse Tapering towards the apex, 20–30×1.2–1.5 μm Straight or curved, usually asymmetrically narrowed or subacute at the ends, 5–8×0.7–1.5 μm Zare and Gams 2001
L. araneicola White, creamy-white reverse Solitary or in whorls of 2–4, slender, tapering toward the tip, (14-)19–31.5×1–2 μm Macroconidia slightly curved to nearly straight, (7.5-)8.5–12(-14)×1.5–2 μm, microconidia allantoid to ellipsoidal with round ends, 3–5×1–2 μm Sukarno et al. 2009
L. araneogenum White to light grey, light yellow reverse Produced in whorls of (1-)2–6(-8), 30–64×1.1–3.2 μm Forming mostly globose heads, cylindric, 3.2–8.6×1.3–1.6 μm Chen et al. 2017
L. attenuatum White, yellowish-white reverse Up to 3–5 per node, 9–15.5×1–2 μm Cylindrical with attenuate base, 4.5–6.5×1.5–2.0 μm Zare and Gams 2001
L. cauligalbarum White, primrose-yellow reverse Solitary or 2–3 whorls, 9–14.4×1.4–1.8 μm Cylindrical, 3.6–6.3×0.9–1.8 μm This work
L. dimorphum White, cream to brownish-cream, red reverse Two kinds: solitary or 4–5 whorls, 14–30×1.0–1.5μm; short, 5–12×0.7–1.5 μm Macroconidia falcate with sharply pointed ends, usually evenly curved, 6–11×1.5–2.5μm, microconidia oval to ellipsoidal, 2.5–4.5×1.0–1.5 μm Zare and Gams 2001
L. evansii White, creamy, brownish-cream to brown reverse, Solitary or up to 3–4 per node, 20–45×1–1.2 μm Macroconidia slightly falcate, 4.5–7.5×0.8–1.2μm, microconidia ellipsoidal or curved, 2.0–3.0×0.8–1.2 μm Zare and Gams 2001
L. flavidum Greyish-white to citron-yellow, citron-yellow reverse In whorls, 12–35×1.5–2.5 μm, 0.5–1 μm at the tips Mostly fusiform, long-ellipsoidal to almost cylindrical, slightly sickle-shaped, 4–8×1.5–2 μm Zare and Gams 2008
L. fungicola var. aleophilum White, reverse uncoloured Whorls of 3–10, 15–30×1.5–2.5 μm, 0.5–1.5 μm at the tips Oblong, fusiform, long ellipsoidal to almost cylindrical, irregular size, 4.5–8×1–2.5 μm Zare and Gams 2008
L. fungicola var. fungicola Dirty white, reverse uncoloured Whorls of 3–7, 14–20(-45)×1.5–3μm, 0.5–1 μm at the tip Fusiform, long-ellipsoidal to almost cylindrical, sickle-shaped, very unequal size, 4–9(-12)×1.5–2.5(-3.5) μm Zare and Gams 2008
L. fusisporum White, with red reverse and pigment diffusing Solitary or up to 5, 16–26×1.0–1.5 μm Fusiform, straight and rather broad, 3–5×1.5–2.0 μm Zare and Gams 2001
L. kalimantanense White, creamy-white reverse Solitary or more often in whorls of 2–5, slender, tapering toward the apex, 12.5–36×1–2 μm Acerose to fusoid with pointed ends, slightly curved, of varying size, (3.5-)4.5–12×1–2 μm Sukarno et al. 2009
L. lecanii Yellowish-white, deep yellow reverse Aculeate and strongly tapering, singly or up to 6, 11–20(-30)×1.3–1.8 μm Typically short-ellipsoidal, 2.5–3.5(-4.2)×1–1.5 μm, homogeneous in size and shape Zare and Gams 2001
L. longisporum White to sulphur-yellow, cream-coloured to pale yellow reverse Tapering towards the apex(sub-aculeate), singly or up to 5–6 or on secondary phialides, 20–40×1.2–2.7 μm Produced in globose heads, ellipsoidal to oblong-oval, 5.0–10.5×1.5–2.5 μm Zare and Gams 2001
L. muscarium White, cream-coloured or uncoloured reverse Solitary or up to 6 (less frequent than in L. lecanii), (15-)20–35×1–1.5 μm Produced in globose heads, ellipsoidal to subcylindrical, more irregular in size and shape, (2-)2.5–5.5(-6)×1–1.5(-1.8) μm Zare and Gams 2001
L. nodulosum White, cream-coloured reverse Subulate, up to 6, 10–20×1.5 μm Produced in heads of about 10μm diam., oval, 2.5–4.5×1.2–1.5 μm Zare and Gams 2001
L. pissodis White, ceram to yellow reverse Solitary, up to 3, 16-(18–28)-38×1–2 μm Up to more than 50 formed in globose droplets, cylindrical to oval, very variable in size and shape, 4–9.2×1.6–2.4 μm Kope and Leal 2006
L. primulinum Pale yellow, yellowish-brown reverse, brownish-yellow pigment Solitary or in whorls of 2–5, tapering toward the tip, 20–50(-85)×0.8–1.8 μm Macroconidia ellipsoidal to cylindrical, 5.0–9.5×1.2–2.5 μm, microconidia oval to ellipsoidal, 3.0–4.8×1.0–2.5 μm Kaifuchi et al. 2013
L. psalliotae White and red, reddish-cream to cream-coloured reverse, red to purple pigment Aculeate, solitary or more often 3–4(-6) in whorls on each node, 25–35×1.0–1.5 μm Macroconidia curved, falcated, 5–10×1.2–1.7 μm, microconidia oval or ellipsoidal, 2.7–3.7×1–1.5 μm Zare and Gams 2001
L. restrictum Yellowish-white, reverse yellowish-white to pale yellow Solitary or in whorls of 2–5, tapering toward the tip, (12-)17–30(-36)×0.5–1.5 μm, 0.3–0.5 μm wide on the tip Macroconidia fusiform or slightly falcate, (5-)6–10(-12)×1–1.5 μm, microconidia ovate, ellipsoidal, obovate or fusoid, frequently slightly curved, 2.5–3×1–1.5 μm Crous et al. 2018
L. sabanense Pale yellow to duller yellow, orange reverse Solitary or in whorls of 2–4, 13–19×1.0–2.0 μm, gradually tapering to 0.5–1.0 μm Forming mostly globose heads, 9–20 μm diam, ellipsoidal to ovoid, 3.5–4.5×1.5–2.0 μm Chiriví-Salomón et al. 2015
L. saksenae White, creamy white reverse Solitary or often in whorls of 2–4, slender, tapering towards the apex, 14.5–36×1.0–2.0 μm Macroconidia slightly curved, 6–13×1.5–2 μm, microconidia ellipsoidal to fusoid with round ends, nearly straight to slightly curved, 2.5–5×1.5–2 μm Sukarno et al. 2009
L. subprimulinum Creamy, primrose-yellow reverse Tapering towards apex, discrete, solitary or up to 2–3 per node, 19–32×1.5–3.5 μm Ovoid to ellipsoidal, elongated, straight or slightly curved, 4–15×2–6 μm Huang et al. 2018
L. testudineum White, centrally raised, wrinkled, reverse pale yellow to greyish-yellow Solitary or in whorls of 2–4, tapering toward the tip, (13-)16–45(-53)×0.5–1 μm (exceptionally 80 μm long), 0.5–1 μm wide on the tip Macroconidia fusiform or slightly falcate, 3.5–6(-6.5)×1–1.5 μm, microconidia ovate, ellipsoidal or fusoid, curved to reniform, 2–3.5×1–1.5 μm Crous et al. 2018
L. tenuipes White, reverse uncoloured Arising singly or in scanty whorls, 20–35(-40)×1.2–1.5 μm Microconidia ellipsoidal, straight, 3.0–5.5(-6.5)×1.0–1.5 μm, microconidia fusiform to falcate, 8–17×1.5–1.8 μm Gams et al. 1984; Zare and Gams 2001
L. uredinophilum White to cream coloured, reverse cream coloured Produced singly or in whorls of up to 3–5, 20–60×1–2.5(-3) μm Cylindric, oblong or ellipsoid, 3–9×1.8–3 μm Park et al. 2016
L. wallacei White, cream-coloured to creamish-brown reverse Sollitary or up to 3–4, aculeate, (14-)17–25(29)×0.7–1.2 μm Macroconidia, fusiform to falcate, (7.0-)8.5–10.5(-12.5)×1.0–1.5 μm, microconidia ellipsoidal to slightly falcate, (3.0-)4.0–5.5(-6.5)×0.7–1.2 μm Zare and Gams 2001, 2008

Discussion

The genera Lecanicillium and Simplicillium belong to the Cordycipitaceae (Sung et al. 2007). The two genera are indistinguishable in morphological traits (Sung et al. 2001; Zare and Gams 2001). However, Lecanicillium and Simplicillium are clearly separated in molecular phylogenetic analyses (Kouvelis et al. 2008; Maharachchikumbura et al. 2015; Nonaka et al. 2013). As an insect pathogen, Lecanicillium spp. has potential for development as effective biological control agents against a number of plant diseases, insect pests and plant-parasitic nematodes (Goettel et al. 2008). Fifteen commercial preparations based on Lecanicillium spp. have been developed or are in the process of being developed (Faria and Wraight 2007). Kepler et al. (2017) concluded that Lecanicillium should be incorporated into Akanthomyces and formally transferred a number of Lecanicillium species. However, the compatibility of Lecanicillium was not so good in this study. Species that have been transferred to Akanthomyces were all assembled in the L. lecanii clade in the present study. The remaining species included in the present analyses were divided into multiple clades similar to those retrieved by Kepler et al. (2017). Relationships amongst Lecanicillium species thus appear to be more complicated than expected. Thus, we also prefer to describe the new taxon as a Lecanicillium species, consistent with Huang et al. (2018), owing to the uncertainty in generic boundaries.

In a comparison of all Lecanicillium species included in the present study, we were unable to identify morphological synapomorphies that characterise the phylogenetic groups. However, the species that show a close phylogenetic relationship are more similar in morphology than those that are phylogenetically distant. For example, the L. lecanii clade, which has globose heads with a higher number of conidia, are distinguishable from those clades that usually have one conidium visible at the top of the phialide in the phylogenetic tree presented here. In our phylogeny study, the node connecting L. antillanum and L. tenuipes is the basal node for the major clade. So the relationships of all of the lineages involved may change with more data or a different dataset. Therefore, more species are needed to enrich the phylogenetic study of Lecanicillium spp.

We know that Lecanicillium has a different origin into the Cordycipitaceae. We consider that the ones ‘L. lecanii clade’ in pig.1 form a strong clade inside of Akanthomyces. Maybe all these should be moved to the Akanthomyces including Lecanicillium longisporum. In addition, the elimination of the genus may create more chaos considering the unsolved other clades.

Blackwellomyces Spatafora & Luangsa-ard is diagnosed by the unique characters of the ascospore, which have irregularly spaced septa and do not disarticulate into part-spores at maturity as advised by Kepler et al. (2017). It includes Blackwellomyces cardinalis and Blackwellomyces pseudomilitaris. Asexual morphs have been described as similar to species in Clonostachys, Hirsutella, Isaria and Mariannaea (Hywel-Jones 1994; Sung and Spatafora 2004). Although the new species are close to the Blackwellomyces in the phylogenetic tree, we think they are clearly distinguished from Blackwellomyces by the morphology. We also treat the new species as Lecanicillium considering the small sample and the unknown teleomorph.Thus, based on the present molecular phylogeny, derived from nuclear and ribosomal DNA sequence data, together with morphological evidence, a distinct new Lecanicillium species, L. cauligalbarum, is proposed.

Acknowledgements

This study was supported by the National Science Foundation of China (Project number: 31860507; 31860037), Guizhou international science and technology cooperation base (Project number: G[2016]5802), Major special projects of Guizhou tobacco company (201603; 201712). We thank Robert McKenzie, PhD, from Liwen Bianji, Edanz Group China (www.liwenbianji.cn/ac), for editing the English text of a draft of this manuscript. We also thank Konstanze Bensch, from mycobank web site (www.mycobank.org/), for the suggested epithet of “cauligalbarum” to replace “bristletailum”.

References

  • Castlebury LA, Rossman AY, Sung G-H, Hyten AS, Spatafora JW (2004) Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycological Research 108: 864–872. https://doi.org/10.1017/S0953756204000607
  • Chiriví-Salomón JS, Danies G, Restrepo S, Sanjuan T (2015) Lecanicillium sabanense sp. nov. (Cordycipitaceae) a new fungal entomopathogen of coccids. Phytotaxa 234: 63–74. https://doi.org/10.11646/phytotaxa.234.1.4
  • Crous PW, Wingfield MJ, Burgess TI, Hardy GESJ, Gené J, Guarro J, Baseia IG, García D, Gusmão LFP, Souza-Motta CM, Thangavel R, Adamčík S, Barili A, Barnes CW, Bezerra JDP, Bordallo JJ, Cano-Lira JF, de Oliveira RJV, Ercole E, Hubka V, Iturrieta-González I, Kubátová A, Martín MP, Moreau PA, Morte A, Ordoñez ME, Rodríguez A, Stchigel AM, Vizzini A, Abdollahzadeh J, Abreu VP, Adamčíková K, Albuquerque GMR, Alexandrova AV, Álvarez Duarte E, Armstrong-Cho C, Banniza S, Barbosa RN, Bellanger JM, Bezerra JL, Cabral TS, Caboň M, Caicedo E, Cantillo T, Carnegie AJ, Carmo LT, Castañeda-Ruiz RF, Clement CR, Čmoková A, Conceição LB, Cruz RHSF, Damm U, da Silva BDB, da Silva GA, da Silva RMF, Santiago ALCMdA, de Oliveira LF, de Souza CAF, Déniel F, Dima B, Dong G, Edwards J, Félix CR, Fournier J, Gibertoni TB, Hosaka K, Iturriaga T, Jadan M, Jany JL, Jurjević Ž, Kolařík M, Kušan I, Landell MF, Leite Cordeiro TR, Lima DX, Loizides M, Luo S, Machado AR, Madrid H, Magalhães OMC, Marinho P, Matočec N, Mešić A, Miller AN, Morozova OV, Neves RP, Nonaka K, Nováková A, Oberlies NH, Oliveira-Filho JRC, Oliveira TGL, Papp V, Pereira OL, Perrone G, Peterson SW, Pham THG, Raja HA (2018) Fungal Planet description sheets: 716–784. Persoonia-Molecular Phylogeny and Evolution of Fungi 40: 240–393. https://doi.org/10.3767/persoonia.2018.40.10
  • Faria MR, Wraight SP (2007) Mycoinsecticides and Mycoacaricides: A comprehensive list with worldwide coverage and international classification of formulation types. Biological Control 43: 237–256. https://doi.org/10.1016/j.biocontrol.2007.08.001
  • Gams W, Hoog D, Samson RA (1984) The hyphomycete genus Engyodontium a link between Verticillium and Aphanocladium. Persoonia 12: 135–147.
  • Gams W, Zare R (2001) A revision of Verticillium sect. Prostrata. III. Generic classification°). Nova Hedwigia 72: 47–55.
  • Goettel MS, Koike M, Kim JJ, Aiuchi D, Shinya R, Brodeur J (2008) Potential of Lecanicillium spp. for management of insects, nematodes and plant diseases. Journal of Invertebrate Pathology 98: 256–261. https://doi.org/10.1016/j.jip.2008.01.009
  • Huang SK, Maharachchikumbura SSN, Jeewon R, Bhat DJ, Phookamsak R, Hyde KD, Al-Sadi AM, Kang JC (2018) Lecanicillium subprimulinum (Cordycipitaceae, Hypocreales), a novel species from Baoshan, Yunnan. Phytotaxa 348: 99–108.
  • Kaifuchi S, Nonaka K, Mori M, Shiomi K, Ōmura S, Masuma R (2013) Lecanicillium primulinum, a new hyphomycete (Cordycipitaceae) from soils in the Okinawa’s main island and the Bonin Islands, Japan. Mycoscience 54: 291–296. https://doi.org/10.1016/j.myc.2012.10.006
  • Kepler RM, Luangsa-ard JJ, Hywel-Jones NL, Quandt CA, Sung GH, Rehner SA, Aime MC, Henkel TW, Sanjuan T, Zare R, Chen MJ, Li ZZ, Rossman AY, Spatafora JW, Shrestha B (2017) A phylogenetically-based nomenclature for Cordycipitaceae (Hypocreales). IMA Fungus 8: 335–353. https://doi.org/10.5598/imafungus.2017.08.02.08
  • Kope HH, Leal I (2006) A new species of Lecanicillium isolated from the white pine weevil. Mycotaxon 94: 331–340.
  • Kouvelis VN, Sialakouma A, Typas MA (2008) Mitochondrial gene sequences alone or combined with ITS region sequences provide firm molecular criteria for the classification of Lecanicillium species. Mycological Research 112: 829–844. https://doi.org/10.1016/j.mycres.2008.01.016
  • Maharachchikumbura SSN, Hyde KD, Jones EBG, McKenzie EHC, Huang S-K, Abdel-Wahab MA, Daranagama DA, Dayarathne M, D’souza MJ, Goonasekara ID, Hongsanan S, Jayawardena RS, Kirk PM, Konta S, Liu J-K, Liu Z-Y, Norphanphoun C, Pang K-L, Perera RH, Senanayake IC, Shang Q, Shenoy BD, Xiao Y, Bahkali AH, Kang J, Somrothipol S, Suetrong S, Wen T, Xu J (2015) Towards a natural classification and backbone tree for Sordariomycetes. Fungal Diversity 72: 199–301. https://doi.org/10.1007/s13225-015-0331-z
  • Mongkolsamrit S, Noisripoom W, Thanakitpipattana D, Wutikhun T, Spatafora JW, Luangsaard J (2018) Disentangling cryptic species with isaria-like morphs in cordycipitaceae. Mycologia 110: 230–257.
  • Park MJ, Hong SB, Shin HD (2016) Lecanicillium uredinophilum sp. nov. associated with rust fungi from Korea. Mycotaxon 130: 997–1005. https://doi.org/10.5248/130.997
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Sukarno N, Kurihara Y, Park J-Y, Inaba S, Ando K, Harayama S, Ilyas M, Mangunwardoyo W, Sjamsuridzal W, Yuniarti E, Saraswati R, Widyastuti Y (2009) Lecanicillium and Verticillium species from Indonesia and Japan including three new species. Mycoscience 50: 369–379. https://doi.org/10.1007/S10267-009-0493-1
  • Sung GH, Hywel-Jones NL, Sung JM, Luangsa-ard JJ, Shrestha B, Spatafora JW (2007) Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Studies in Mycology 57: 5–59. https://doi.org/10.3114/sim.2007.57.01
  • Sung GH, Spatafora JW, Zare R, Hodge KT, Gams W (2001) A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs and teleomorphs of the ClavicipitaceaeO). Nova Hedwigia 72: 311–328.
  • Swofford DL (2001) Paup*: Phylogenetic analysis using parsimony (and other methods) 4.0. b10. Sunderland, Massachusetts.
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 30: 2725–2729. https://doi.org/10.1093/molbev/mst197
  • van den Brink J, Samson RA, Hagen F, Boekhout T, de Vries RP (2011) Phylogeny of the industrial relevant, thermophilic genera Myceliophthora and Corynascus. Fungal Diversity 52: 197–207. https://doi.org/10.1007/s13225-011-0107-z
  • White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR Protocols.Academic Press, San Diego, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Wijayawardene NN, Hyde KD, Rajeshkumar KC, Hawksworth DL, Madrid H, Kirk PM, Braun U, Singh RV, Crous PW, Kukwa M, Lücking R, Kurtzman CP, Yurkov A, Haelewaters D, Aptroot A, Lumbsch HT, Timdal E, Ertz D, Etayo J, Phillips AJL, Groenewald JZ, Papizadeh M, Selbmann L, Dayarathne MC, Weerakoon G, Jones EBG, Suetrong S, Tian Q, Castañeda-Ruiz RF, Bahkali AH, Pang KL, Tanaka K, Dai DQ, Sakayaroj J, Hujslová M, Lombard L, Shenoy BD, Suija A, Maharachchikumbura SSN, Thambugala KM, Wanasinghe DN, Sharma BO, Gaikwad S, Pandit G, Zucconi L, Onofri S, Egidi E, Raja HA, Kodsueb R, Cáceres MES, Pérez-Ortega S, Fiuza PO, Monteiro JS, Vasilyeva LN, Shivas RG, Prieto M, Wedin M, Olariaga I, Lateef AA, Agrawal Y, Fazeli SAS, Amoozegar MA, Zhao GZ, Pfliegler WP, Sharma G, Oset M, Abdel-Wahab MA, Takamatsu S, Bensch K, de Silva NI, De Kesel A, Karunarathna A, Boonmee S, Pfister DH, Lu YZ, Luo ZL, Boonyuen N, Daranagama DA, Senanayake IC, Jayasiri SC, Samarakoon MC, Zeng X-Y, Doilom M, Quijada L, Rampadarath S, Heredia G, Dissanayake AJ, Jayawardana RS, Perera RH, Tang LZ, Phukhamsakda C, Hernández-Restrepo M, Ma X, Tibpromma S, Gusmao LFP, Weerahewa D, Karunarathna SC (2017) Notes for genera: Ascomycota. Fungal Diversity 86: 1–594. https://doi.org/10.1007/s13225-017-0386-0
  • Zare R, Gams W (2001) The genera Lecanicillium and Simplicillium gen. nov. Nova Hedwigia 73: 1–50.
  • Zou X, Zhou YM, Liang ZQ, Xu FL (2016) A new species of the genus Hirsutella with helical twist neck of phialides parasitized on Tortricidae. Mycosystema 35: 807–813.
login to comment