Research Article |
|
Corresponding author: Jun-Rui Zhi ( jrzhi@gzu.edu.cn ) Corresponding author: Xiao Zou ( xzou@gzu.edu.cn ) Academic editor: Thorsten Lumbsch
© 2018 Ye-Ming Zhou, Jun-Rui Zhi, Mao Ye, Zhi-Yuan Zhang, Wen-Bo Yue, Xiao Zou.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Zhou Y-M, Zhi J-R, Ye M, Zhang Z-Y, Yue W-B, Zou X (2018) Lecanicillium cauligalbarum sp. nov. (Cordycipitaceae, Hypocreales), a novel fungus isolated from a stemborer in the Yao Ren National Forest Mountain Park, Guizhou. MycoKeys 43: 59-74. https://doi.org/10.3897/mycokeys.43.30203
|
A new species of entomopathogenic fungi, Lecanicillium cauligalbarum, was discovered from a survey of invertebrate-associated fungi in the Yao Ren National Forest Mountain Park in China. The synnemata of this species emerged from the corpse of a stemborer (Lepidoptera), which was hidden amongst pieces of wood on the forest floor. It differs from morphologically similar Lecanicillium species mainly in its short conidiogenous cells and ellipsoid to ovoid and aseptate conidia. Phylogenetic analysis of a combined data set comprising ITS, SSU, LSU, TEF, RPB1 and RPB2 sequence data supported the inclusion of L. cauligalbarum in the Lecanicillium genus and its recognition as a distinct species.
Entomopathogenic fungi, Lecanicillium , multiple genes, phylogeny, new species
The entomopathogenic fungal genus Lecanicillium W. Gams & Zare belongs to Ophiocordycipitaceae. It is typified by Lecanicillium lecanii with Torrubiella confragosa as the sexual morph (
Presently, 29 Lecanicillium species have been formally described and are listed in the Index Fungorum (http://www.indexfungorum.org).
We carried out a survey of invertebrate-associated fungi in the Yao Ren National Forest Mountain Park near Sandu county in Guizhou province, China. A parasitic fungus was found on a stemborer (Lepidoptera) hiding amongst pieces of wood. Attempting to identify the fungus, we determined it to be a member of Lecanicillium but its morphological traits and gene sequences did not correspond with those of any known Lecanicillium species. On the basis of its morphology and molecular phylogenetic analysis of multilocus nuclear genes (TEF, RPB1, RPB2, LSU and SSU) and ITS sequence data, this fungus was suggested to be an unnamed species of Lecanicillium and is here described and named Lecanicillium cauligalbarum sp. nov.
The specimen was collected from Yao Ren National Forest Mountain Park, Sandu county, Guizhou, China (107°53', 107°58'E; 24°54', 25°59'N, approximately 560–1365 m above sea level), in September 2015 by Yeming Zhou and Xiao Zou. The synnemata of this species emerged from a dead stemborer (Lepidoptera) hidden amongst pieces of wood on the forest floor. The specimen GZUIFR–2015ZHJ and two isolated strains of the fungal asexual stage, GZUIFRZHJ01 and GZUIFRZHJ02, were deposited at the Institute of Fungal Resources of Guizhou University (GZUIFR). The fungal strains were isolated on potato dextrose agar (PDA) medium; one strain was isolated from part of the body and the second strain was isolated from the synnemata.
The isolated strains were inoculated on PDA at 25 °C for 14 d under 12-h light/12-h dark conditions. The fresh hyphae were observed with an optical microscope (OM, BK5000, OPTEC, USA) following pretreatment with lactophenol cotton blue solution or normal saline.
Genomic DNA was extracted using a previously described method (
To conduct phylogenetic analysis of the sequences obtained, sequences for selected taxa based on recent phylogenetic studies of Lecanicillium (
| Gene | Primer | Provenance |
|---|---|---|
| ITS | F: 5’-TCCGTAGGTGAACCTGCGG-3’ |
|
| R: 5’-TCCTCCGCTTATTGATATGC-3’ | ||
| SSU | F: GTAGTCATATGCTTGTCTC |
|
| R: CTTCCGTCAATTCCTTTAAG | ||
| LSU | F: GTTTCCGTAGGTGAACCTGC |
|
| R: ATATGCTTAAGTTCAGCGGGT | ||
| TEF | F: 5’-GCCCCCGGCCATCGTGACTTCAT-3’ |
|
| R: 5’-ATGACACCGACAGCGACGGTCTG-3’ | ||
| RPB1 | F: 5’-CCWGGYTTYATCAAGAARGT-3’ |
|
| R: 5’-CAYCCWGGYTTYATCAAGAA-3’ | ||
| RPB2 | F: 5’-GACGACCGTG ATCACTTTGG-3’ |
|
| R: 5’-CCCATGGCCTGTTTGCCCAT-3’ |
The DNA sequences used in this study were edited using the LASERGENE software (version 6.0; DNASTAR, Madison, WI, USA). Multiple sequence alignments for TEF, RPB1 and RPB2 were performed in MAFFT (Katoh and Standley 2013) with the default settings. Multiple sequence alignments for ITS, LSU and SSU were conducted using MUSCLE algorithm (
The first sequence dataset consisted of 3793 bases, including inserted gaps (ITS: 506 bp; SSU: 579 bp; LSU: 490 bp; TEF: 772 bp; RPB1: 561 bp; RPB2: 885 bp). The second sequence dataset consisted of 2944 bases, including inserted gaps (ITS: 526 bp; SSU: 456 bp; LSU: 409 bp; TEF: 386 bp; RPB1: 500 bp; RPB2: 667 bp). No significant differences in topology were observed between the BI and ML phylogenies. The first tree formed with almost all the Lecanicillium species (only Lecanicillium evansii could not be found in the NCBI) and one Simplicillium species (Simplicillium lanosoniveum). The phylogeny was resolved into 4 clades obviously. Lecanicillium cauligalbarum formed an independent branch in a polytomy together with a clade containing L. flavidum and L. fungicola and a major clade consisting of 27 accessions. The L. cauligalbarum lineage received maximum statistical support (BI posterior probabilities 1, ML boostrap 100%), which still remains unnamed (Figure
Characterised by phialides gradually tapering towards the apex, solitary or 2–3 whorls, 9–14.4 × 1.4–1.8 µm. Conidia cylindric, aseptate, 3.6–6.3 × 0.9–1.8 μm.
CHINA, Guizhou Province, Sandu county (107°53', 107°58'E; 24°54', 25°59'N, approximately 560–1365 m above sea level), September 2015, Yeming Zhou & Xiao Zou. Sequences from isolated strains (GZUIFRZHJ01 and GZUIFRZHJ02) have been deposited in GenBank (accession numbers to be provided).
Colony on PDA 15 mm in diameter after 7 days, 33 mm in diameter after 14 days at 25 °C, colony circular, white, cottony, umbonate, with radiating surface texture from above, with clear radial crack and primrose-yellow from reverse. Mycelium 0.9–1.8 μm wide, hyaline, smooth, septated, branched. Conidiophores usually arising from aerial hyphae, sporulate abundant. Phialides gradually tapering towards the apex, solitary or 2–3 whorls, 9–14.4 × 1.4–1.8 µm. Conidia cylindric, aseptate, 3.6–6.3 × 0.9–1.8 μm. In culture, both phialides and conidia are of similar general shape and size to those found on the host stemborer.
Lecanicillium cauligalbarum. a Synnemata emerged from the corpse of a stemborer (Lepidoptera) b Culture plate, showing the front (upper) and the back (lower) of the colony, cultured on PDA medium c–e Phialides solitary or in 2–3 whorls f–g Conidia. Scale bars: 10 mm (b, c, e), 5 μm (d, f, g).
Stemborer (Lepidoptera) hidden amongst wooden sticks.
Hidden amongst pieces of wood in humid forests of southwest China.
The epithet ‘cauligalbarum’ refers to the host (stemborer).
Not known.
With regard to phylogenetic relationships, L. cauligalbarum is closely related to the L. fungicola clade and L. fusisporum. The two strains (GZUIFRZHJ01 and GZUIFRZHJ02) formed a distinct lineage. All Lecanicillium species were included in the phylogenetic analysis except for L. evansii for which sequence data could not be located in public databases, although
In morphology L. cauligalbarumis is similar to L. aphanocladii, L. attenuatum and L. nodulosum with regard to the short conidiogenous cell (Table
Morphological comparison among Lecanicillium cauligalbarum and the other related species.
| Species | Colonies | Conidiogenous cell | Conidia | Refrence |
|---|---|---|---|---|
| Lecanicillium acerosum | White, yellow reverse | Solitary or up to 4–5, 30–32×1.8–2.2 μm | Macroconidia fusiform, straight to slightly falcate, 15–20×1.6–2.2 μm, microconidia fusiform, 4.5–7.5×1.0–1.5 μm |
|
| L. antillanum | White, cream-coloured reverse | Solitary or up to 6, subulate, 18–31×1 μm (at the top) | Macroconidia fusiform, 11–18×0.8–1.5 μm, microconidia ellipsoidal, 3–4×0.8–1.2 μm |
|
| L. aphanocladii | White, red, reddish-white to cream-coloured reverse | Solitary, in pairs, verticillate, flask-shaped in the beginning, tapering into a thread-like neck, 4.5–11×1.0–1.8 μm | Solitary, oval to sub-globose, 2.7–4×1.5–2.2 μm |
|
| L. aranearum | White, yellowish-cream reverse | Tapering towards the apex, 20–30×1.2–1.5 μm | Straight or curved, usually asymmetrically narrowed or subacute at the ends, 5–8×0.7–1.5 μm |
|
| L. araneicola | White, creamy-white reverse | Solitary or in whorls of 2–4, slender, tapering toward the tip, (14-)19–31.5×1–2 μm | Macroconidia slightly curved to nearly straight, (7.5-)8.5–12(-14)×1.5–2 μm, microconidia allantoid to ellipsoidal with round ends, 3–5×1–2 μm |
|
| L. araneogenum | White to light grey, light yellow reverse | Produced in whorls of (1-)2–6(-8), 30–64×1.1–3.2 μm | Forming mostly globose heads, cylindric, 3.2–8.6×1.3–1.6 μm |
|
| L. attenuatum | White, yellowish-white reverse | Up to 3–5 per node, 9–15.5×1–2 μm | Cylindrical with attenuate base, 4.5–6.5×1.5–2.0 μm |
|
| L. cauligalbarum | White, primrose-yellow reverse | Solitary or 2–3 whorls, 9–14.4×1.4–1.8 μm | Cylindrical, 3.6–6.3×0.9–1.8 μm | This work |
| L. dimorphum | White, cream to brownish-cream, red reverse | Two kinds: solitary or 4–5 whorls, 14–30×1.0–1.5μm; short, 5–12×0.7–1.5 μm | Macroconidia falcate with sharply pointed ends, usually evenly curved, 6–11×1.5–2.5μm, microconidia oval to ellipsoidal, 2.5–4.5×1.0–1.5 μm |
|
| L. evansii | White, creamy, brownish-cream to brown reverse, | Solitary or up to 3–4 per node, 20–45×1–1.2 μm | Macroconidia slightly falcate, 4.5–7.5×0.8–1.2μm, microconidia ellipsoidal or curved, 2.0–3.0×0.8–1.2 μm |
|
| L. flavidum | Greyish-white to citron-yellow, citron-yellow reverse | In whorls, 12–35×1.5–2.5 μm, 0.5–1 μm at the tips | Mostly fusiform, long-ellipsoidal to almost cylindrical, slightly sickle-shaped, 4–8×1.5–2 μm |
|
| L. fungicola var. aleophilum | White, reverse uncoloured | Whorls of 3–10, 15–30×1.5–2.5 μm, 0.5–1.5 μm at the tips | Oblong, fusiform, long ellipsoidal to almost cylindrical, irregular size, 4.5–8×1–2.5 μm |
|
| L. fungicola var. fungicola | Dirty white, reverse uncoloured | Whorls of 3–7, 14–20(-45)×1.5–3μm, 0.5–1 μm at the tip | Fusiform, long-ellipsoidal to almost cylindrical, sickle-shaped, very unequal size, 4–9(-12)×1.5–2.5(-3.5) μm |
|
| L. fusisporum | White, with red reverse and pigment diffusing | Solitary or up to 5, 16–26×1.0–1.5 μm | Fusiform, straight and rather broad, 3–5×1.5–2.0 μm |
|
| L. kalimantanense | White, creamy-white reverse | Solitary or more often in whorls of 2–5, slender, tapering toward the apex, 12.5–36×1–2 μm | Acerose to fusoid with pointed ends, slightly curved, of varying size, (3.5-)4.5–12×1–2 μm |
|
| L. lecanii | Yellowish-white, deep yellow reverse | Aculeate and strongly tapering, singly or up to 6, 11–20(-30)×1.3–1.8 μm | Typically short-ellipsoidal, 2.5–3.5(-4.2)×1–1.5 μm, homogeneous in size and shape |
|
| L. longisporum | White to sulphur-yellow, cream-coloured to pale yellow reverse | Tapering towards the apex(sub-aculeate), singly or up to 5–6 or on secondary phialides, 20–40×1.2–2.7 μm | Produced in globose heads, ellipsoidal to oblong-oval, 5.0–10.5×1.5–2.5 μm |
|
| L. muscarium | White, cream-coloured or uncoloured reverse | Solitary or up to 6 (less frequent than in L. lecanii), (15-)20–35×1–1.5 μm | Produced in globose heads, ellipsoidal to subcylindrical, more irregular in size and shape, (2-)2.5–5.5(-6)×1–1.5(-1.8) μm |
|
| L. nodulosum | White, cream-coloured reverse | Subulate, up to 6, 10–20×1.5 μm | Produced in heads of about 10μm diam., oval, 2.5–4.5×1.2–1.5 μm |
|
| L. pissodis | White, ceram to yellow reverse | Solitary, up to 3, 16-(18–28)-38×1–2 μm | Up to more than 50 formed in globose droplets, cylindrical to oval, very variable in size and shape, 4–9.2×1.6–2.4 μm |
|
| L. primulinum | Pale yellow, yellowish-brown reverse, brownish-yellow pigment | Solitary or in whorls of 2–5, tapering toward the tip, 20–50(-85)×0.8–1.8 μm | Macroconidia ellipsoidal to cylindrical, 5.0–9.5×1.2–2.5 μm, microconidia oval to ellipsoidal, 3.0–4.8×1.0–2.5 μm |
|
| L. psalliotae | White and red, reddish-cream to cream-coloured reverse, red to purple pigment | Aculeate, solitary or more often 3–4(-6) in whorls on each node, 25–35×1.0–1.5 μm | Macroconidia curved, falcated, 5–10×1.2–1.7 μm, microconidia oval or ellipsoidal, 2.7–3.7×1–1.5 μm |
|
| L. restrictum | Yellowish-white, reverse yellowish-white to pale yellow | Solitary or in whorls of 2–5, tapering toward the tip, (12-)17–30(-36)×0.5–1.5 μm, 0.3–0.5 μm wide on the tip | Macroconidia fusiform or slightly falcate, (5-)6–10(-12)×1–1.5 μm, microconidia ovate, ellipsoidal, obovate or fusoid, frequently slightly curved, 2.5–3×1–1.5 μm |
|
| L. sabanense | Pale yellow to duller yellow, orange reverse | Solitary or in whorls of 2–4, 13–19×1.0–2.0 μm, gradually tapering to 0.5–1.0 μm | Forming mostly globose heads, 9–20 μm diam, ellipsoidal to ovoid, 3.5–4.5×1.5–2.0 μm |
|
| L. saksenae | White, creamy white reverse | Solitary or often in whorls of 2–4, slender, tapering towards the apex, 14.5–36×1.0–2.0 μm | Macroconidia slightly curved, 6–13×1.5–2 μm, microconidia ellipsoidal to fusoid with round ends, nearly straight to slightly curved, 2.5–5×1.5–2 μm |
|
| L. subprimulinum | Creamy, primrose-yellow reverse | Tapering towards apex, discrete, solitary or up to 2–3 per node, 19–32×1.5–3.5 μm | Ovoid to ellipsoidal, elongated, straight or slightly curved, 4–15×2–6 μm |
|
| L. testudineum | White, centrally raised, wrinkled, reverse pale yellow to greyish-yellow | Solitary or in whorls of 2–4, tapering toward the tip, (13-)16–45(-53)×0.5–1 μm (exceptionally 80 μm long), 0.5–1 μm wide on the tip | Macroconidia fusiform or slightly falcate, 3.5–6(-6.5)×1–1.5 μm, microconidia ovate, ellipsoidal or fusoid, curved to reniform, 2–3.5×1–1.5 μm |
|
| L. tenuipes | White, reverse uncoloured | Arising singly or in scanty whorls, 20–35(-40)×1.2–1.5 μm | Microconidia ellipsoidal, straight, 3.0–5.5(-6.5)×1.0–1.5 μm, microconidia fusiform to falcate, 8–17×1.5–1.8 μm |
|
| L. uredinophilum | White to cream coloured, reverse cream coloured | Produced singly or in whorls of up to 3–5, 20–60×1–2.5(-3) μm | Cylindric, oblong or ellipsoid, 3–9×1.8–3 μm |
|
| L. wallacei | White, cream-coloured to creamish-brown reverse | Sollitary or up to 3–4, aculeate, (14-)17–25(29)×0.7–1.2 μm | Macroconidia, fusiform to falcate, (7.0-)8.5–10.5(-12.5)×1.0–1.5 μm, microconidia ellipsoidal to slightly falcate, (3.0-)4.0–5.5(-6.5)×0.7–1.2 μm |
|
The genera Lecanicillium and Simplicillium belong to the Cordycipitaceae (
In a comparison of all Lecanicillium species included in the present study, we were unable to identify morphological synapomorphies that characterise the phylogenetic groups. However, the species that show a close phylogenetic relationship are more similar in morphology than those that are phylogenetically distant. For example, the L. lecanii clade, which has globose heads with a higher number of conidia, are distinguishable from those clades that usually have one conidium visible at the top of the phialide in the phylogenetic tree presented here. In our phylogeny study, the node connecting L. antillanum and L. tenuipes is the basal node for the major clade. So the relationships of all of the lineages involved may change with more data or a different dataset. Therefore, more species are needed to enrich the phylogenetic study of Lecanicillium spp.
We know that Lecanicillium has a different origin into the Cordycipitaceae. We consider that the ones ‘L. lecanii clade’ in pig.1 form a strong clade inside of Akanthomyces. Maybe all these should be moved to the Akanthomyces including Lecanicillium longisporum. In addition, the elimination of the genus may create more chaos considering the unsolved other clades.
Blackwellomyces Spatafora & Luangsa-ard is diagnosed by the unique characters of the ascospore, which have irregularly spaced septa and do not disarticulate into part-spores at maturity as advised by
This study was supported by the National Science Foundation of China (Project number: 31860507; 31860037), Guizhou international science and technology cooperation base (Project number: G[2016]5802), Major special projects of Guizhou tobacco company (201603; 201712). We thank Robert McKenzie, PhD, from Liwen Bianji, Edanz Group China (www.liwenbianji.cn/ac), for editing the English text of a draft of this manuscript. We also thank Konstanze Bensch, from mycobank web site (www.mycobank.org/), for the suggested epithet of “cauligalbarum” to replace “bristletailum”.