The study site is located in the middle taiga sub-zone of Western Siberia, in Russia. The area is characterised by a subarctic climate with average yearly temperatures of -1.1 °C, ranging from averages of -20 °C in January to 18 °C in July. The total annual precipitation is 553 mm. The period without snow cover usually lasts from May until October (Bulatov et al. 2007).

The collections were made in a mixed coniferous-deciduous forest close to a stream and a forest path 1.2 km SSE of Shapsha village, 61.07929"N, 69.46925"E. The tree canopy was dominated by Pinus sibirica, Picea obovata and Abies sibirica with admixture of Betula pubescens, Populus tremula, Sorbus sibirica and Salix spp. The plant layer was made up of Equisetum sylvaticum, Rubus arcticus, Milium effusum and Luzula pilosa.

Several years ago, a fire took place in this forest, resulting in the dominance of E. sylvaticum. Ground fires generally result in completely new successional trajectories and one dominant component of early post-fire vegetation communities is E. sylvaticum. Its rhizomes are buried deep in the soil and thus are resistant to fire (Viereck 1983). Interestingly, the new Stamnaria species was only collected from these post-fire mass populations of E. sylvaticum. Elsewhere in coniferous forests in Khanty-Mansi Autonomous Okrug – Yugra, E. sylvaticum is common but occurs in sparse densities and no growth of Stamnaria has been observed.

The species was discovered after examining the litter of the host plant in situ by the naked eye. Time of collection was always at the beginning of summer (about three weeks after snow melt). The substrate (Equisetum sylvaticum side branches) extracted from under the snow in February 2014 also gave abundant fruiting after three weeks of incubation in a moist chamber.

The litter was collected and brought to the laboratory where it was studied and documented the same day. Hereafter, the material (side branches with attached fruiting bodies) was dried at room temperature and stored as dry collection at Yugra State University Biological Collection (YSU). Voucher specimens are also preserved at Farlow Herbarium of Harvard University, Cambridge, Massachusetts (FH) and at V.L. Komarov Botanical Institute, Saint-Petersburg (LE).

The morphological features of the species were studied using a Zeiss Stemi 2000-C stereomicroscope, with magnification from 6 to 50× and a Zeiss Axiostar transmitted light microscope (with Achromat 10/0.25, 40/0.65 dry and 100/1.25 oil immersion objectives). Microstructures were studied and measured from living material in tap water and later compared to dead material from dried specimens. The iodine reaction was tested with Lugol’s solution and Congo Red in water was used to stain the sections and the structure of the excipulum.

Macro- and micro-photographs were obtained using a Canon EOS 50D digital camera and Axiocam ERc 5s digital camera. Abbreviations used: * = living state, † = dead state, CR = Congo Red, VB = vacuolar body.

DNA was extracted from dry apothecia with the help of the Extract-N-Amp Plant PCR Kit (Sigma-Aldrich, St Louis, MO), DNeasy Plant Mini Kit (Qiagen, Valencia, CA) and the QIAamp DNA Micro Kit (Qiagen). Per extraction, 1 to 4 apothecia were used. Apothecia were crushed in 1.5 mL tubes using a 1.5 mL pellet pestle (Kimble, Rockwood, TN, #749521-1500) or cut in half using a sterile no. 10 surgical blade on a disposable Bard-Parker handle (Aspen Surgical, Caledonia, MI). Undiluted DNA was used for PCR amplification of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). The ITS was amplified using the forward primer ITS1f (5’–CTTGGTCATTTAGAGGAAGTAA–3’) in combination with either ITS4 (5’–TCCTCCGCTTATTGATATGC–3’) or the Ascomycota-specific primer ITS4A (5’–CGCCGTTACTGGGGCAATCCCTG–3’) (White et al. 1990, Gardes and Bruns 1993, Larena et al. 1999). All PCR reactions were done in a Mastercycler ep gradient thermocycler (Eppendorf, Hauppauge, NY) using Sigma-Aldrich’s REDTaq DNA Polymerase enzyme. PCR conditions were as follows: an initial denaturation step at 94 °C for 3 min, then 35 cycles of 94 °C for 1 min, 50 °C for 45 s and 72 °C for 90 s and a final extension step at 72 °C for 10 min (ITS).

Products with clear bands on agarose gel were cleaned with the Qiaquick PCR Purification Kit (Qiagen) and subsequently sequenced with the same primers (3 μl of purified PCR product per 10 μl sequencing reaction). Sequencing reactions were performed using the Big Dye Terminator v3.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA). Sequences were trimmed, edited and assembled in Sequencher v. 4.10.1. All generated sequences have been deposited in GenBank (Table 1). BLAST searches for similar sequences were undertaken at: http://ncbi.nlm.nih.gov/blast/Blast.cgi.

An ITS dataset was constructed to investigate the phylogenetic structure within the genus Stamnaria. Sequences were aligned using Muscle v3.7 (Edgar 2004), available on the Cipres Science Gateway version 3.3 (Miller et al. 2010). Pairwise evolutionary distances, the amounts of genetic variation between two species, were calculated using Paup on XSEDE, also on the Cipres Science Gateway. The p-distance is calculated as the proportion of sites in a pairwise alignment at which the compared sequences are different. This is the number of nucleotide differences divided by the number of nucleotides compared. In addition, Jukes-Cantor (JC69) and Kimura 2-parameter (K2P) distance metrics (Jukes and Cantor 1969, Kimura 1980) were calculated. Neighbour joining (NJ) analyses (Saitou and Nei 1987) were performed to cluster taxa based on the respective distance matrices. The three resulting NJ trees were statistically compared with the SH test (Shimodaira and Hasegawa 1999).

Maximum parsimony (MP) and maximum likelihood (ML) analyses were run using Paup on XSEDE. MP was estimated with heuristic searches consisting of 500 stepwise-addition trees obtained using random sequence addition replicates followed by tree bisection-reconnection (TBR) branch swapping (MulTrees in effect) and saving all equally most parsimonious trees. Robustness of branches was estimated by maximum parsimony bootstrap proportions (BP) using 1000 bootstrap replicates, with heuristic searches consisting of 10 stepwise-addition trees obtained using random sequence addition replicates followed by TBR branch swapping, with MaxTrees set at 100. ML inference was run under a TIM2ef+I+G model of nucleotide substitution, as selected by jModeltest 2.1 (Darriba et al. 2012) following the Akaike Information Criterion. Rapid bootstrapping was implemented with 500 replicates.

Bayesian analyses were done with a Markov chain Monte Carlo (MCMC) coalescent approach implemented in Beast 1.8.4 (Drummond et al. 2012), with a strict clock with uniform rates of evolution across branches. A Yule speciation (Yule 1925) tree prior was selected with the TIM2ef+G nucleotide substitution model (considering the Bayesian Information Criterion from the earlier jModelTest 2.1 analysis). Four independent runs were performed from a random starting tree for 40 million generations, with a sampling frequency of 4000. Tracer 1.6 (Rambaut et al. 2014) was used to check trace plots and effective sample sizes (ESS). Burnin values were 5 % for all runs. Logged parameters were checked to have combined ESS values of at least 200. TreeAnnotator 1.8.4 was used to generate consensus trees with 0 % burnin and to infer the Maximum Clade Credibility (MCC) tree, with the highest product of individual clade posterior probabilities. The different trees with bootstrap values (BS) and posterior probabilities (pp) were visualised in FigTree 1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/).

The ITS rDNA dataset consists of 16 isolates and 671 characters, of which 387 are constant and 187 are parsimony-informative. Taxonomical sampling covers the genera Hymenoscyphus Gray (1 isolate), Leotia Pers. (1), Microglossum Gillet (1), Rommelaarsia Baral & Haelew. (1), Roseodiscus Baral (1) and Stamnaria (8); Geoglossum Pers. (2) and Sarcoleotia S. Ito & S. Imai (1) served as outgroup taxa (Geoglossomycetes, Geoglossales, sensu Schoch et al. 2006). This dataset includes the three currently recognised species in the genus Stamnaria.

Figure 4. 

A Median section through receptacle, showing gelatinised outer layer of ectal excipulum B Median section through stipe, showing outer gelatinised layer, inner layer of textura porrecta (orange) and transition to medullary excipulum C Medullary excipulum in squash mount D Inner part of collar in squash mount showing hyphae forming outgrowths (single hyphae shown in insert) E Ectal excipulum of textura prismatica at receptacle flank in squash mount (outer layer absent). All stained by CR in water (cells partly in vital state), from YSU-F-04933. Scale bars: 10 μm.

Intra-specific divergence in the ITS region ranges from 0.0 to 0.9 % while inter-specific divergences range between 8.0 and 13.7 % (p-distances) or between 8.4–8.5 and 15.1 % (JC69, K2P). The p-distances are 8.0 % between S. americana and S. persoonii, 10.6 % between S. persoonii and S. yugrana and 13.7 % between S. americana and S. yugrana. JC69 and K2P distances are almost identical, higher but equivalent to the p-distances (Table 2). The NJ phenogram constructed from the Jukes–Cantor distance matrix has a higher likelihood score (-lnL = 791.63111) compared to the analyses based on p-distances and Kimura 2-parameter distances, but the differences are insignificant.

The genus Stamnaria is retrieved as a monophyletic clade in all three phylogenetic reconstructions (MPBS = 74, MLBS = 98, pp = 1.0). All morphologically delineated species of Stamnaria have maximum support. The position of the new species within the genus is unresolved. Under MP and ML inference, S. yugrana is sister to S. persoonii but this sister relationship is only supported by MLBS = 81. In the Bayesian analysis, on the other hand, S. yugrana is sister to (S. americana, S. persoonii), with moderate support for the sister relationship between the two latter species (pp = 0.8).

Figure 5. 

Bayesian MCC tree, with node values indicating posterior probabilities (above) and MP/ML bootstrap values (below). Thick branches indicate maximum Bayesian support (pp = 1.0). Photos of apothecia (left) and drawings of ascospores (right) from top to bottom: S. yugrana, holotype, YSU-F-03519, Russia, 9 Jun 2012; S. persoonii, Gilbert Moyne, H.B. 8889, France, 24.VI.2008; S. americana, Claude Page, France, 7 Apr 2016 (first French report in Moingeon and Page 2003). Scale bar: 20 µm.