Research Article
Research Article
A new species of Stamnaria (Leotiomycetes, Helotiales) from Western Siberia
expand article infoDanny Haelewaters, Nina V. Filippova§, Hans-Otto Baral|
‡ Harvard University, Cambridge, United States of America
§ Yugra State University, Khanty-Mansiyskiy autonomous okrug, Russia
| Unaffiliated, Tübingen, Germany
Open Access


A new species of Stamnaria is described based on morphology and molecular data from a collection made in West Siberia. Stamnaria yugrana is differentiated by lanceolate, strongly protruding paraphyses and comparatively narrow, fusoid-clavate ascospores. The apothecia are urn-shaped due to a prominent and even collar as in S. persoonii. The species grows on fallen side branches of Equisetum sylvaticum, a rarely recorded host for Stamnaria. The authors formally describe the new species and provide colour illustrations. In addition, the literature is reviewed on previously described species of Stamnaria. Phylogenetic reconstruction of the Stamnaria lineage, based on the ITS ribosomal DNA, strongly supports the three currently recognised species: S. americana, S. persoonii and S. yugrana.


Ascomycota , ecology, Equisetum , ITS rDNA, Stamnaria , taxonomy


During ongoing studies of the Helotiales (see Baral and Haelewaters 2015, Baral et al. 2015), material of a species of Stamnaria Fuckel, which had been collected and morphologically documented by one of the authors (NVF), was investigated by molecular methods. Collections were made during surveys in the vicinities of Shapsha field station of Yugra State University in Western Siberia, Russia. After the first collection of the species in June 2008, the same locality was visited in June 2012, February 2014 and May 2015. During all these visits, abundant apothecia were observed. The species was always found growing on Equisetum sylvaticum. This plant species had rarely been mentioned before as a host for the genus Stamnaria (Sydow 1898: 432, S. equiseti; Jaap 1922: 15, S. persoonii). Moreover, the microscopic features of the collections differed markedly from all earlier taxa described in the genus Stamnaria. Therefore, it was decided to formally describe this fungus as a new species based on morphological and molecular characteristics.

Members of the genus Stamnaria (Ascomycota, Leotiomycetes, Helotiales) share the following characteristics: 1) the presence of a thick hyaline gelatinised layer of textura oblita outside the ectal excipulum of textura prismatica, 2) cells of ectal excipulum and paraphyses containing yellow-orange carotenoids, 3) apothecia erumpent through epidermis, 4) all species growing on members of Equisetum and 5) with asexual state in the genus Titaeospora Bubák (von Höhnel 1928, Gruber 2006, Baral in Jaklitsch et al. 2016). According to Johnston et al. (2014), the older name Stamnaria is recommended to be used for the holomorph, instead of Titaeospora. Based on the currently available sequence data, the genus forms its own clade within the Helotiales (Baral and Haelewaters 2015). Its isolated position was emphasised by Baral in Jaklitsch et al. (2016) by the informal recognition as “Stamnaria lineage.”

Thus far, seven species have been referred to as Stamnaria in the literature: S. americana Massee & Morgan, S. herjedalensis (Rehm) Bubák, S. hyalopus P. Karst., S. equiseti (Hoffm.) Sacc., S. persoonii (Moug.) Fuckel, S. pusio (Berk. & M.A. Curtis) Massee and S. thujae Seaver, according to the Index Fungorum (2018). However, S. hyalopus, S. pusio and S. thujae do not belong in the genus Stamnaria because they grow on hosts other than Equisetum, amongst other reasons (Gruber 2006). Stamnaria hyalopus occurs on decaying leaves of Carex vesicaria and S. thujae on Thuja occidentalis. Stamnaria pusio grows on rotting debris in the soil and was placed in tentative synonymy with Sarcoscypha occidentalis (Schwein.) Sacc. by Harrington (1990). Stamnaria herjedalensis appears to be a synonym of Roseodiscus equisetinus (Velen.) Baral (O. Eriksson pers. comm.). Stamnaria equiseti is considered a synonym of S. persoonii by accepting the older name equiseti (Saccardo 1889) but S. equiseti is of uncertain identity whereas that of S. persoonii could be clarified based on the lectotype (Gruber 2006). Taken together, only two species are currently accepted in the genus Stamnaria: S. americana and S. persoonii.

Material and methods

Study site ecology

The study site is located in the middle taiga sub-zone of Western Siberia, in Russia. The area is characterised by a subarctic climate with average yearly temperatures of -1.1 °C, ranging from averages of -20 °C in January to 18 °C in July. The total annual precipitation is 553 mm. The period without snow cover usually lasts from May until October (Bulatov et al. 2007).

The collections were made in a mixed coniferous-deciduous forest close to a stream and a forest path 1.2 km SSE of Shapsha village, 61.07929"N, 69.46925"E. The tree canopy was dominated by Pinus sibirica, Picea obovata and Abies sibirica with admixture of Betula pubescens, Populus tremula, Sorbus sibirica and Salix spp. The plant layer was made up of Equisetum sylvaticum, Rubus arcticus, Milium effusum and Luzula pilosa.

Several years ago, a fire took place in this forest, resulting in the dominance of E. sylvaticum. Ground fires generally result in completely new successional trajectories and one dominant component of early post-fire vegetation communities is E. sylvaticum. Its rhizomes are buried deep in the soil and thus are resistant to fire (Viereck 1983). Interestingly, the new Stamnaria species was only collected from these post-fire mass populations of E. sylvaticum. Elsewhere in coniferous forests in Khanty-Mansi Autonomous Okrug – Yugra, E. sylvaticum is common but occurs in sparse densities and no growth of Stamnaria has been observed.

Morphological studies

The species was discovered after examining the litter of the host plant in situ by the naked eye. Time of collection was always at the beginning of summer (about three weeks after snow melt). The substrate (Equisetum sylvaticum side branches) extracted from under the snow in February 2014 also gave abundant fruiting after three weeks of incubation in a moist chamber.

The litter was collected and brought to the laboratory where it was studied and documented the same day. Hereafter, the material (side branches with attached fruiting bodies) was dried at room temperature and stored as dry collection at Yugra State University Biological Collection (YSU). Voucher specimens are also preserved at Farlow Herbarium of Harvard University, Cambridge, Massachusetts (FH) and at V.L. Komarov Botanical Institute, Saint-Petersburg (LE).

The morphological features of the species were studied using a Zeiss Stemi 2000-C stereomicroscope, with magnification from 6 to 50× and a Zeiss Axiostar transmitted light microscope (with Achromat 10/0.25, 40/0.65 dry and 100/1.25 oil immersion objectives). Microstructures were studied and measured from living material in tap water and later compared to dead material from dried specimens. The iodine reaction was tested with Lugol’s solution and Congo Red in water was used to stain the sections and the structure of the excipulum.

Macro- and micro-photographs were obtained using a Canon EOS 50D digital camera and Axiocam ERc 5s digital camera. Abbreviations used: * = living state, † = dead state, CR = Congo Red, VB = vacuolar body.

DNA extraction, PCR and sequencing

DNA was extracted from dry apothecia with the help of the Extract-N-Amp Plant PCR Kit (Sigma-Aldrich, St Louis, MO), DNeasy Plant Mini Kit (Qiagen, Valencia, CA) and the QIAamp DNA Micro Kit (Qiagen). Per extraction, 1 to 4 apothecia were used. Apothecia were crushed in 1.5 mL tubes using a 1.5 mL pellet pestle (Kimble, Rockwood, TN, #749521-1500) or cut in half using a sterile no. 10 surgical blade on a disposable Bard-Parker handle (Aspen Surgical, Caledonia, MI). Undiluted DNA was used for PCR amplification of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). The ITS was amplified using the forward primer ITS1f (5’–CTTGGTCATTTAGAGGAAGTAA–3’) in combination with either ITS4 (5’–TCCTCCGCTTATTGATATGC–3’) or the Ascomycota-specific primer ITS4A (5’–CGCCGTTACTGGGGCAATCCCTG–3’) (White et al. 1990, Gardes and Bruns 1993, Larena et al. 1999). All PCR reactions were done in a Mastercycler ep gradient thermocycler (Eppendorf, Hauppauge, NY) using Sigma-Aldrich’s REDTaq DNA Polymerase enzyme. PCR conditions were as follows: an initial denaturation step at 94 °C for 3 min, then 35 cycles of 94 °C for 1 min, 50 °C for 45 s and 72 °C for 90 s and a final extension step at 72 °C for 10 min (ITS).

Products with clear bands on agarose gel were cleaned with the Qiaquick PCR Purification Kit (Qiagen) and subsequently sequenced with the same primers (3 μl of purified PCR product per 10 μl sequencing reaction). Sequencing reactions were performed using the Big Dye Terminator v3.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA). Sequences were trimmed, edited and assembled in Sequencher v. 4.10.1. All generated sequences have been deposited in GenBank (Table 1). BLAST searches for similar sequences were undertaken at:

Table 1.

Isolates used in phylogenetic analyses, with voucher information and GenBank accession numbers. Accession numbers of sequences generated during this study are in bold. *This sequence was retrieved from the Biological Resource Center of the National Institute of Technology and Evaluation, Japan (NBRC).

Species Isolate Voucher GenBank accession number
Geoglossum nigritum AFTOL-ID 56 OSC 100009 DQ491490
Geoglossum umbratile ANM Acc377 ILLS:61040 JQ256422
Hymenoscyphus epiphyllus H.B. 7054 DQ431180
Leotia lubrica ZW-Geo59-Clark AY789360
Microglossum rufum AY144533
Rommelaarsia flavovirens E5 H.B. 9684 KT958772
Roseodiscus rhodoleucus DH257 H.B. 8488a KT972704
Sarcoleotia globosa OSC 63633 AY789410
Stamnaria americana DH258a H.B. 7261 KT972707
DH941c Gruber 152/226 MG662188
DH941d Gruber 152/226 MG662189
FC-2732 TNS-F-39244 NBRC 108774*
Stamnaria persoonii DH671a Gruber 119/183 MG662201
NLU003b Gruber 118/182 MG662202
Stamnaria yugrana sp. nov. DH603a FH 01146308 MG662203
DH603b FH 01146308 MG662204

Sequence alignment, nucleotide divergence and phylogenetic analyses

An ITS dataset was constructed to investigate the phylogenetic structure within the genus Stamnaria. Sequences were aligned using Muscle v3.7 (Edgar 2004), available on the Cipres Science Gateway version 3.3 (Miller et al. 2010). Pairwise evolutionary distances, the amounts of genetic variation between two species, were calculated using Paup on XSEDE, also on the Cipres Science Gateway. The p-distance is calculated as the proportion of sites in a pairwise alignment at which the compared sequences are different. This is the number of nucleotide differences divided by the number of nucleotides compared. In addition, Jukes-Cantor (JC69) and Kimura 2-parameter (K2P) distance metrics (Jukes and Cantor 1969, Kimura 1980) were calculated. Neighbour joining (NJ) analyses (Saitou and Nei 1987) were performed to cluster taxa based on the respective distance matrices. The three resulting NJ trees were statistically compared with the SH test (Shimodaira and Hasegawa 1999).

Maximum parsimony (MP) and maximum likelihood (ML) analyses were run using Paup on XSEDE. MP was estimated with heuristic searches consisting of 500 stepwise-addition trees obtained using random sequence addition replicates followed by tree bisection-reconnection (TBR) branch swapping (MulTrees in effect) and saving all equally most parsimonious trees. Robustness of branches was estimated by maximum parsimony bootstrap proportions (BP) using 1000 bootstrap replicates, with heuristic searches consisting of 10 stepwise-addition trees obtained using random sequence addition replicates followed by TBR branch swapping, with MaxTrees set at 100. ML inference was run under a TIM2ef+I+G model of nucleotide substitution, as selected by jModeltest 2.1 (Darriba et al. 2012) following the Akaike Information Criterion. Rapid bootstrapping was implemented with 500 replicates.

Bayesian analyses were done with a Markov chain Monte Carlo (MCMC) coalescent approach implemented in Beast 1.8.4 (Drummond et al. 2012), with a strict clock with uniform rates of evolution across branches. A Yule speciation (Yule 1925) tree prior was selected with the TIM2ef+G nucleotide substitution model (considering the Bayesian Information Criterion from the earlier jModelTest 2.1 analysis). Four independent runs were performed from a random starting tree for 40 million generations, with a sampling frequency of 4000. Tracer 1.6 (Rambaut et al. 2014) was used to check trace plots and effective sample sizes (ESS). Burnin values were 5 % for all runs. Logged parameters were checked to have combined ESS values of at least 200. TreeAnnotator 1.8.4 was used to generate consensus trees with 0 % burnin and to infer the Maximum Clade Credibility (MCC) tree, with the highest product of individual clade posterior probabilities. The different trees with bootstrap values (BS) and posterior probabilities (pp) were visualised in FigTree 1.4.3 (



Stamnaria yugrana Filippova, Haelew. & Baral, sp. nov.

MycoBank No: 823742


Characterised by the presence of both lanceolate and cylindrical paraphyses, fusoid-clavate ascospores with a length/width ratio of predominantly >4 and free-ending hyphae at the inner excipulum of the tube-shaped, even collar. Saprophytic on dead branches of E. sylvaticum.

Figure 1. 

Study site of Stamnaria yugrana growing on litter of Equisetum sylvaticum in Western Siberia near the Khanty-Mansiysk town.


Holotype: Russia, Western Siberia, Khanty-Mansi Autonomous Okrug – Yugra, 25 km ENE of Khanty-Mansiysk town, 1.2 km SSE of Shapsha village, 61.07929"N, 69.46925"E, alt. 40 m, 9 Jun 2012, leg. N.V. Filippova, on fallen side branches of Equisetum sylvaticum L. lying amongst other forest litter in a mixed coniferous-deciduous forest; Biological Collection of Yugra State University (YSU-F-03519). Isotypes: LE-295215; FH 01146308. Paratypes: ibid., 16 Jun 2008 (YSU-F-00097, material lost; LE-295060); ibid., 22 Feb 2014, substrate collected from under snow and grown in a moist chamber (YSU-F-04933); ibid., 25 Feb 2015 (YSU-F-06579; LE-296061).

Figure 2. 

Apothecia of Stamnaria yugrana on side branches of Equisetum sylvaticum: A Apothecia grown in situ under well-lit conditions B Apothecia grown in shady conditions after incubation in a moist chamber C Median section through an apothecium after incubation in a moist chamber (dead, in CR). A from YSU-F-03519, B from YSU-F-04933, C from YSU-F00097. Scale bars: A 1.0 mm, B, C 0.5 mm.


Apothecia urn-shaped, stipitate, 0.25–0.6 mm in diameter when mature, 0.5–1 mm high, varying depending on light conditions, being stouter with shorter stipe when substrate exposed to sunlight; receptacle light yellow(-ochraceous) when fresh, with even, whitish collar ~80–120 µm high, stipe pale yellowish-translucent, 100–380 × 130–300 µm, receptacle becoming light brown on drying; scattered to moderately gregarious, often abundant on the branches. Ectal excipulum outer layer *40–45 µm thick at middle flanks and margin, made up of strongly gelatinous tissue of loose, parallel to wavy hyphae 2–3 μm broad, septate, embedded in abundant gelatinous matrix (textura oblita); inner layer *~45 µm thick at middle flanks, made up of textura prismatica-porrecta running parallel to outside, cells at middle flanks *17–44 × 7–12 μm, slightly narrower in the collar region, much narrower in stipe (*20–45 × 3–5 µm); the inner layer of the collar composed of narrow hyphae, free upper part of these hyphae internally covered by lateral cellular outgrowths *2–5 × 1.5–2 µm. Medullary excipulum well developed, of dense, parallel, septate hyphae (textura porrecta) without gel, cells *65–90 × 2.5–6 (–7.7) μm; subhymenium well developed (*20–30 thick), of intricate hyphae *2 μm broad. Asci cylindrical, developing from croziers which are difficult to see in mature asci, with apical thickening enclosing a hemiamyloid ring of Calycina-type (rb: dirty red at high, blue at low concentration), *146 × 12.5 [123–159 (–206) × 11.7–13.5] μm, †98 × 9 (90–110 × 8–10.5) μm, 8-spored, spores *obliquely biseriate. Paraphyses of two types: (1) lanceolate, exceeding asci for *12–20 µm when young and *30–40 μm when fully developed, septate in lower part, non-septate in broad upper part, with quite acute tip, in young paraphyses with granular (multiguttulate) vacuolar content of moderate refractivity (VBs), later replaced by larger non-refractive vacuoles, *5–7 (†3–6) μm broad in upper part; (2) cylindrical, more abundant, not exceeding the asci, *2.3–3 μm broad above, septate, with obtuse tip, rarely branched below and scarcely enlarged in upper segment, without VBs, with pale yellow-orange pigment in middle and lower part. Ascospores fusoid-clavate, slightly to distinctly heteropolar, with rounded to obtuse ends, usually without any gel around, filled with granular oil content in both halves, leaving a central zone for the single nucleus, variable in length, *19.8 × 4.8 (16.5–24.5 × 4.2–5.6), n=18, Q=4.1 (YSU-F-04933); †20.5 × 4.0 (17.2–24.2 × 3.6–4.6) μm, n=37, Q=5.1 (YSU-F-03519, YSU-F-04933).

Figure 3. 

A1 Young living paraphysis with multiguttulate, medium refractive vacuolar content (VBs), A2 Mature living paraphysis with large non-refractive vacuoles A3 Dead paraphysis with small oil drops (LBs), vacuoles disappeared B Paraphyses of cylindrical and lanceolate type C Mature living asci D Mature ejected ascospores with granular lipid content of minute LBs (confluent in dead state) E Ascus bases with croziers F Apices of mature and immature ascus (stained in IKI). All * and F from YSU-F-04933, all other † from YSU-F-00097. Scale bars: A, D, E, F 10 μm, B, C 20 μm.


Referring to Yugra, the historical name of the region (currently “Khanty-Mansi Autonomous Okrug – Yugra”).


Known only from the type locality.

Nucleotide alignment dataset and phylogenetic inferences

The ITS rDNA dataset consists of 16 isolates and 671 characters, of which 387 are constant and 187 are parsimony-informative. Taxonomical sampling covers the genera Hymenoscyphus Gray (1 isolate), Leotia Pers. (1), Microglossum Gillet (1), Rommelaarsia Baral & Haelew. (1), Roseodiscus Baral (1) and Stamnaria (8); Geoglossum Pers. (2) and Sarcoleotia S. Ito & S. Imai (1) served as outgroup taxa (Geoglossomycetes, Geoglossales, sensu Schoch et al. 2006). This dataset includes the three currently recognised species in the genus Stamnaria.

Figure 4. 

A Median section through receptacle, showing gelatinised outer layer of ectal excipulum B Median section through stipe, showing outer gelatinised layer, inner layer of textura porrecta (orange) and transition to medullary excipulum C Medullary excipulum in squash mount D Inner part of collar in squash mount showing hyphae forming outgrowths (single hyphae shown in insert) E Ectal excipulum of textura prismatica at receptacle flank in squash mount (outer layer absent). All stained by CR in water (cells partly in vital state), from YSU-F-04933. Scale bars: 10 μm.

Intra-specific divergence in the ITS region ranges from 0.0 to 0.9 % while inter-specific divergences range between 8.0 and 13.7 % (p-distances) or between 8.4–8.5 and 15.1 % (JC69, K2P). The p-distances are 8.0 % between S. americana and S. persoonii, 10.6 % between S. persoonii and S. yugrana and 13.7 % between S. americana and S. yugrana. JC69 and K2P distances are almost identical, higher but equivalent to the p-distances (Table 2). The NJ phenogram constructed from the Jukes–Cantor distance matrix has a higher likelihood score (-lnL = 791.63111) compared to the analyses based on p-distances and Kimura 2-parameter distances, but the differences are insignificant.

Table 2.

Intra- and interspecific distances for and between S. americana, S. persoonii and S. yugrana. Distances are given as percentages (%).

p-distance JC69 K2P
S. americana, intraspecific 0.2 0.2 0.2
S. persoonii, intraspecific 0.9 0.9 0.9
S. yugrana, intraspecific 0.0 0.0 0.0
S. americanaS. persoonii 8.0 8.4 8.5
S. americanaS. yugrana 13.7 15.1 15.1
S. persooniiS. yugrana 10.6 11.4 11.4

The genus Stamnaria is retrieved as a monophyletic clade in all three phylogenetic reconstructions (MPBS = 74, MLBS = 98, pp = 1.0). All morphologically delineated species of Stamnaria have maximum support. The position of the new species within the genus is unresolved. Under MP and ML inference, S. yugrana is sister to S. persoonii but this sister relationship is only supported by MLBS = 81. In the Bayesian analysis, on the other hand, S. yugrana is sister to (S. americana, S. persoonii), with moderate support for the sister relationship between the two latter species (pp = 0.8).

Figure 5. 

Bayesian MCC tree, with node values indicating posterior probabilities (above) and MP/ML bootstrap values (below). Thick branches indicate maximum Bayesian support (pp = 1.0). Photos of apothecia (left) and drawings of ascospores (right) from top to bottom: S. yugrana, holotype, YSU-F-03519, Russia, 9 Jun 2012; S. persoonii, Gilbert Moyne, H.B. 8889, France, 24.VI.2008; S. americana, Claude Page, France, 7 Apr 2016 (first French report in Moingeon and Page 2003). Scale bar: 20 µm.


The morphological and ecological features of S. yugrana (Table 3) are considerably different compared to the two previously recognised species, the most pronounced features being paraphyses of two types, including strongly protruding, broadly lanceolate ones and heteropolar, comparatively narrow ascospores. No previous reports of a Stamnaria species with ascertained identity are known from E. sylvaticum, when applying the revised species concept as reviewed in the introduction. Jaap (1922) presented a report of S. persoonii on E. sylvaticum but did not provide a morphological description. It is impossible to assess whether this report represents S. persoonii or S. yugrana because the collection does not seem to have been preserved (no voucher number cited).

Stamnaria yugrana differs from S. americana by solitary, never fasciculate, distinctly stalked apothecia, presence of a pronounced raised collar with free-ending hyphae at its inner excipulum, presence of two types of paraphyses (cylindrical and lanceolate) and shorter and especially narrower, fusoid-clavate ascospores (Table 3). The ecology of these two species is also quite different: the apothecia of S. americana occur on living stems of Equisetum hyemale, while those of S. yugrana are found on dead fallen side branches of E. sylvaticum. Both S. yugrana and S. persoonii have stipitate apothecia with a distinct collar. However, S. yugrana differs by the presence of paraphyses of two types and much narrower, heteropolar spores with higher length/width ratio (Table 3). Apothecia of S. persoonii also grow on dead stems, but on another host plant, E. fluviatile (Gruber 2006).

Table 3.

Comparison of the ecological and morphological characteristics between described Stamnaria species.

Species S. americana S. persoonii S. yugrana
Host association Parasitic on E. hyemale Saprophytic on E. fluviatile, rarely on E. arvense Saprophytic on E. sylvaticum
Apothecia, diameter 0.3–0.7 (–1.0) mm 0.4–1.0 mm 0.25–0.6 mm
Apothecia, margin Without collar With even collar With even collar
Asci, measurements *(110–) 140–190 (–210) × 13.5–14.6 μm, †120–157 × (11.5–) 12–14 (–15) μm *190–230 × 14–16 μm, †130 × 12 μm *123–159 (–206) × 11.7–13.5 μm, †90–110 × 8.0–10.5 μm
Asci, apex Inamyloid, thin-walled With thick amyloid ring With thick amyloid ring
Ascospores, measurements *(22–) 24–28 (–34) × (6–) 6.5–7.5 (–8.4) μm, †20–29 × 5.5–7.0 μm *16–23 × 7.5–9.5 μm, †15–18 × 5.0–8.0 μm *16.5–24.5 × 4.2–5.6 μm, †16.5–23.2 × 4.0–4.8 μm
Ascospores, shape Fusoid, not or only slightly heteropolar Broadly ellipsoid with rounded ends Fusoid-clavate
Paraphyses Cylindrical, with apical part enlarged to *4.0–6.7 μm Cylindrical, with apical part enlarged to *2.5–4.5 µm Lanceolate, strongly exceeding, *5–7 (†3–6) μm broad; and cylindrical, not exceeding, *2.3–3.0 μm broad above
Reference Künkele et al. (2005) Dennis (1968), H.-O. Baral (pers. obs.) This paper

Many Stamnaria collections have been misidentified and/or reported under misidentified host plants. Currently, the Stamnaria lineage has no taxonomic assignment at the family level. In their ITS+LSU rDNA phylogeny, Baral et al. (2015) retrieved it as a sister clade to Erysiphales, but without support for this sister relationship. Baral and Haelewaters (2015) found a sister relationship of Stamnaria and Roseodiscus, although only moderately supported by Bayesian analysis (pp = 0.83). Hosoya et al. (2013) suggested a transfer of the genus Stamnaria from Helotiaceae to the small family Leotiaceae. This was based on the strongly supported sister relationship with Leotia lubrica (Scop.) Pers. obtained in the maximum parsimony multigene analysis using rDNA, EF1 and RPB genes, with bootstrap values of 100 from neighbour-joining and 99 from maximum parsimony. Morphologically, Hosoya et al. (2013) mentioned “a gelatinized layer in the external part of apothecia” as a synapomorphic character and suggested to include Stamnaria in Leotiaceae in a restricted sense, which traces back to a concept introduced by Korf & Lizoň (2001). However, recent molecular research indicated that the family Leotiaceae includes solely soil-inhabiting species with large ascomata with convex, pileate or clavate fertile part. Amongst the genera in this family, Leotia Pers. is the only one showing a gelatinised external layer outside the ectal excipulum (Baral in Jaklitsch et al. 2016). In addition, the ascospores of Leotiaceae consistently contain large oil drops (Baral in Jaklitsch et al. 2016), unlike Stamnaria.

Detailed morphological studies in the genus Stamnaria by Gruber (2006) revealed several other species, including collections that had been misidentified as S. americana or S. persoonii (sensuMagnes and Hafellner 1991, Brunelli 1992, Künkele et al. 2005). The author proposed several new names for species that he considered undescribed, but they have not been validly published. Formal descriptions of these new species along with molecular phylogenetic analyses are planned in the near future. It is clear that the genus Stamnaria is in need of thorough revision. The discovery and detailed description of S. yugrana will help in the further delimitation of the genus.


The authors are very thankful to Erwin Gruber (Karl-Franzens-Universität, Graz, Austria) for providing collections that were used in molecular analyses, to Ove Eriksson (Umeå University, Sweden) for valuable information during the course of this study and to Kanchi Gandhi (Harvard University Herbaria) for nomenclatural advice. Nadia L. Urrea (Harvard College) is acknowledged for providing assistance in the molecular lab. This study was partially supported by two Russian Foundation of Basic Research grants (Nos. 18-34-00291 & 18-44-860017).


  • Baral HO, Haelewaters D (2015) Rommelaarsia flavovirens gen. et sp. nov. (Helotiales), a new discomycete on Equisetum with a peculiar asexual state. Ascomycete. org 7: 321–330.
  • Baral HO, Haelewaters D, Pärtel K (2015) A new attempt to classify the families of the Helotiales. Poster presented at the Ascomycete Workshop in Amsterdam. [April 2015]
  • Brunelli F (1992) Anmerkungen zu Stamnaria americana Massee & Morgan. Schweizerische Zeitschrift für Pilzkunde 70(4): 107–108.
  • Bulatov VI (2007) Geography and ecology of Khanty-Mansiysk and its surroundings. Khanty-Mansiysk, 187 pp.
  • Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9: 772–772.
  • Dennis RWG (1968) British ascomycetes. Cramer, Lehre, 455 pp.
  • Drummond AJ, Suchard MA, Xie D, Rambaut A (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29: 1969–1973.
  • Gruber E (2006) Studien über die equiseticole Gattung Stamnaria Fuckel (Ascomycota, Helotiales, Helotiaceae), einschließlich ökologischer Beobachtungen in der Steiermark (Österreich). Thesis, Karl-Franzens-Universität, Graz, Austria.
  • Harrington FA (1990) Sarcoscypha in North America (Pezizales, Sarcoscyphaceae). Mycotaxon 38: 417–458.
  • Hosoya T, Saito Y, Harada Y, Tanaka Y, Zhao YJ, Kakishima M (2013) Stamnaria americana, new to Japan and occurring on Equisetum stems. Mycosystema 32: 448–456.
  • Jaap O (1922) Weitere Beiträge zur Pilzflora von Triglitz in der Prignitz. Verhandlungen des Botanischen Vereins der Provinz Brandenburg 64: 1–60.
  • Jaklitsch W, Baral HO, Lücking R, Lumbsch HT (2016) Ascomycota. In: Frey W (Ed.) Engler’s syllabus of plant families.13th edition. Borntraeger Science Publisher, 1–322.
  • Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111–120.
  • Korf RP, Lizoň P (2001) The status of the ordinal name Leotiales. Czech Mycology 52: 255–257.
  • Künkele U, Lohmeyer TR, Baral HO (2005) Stamnaria americana, ein in Auwäldern vermutlich häufiger, aber aus Deutschland bisher nicht berichteter Parasit an Equisetum hyemale [Stamnaria americana, an in riverside forests presumably common, but in Germany hitherto overlooked parasite on Equisetum hyemale]. Mycologia Bavarica 7: 3–20.
  • Larena I, Salazar O, González V, Julián MC, Rubio V (1999) Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. Journal of Biotechnology 75(2): 187–194.
  • Magnes M, Hafellner J (1991) Ascomyceten auf Gefäßpflanzen an Ufern von Gebirgsseen in den Ostalpen. Bibliotheca Mycologica 139: 1–185.
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proc. Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA, 1–8.
  • Moingeon J-M, Page C (2003) Stamnaria americana Massee et Morgan: premières récoltes françaises. Bulletin de la fédération Mycologique de l’Est 1: 6–12.
  • Saccardo PA (1889) Sylloge fungorum omnium hucusque cognitorum. Vol. VIII. Sumptibus auctoris. Patavii, Italy, 1–1143.
  • Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406–425.
  • Schoch CL, Wang Z, Townsend JP, Spatafora JW (2009) Geoglossomycetes cl. nov., Geoglossales ord. nov. and taxa above class rank in the Ascomycota Tree of Life. Persoonia 22: 129–138.
  • Sydow P (1898) Sylloge fungorum omnium hucusque cognitorum 13. Patavii.
  • von Höhnel F (1928) Über die Gattung Titaeospora Bubák. Mitteilungen aus dem Botanischen Institut der Technischen Hochschule in Wien 5: 1–4.
  • Viereck LA (1983) The effects of fire in black spruce ecosystems of Alaska and Northern Canada. In: Wein RW, MacLean DA (Eds) The role of fire in northern circumpolar ecosystems.John Wiley and Sons, New York, 201–220.
  • Yule GU (1925) A mathematical theory of evolution, based on the conclusions of Dr. JC Willis, FRS. Philosophical Transactions of the Royal Society of London B 213: 21–87.