Morphological and phylogenetic evidence reveals three new arthropod-associated species of Hypocreales (Clavicipitaceae, Bionectriaceae, and Myrotheciomycetaceae) from karst habitats in Guizhou, China

Wan-Hao Chen; Hui-Lin Shu; Dan Li; Jian-Dong Liang; Xiu-Xiu Ren; Nalin N. Wijayawardene; Yan-Feng Han; Jie-Hong Zhao

doi:10.3897/mycokeys.123.164334

Research Article

Morphological and phylogenetic evidence reveals three new arthropod-associated species of Hypocreales (Clavicipitaceae, Bionectriaceae, and Myrotheciomycetaceae) from karst habitats in Guizhou, China

Wan-Hao Chen^‡§|, Hui-Lin Shu^‡, Dan Li^‡, Jian-Dong Liang^‡|, Xiu-Xiu Ren^‡, Nalin N. Wijayawardene^¶#, Yan-Feng Han^§, Jie-Hong Zhao^‡

‡ Guizhou University of Traditional Chinese Medicine, Guiyang, China

§ Guizhou University, Guiyang, China

| Key Laboratory of Microbio and Infectious Disease Prevention & Control in Guizhou Province, Guiyang, China

¶ Qujing Normal University, Qujing, China

# Tropical Microbiology Research Foundation, Pannipitiya, Sri Lanka

Corresponding author: Yan-Feng Han ( swallow1128@126.com )

Corresponding author: Jie-Hong Zhao ( zhaojiehong020@gzy.edu.cn )

Academic editor: Marc Stadler

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation: Chen W-H, Shu H-L, Li D, Liang J-D, Ren X-X, Wijayawardene NN, Han Y-F, Zhao J-H (2025) Morphological and phylogenetic evidence reveals three new arthropod-associated species of Hypocreales (Clavicipitaceae, Bionectriaceae, and Myrotheciomycetaceae) from karst habitats in Guizhou, China. MycoKeys 123: 319-353. https://doi.org/10.3897/mycokeys.123.164334

The karst regions of southwest China are rich in biodiversity and have critically threatened ecosystems, harboring unique species that could be new to science. During the investigations of arthropods associated-fungi, several fungal strains were collected. Among these, three new species, Conoideocrella tiankengensis sp. nov. (Clavicipitaceae), Ovicillium zunyiense sp. nov. (Bionectriaceae) and Trichothecium sinense sp. nov. (Myrotheciomycetaceae), isolated from a dead scale insect, larva and spider, respectively, were introduced as novel taxa, based on the morphological characteristics and DNA-based phylogenetic analyses. This is the first time that a species from Myrotheciomycetaceae is reported from the karst habitats. In addition, the genus Myrotheciomyces is treated as a synonym of Trichothecium based on the phylogenetic analysis, and the type species of the former is transferred to the latter genus.

Key words:

Insect, karst, morphology, phylogenetic analysis, spider

Introduction

Karst regions, particularly those in southwest China, harbor vast tracts of well-preserved primary forests with exceptionally high biodiversity (Wijayawardene et al. 2021; Sun et al. 2023, 2024). The intricate ecosystems and unique geological conditions of these areas serve as important microhabitats for numerous ancient species (Özkan et al. 2010; Su et al. 2017). Moreover, the region is now recognized as one of the most critically threatened biodiversity hotspots globally due to the unique and highly fragile nature of its ecosystem and anthropogenic activities (Long et al. 2024). Hence, urgent conservation measures are needed to protect these vulnerable ecosystems (Wu and Zhang 2020; Duan et al. 2021).

Guizhou Province, a quintessential karst region in China, is characterized by its crisscrossing mountain ranges and dramatic elevation variations. These topographical contrasts have fostered diverse microenvironments, shaping intricate ecosystems that support a wide array of species across distinct habitats (Liu et al. 2018). As a key hub of biodiversity, Guizhou Province hosts exceptional ecological richness (Xu et al. 2017).

Wijayawardene et al. (2021) regarded the Guizhou and Yunnan Provinces as mycological hotspots. Annually, a large number of novel fungal species are introduced from different substrates, including arthropods, and these taxa could be parasitic or saprobes of insects and spiders (e.g. Chen et al. 2024a, b, d). Recent studies reported new arthropod-associated fungi that are accommodated in nine families (For a list of the species, see Suppl. material 1), viz., Bionectriaceae (Chen et al. 2024a; Wang et al. 2025a), Calcarisporiaceae (Chen et al. 2024b), Clavicipitaceae (Chen et al. 2022a), Cordycipitaceae (Chen et al. 2023; Bu et al. 2025), Hypocreaceae (Tarafder et al. 2024), Nectriaceae (Wang et al. 2024), Ophiocordycipitaceae (Chen et al. 2024c; Peng et al. 2024; Xu et al. 2025), Polycephalomycetaceae (Chen et al. 2024c), Tilachlidiaceae (Liang et al. 2016) from Guizhou Province.

During a survey of arthropod-associated species in Hypocreales from southwestern China, several specimens were collected, and fungal strains were isolated and purified. Isolated strains were identified based on the multigene phylogeny and morphological characteristics, and three new species introduced, i.e. Conoideocrella tiankengensis sp. nov., Ovicillium zunyiense sp. nov. and Trichothecium sinensesp. nov., which belong to the families Clavicipitaceae, Bionectriaceae and Myrotheciomycetaceae, respectively. This is the first report of a taxon from the family Myrotheciomycetaceae reported in the Guizhou karst habitats. Moreover, the type species of Myrotheciomyces, M. corymbiae resided in Trichothecium s. str. Thus, Myrotheciomyces is regarded as a synonym of Trichothecium.

Materials and methods

Specimen collection and isolation

The specimens were collected from Monkey-Ear Tiankeng (27°5'12.138"N, 107°40'48.42"E), Kaiyang County, Guiyang City, Mayao River Valley (26°21'24.71"N, 107°22'48.22"E), Duyun City, Qiannan Buyi and Miao Autonomous Prefecture and Dabanshui National Forest Park (27°46'35.904"N, 106°48'30.89"E), Honghuagang District, Zunyi City, Guizhou Province, on 6^th April 2024, 1^st May 2022 and 2^nd September 2023, respectively. The samples were placed in sterile bags, kept separately on ice, and transported to the laboratory. Specimens were preserved in the refrigerator at 4 °C until further processing.

The surface of each arthropod body was rinsed with sterile water, followed by sterilization with 75% ethanol for 3–5 s and rinsing again three times with sterilized water. After drying on sterilized filter paper, a piece of the mycelium or sclerotium was cut from the specimen and placed on plates of potato dextrose agar (PDA) (Potato powder 6%, Agar 20%, Glucose 20%, Beijing Solarbio Technology Co., Ltd., China) or PDA modified by the addition of 1% w/v peptone (Beijing Solarbio Technology Co., Ltd., China) containing 0.1 g/l streptomycin (Beijing Solarbio Technology Co., Ltd., China) and 0.05 g/l tetracycline (Beijing Solarbio Technology Co., Ltd., China) (Chen et al. 2019). After fungal colonies emerged from the plated samples, a piece of mycelium from the colony edge was transferred onto new agar plates and cultured at 25 °C for 14 days under 12 h light/12 h dark conditions (Zou et al. 2010).

Morphological study

Colony characteristics were determined on PDA cultures incubated at 25 °C for 14 days, and growth rate, presence of octahedral crystals and colony colors (surface and reverse) were observed. To investigate microscopic characteristics, a little of the mycelia was picked up from the colony and mounted in lactophenol cotton blue or 20% lactic acid solution and the asexual morphological characteristics (e.g., conidiophores, phialides or conidiogenous cells, and conidia) were observed and measured using a Leica DM4 B microscope.

Maintenance and deposition of type materials and registration of novel taxa

The holotypes and ex-type cultures were deposited at the Institute of Fungus Resources, Guizhou University (formerly Herbarium of Guizhou Agricultural College; code, GZAC), Guiyang City, Guizhou, China. MycoBank numbers were obtained for novel taxa as outlined in MycoBank (http://www.MycoBank.org) (Crous et al. 2004).

DNA extraction, polymerase chain reaction amplification (PCR) and nucleotide sequencing

DNA extraction was carried out using a fungal genomic DNA extraction kit (DP2033, BioTeke Corporation) according to Liang et al. (2011). The extracted DNA was stored at −20 °C. Polymerase chain reaction (PCR) was used to amplify genetic markers using the following primer pairs: ITS5/ITS4 for the internal transcribed spacer (ITS) region (White et al. 1990), LR0R/LR5 for 28S large subunit ribosomal RNA gene (LSU) (Vilgalys and Hester 1990), fRPB2-5F/fRPB2-7cR for RNA polymerase II second largest subunit (RPB2) (Liu et al. 1999) and 983F/2218R for translation elongation factor 1 alpha (tef-1α) (Castlebury et al. 2004). The thermal cycle conditions of PCR amplification for these phylogenetic markers were set up following the procedure described by Chen et al. (2021) (Table 1). The PCR products were purified and sequenced at Sangon Biotech (Shanghai) Co. All newly generated sequences were deposited in GenBank and accession numbers were obtained (Table 2).

Table 1.

Download as

CSV

XLSX

List of primer information used in this study.

Locus	Primer	Length	Direction	Sequence 5’-3’	Optimised PCR protocols	References
ITS	ITS5	22	forward	GGAAGTAAAAGTCGTAACAAGG	(95 °C: 30 s, 51 °C: 50 s, 72 °C:45 s) × 33 cycles	White et al. 1990
ITS	ITS4	20	reverse	TCCTCCGCTTATTGATATGC	(95 °C: 30 s, 51 °C: 50 s, 72 °C:45 s) × 33 cycles	White et al. 1990
LSU	LROR	17	forward	ACCCGCTGAACTTAAGC	(94 °C: 30 s, 51 °C: 1 min,72 °C: 2 min) × 33 cycles	Vilgalys and Hester 1990
LSU	LR5	17	reverse	TCCTGAGGGAAACTTCG	(94 °C: 30 s, 51 °C: 1 min,72 °C: 2 min) × 33 cycles	Vilgalys and Hester 1990
RPB2	RPB2-5F3	20	forward	GACGACCGTGATCACTTTGG	(94 °C: 30 s, 54 °C: 40 s, 72 °C:1 min 20 s) × 33 cycles	Liu et al. 1999
RPB2	RPB2-7Cr2	20	reverse	CCCATGGCCTGTTTGCCCAT	(94 °C: 30 s, 54 °C: 40 s, 72 °C:1 min 20 s) × 33 cycles	Liu et al. 1999
tef-1α	983F	23	forward	GCYCCYGGHCAYCGTGAYTTYAT	(94 °C: 30 s, 58 °C: 1 min 20 s,72 °C: 1 min) × 33 cycles	Castlebury et al. 2004
tef-1α	2218R	23	reverse	ATGACACCRACRGCRACRGTYTG	(94 °C: 30 s, 58 °C: 1 min 20 s,72 °C: 1 min) × 33 cycles	Castlebury et al. 2004

Table 2.

Download as

CSV

XLSX

List of strains and GenBank accession numbers of sequences used in this study.

Species	Strain No.	GenBank Accession No.				Reference
Species	Strain No.	ITS	LSU	RPB2	tef-1α	Reference
Acremonium alternatum	CBS 407.66^T	OQ429442	OQ055353	OQ560696	OQ470739	Hou et al. 2023
A. egyptiacum	CBS 114785^T	OQ429456	OQ055362	OQ453845	OQ470749	Hou et al. 2023
Akanthomyces aculeatus	HUA 772	KC519371	-	-	KC519366	Sanjuan et al. 2014
Albacillium hingganense	SGSF339^T	OR740562	OR740566	OR769081	MN065771	Ding et al. 2024
Bionectria ochroleuca	AFTOL-ID 187	-	DQ862027	DQ862013	DQ862029	Zhang et al. 2006
B. vesiculosa	HMAS 183151^T	HM050304	HM050302	-	-	Luo and Zhuang 2010
Bulbithecium arxii	CBS 737.84 ^T	OQ429505	OQ055416	OQ451834	OQ470794	Hou et al. 2023
B. borodinense	CBS 101148 ^T	OQ429506	OQ055417	-	OQ470795	Hou et al. 2023
B. pinkertoniae	CBS 157.70 ^T	OQ429509	OQ055420	OQ453898	OQ470799	Hou et al. 2023
B. spinosum	CBS 136.33 ^T	OQ429512	OQ055423	OQ453899	OQ470802	Hou et al. 2023
Calcarisporium arbuscula	CBS 221.73^T	AY271809	-	-	-	Sun et al. 2016
C. arbuscula	CBS 900.68	KT945003	KX442598	KX442597	KX442596	Sun et al. 2017
C. cordycipiticola	CGMCC 3.17905^T	KT944999	KX442599	KX442594	KX442593	Sun et al. 2016
C. cordycipiticola	CGMCC 3.17904	KT945001	KX442604	KX442607	KX442605	Sun et al. 2016
C. xylariicola	HMAS 276836^T	KX442603	KX442601	KX442606	KX442595	Sun et al. 2017
Calonectria ilicicola	CBS 190.50	GQ280605	GQ280727	KM232307	AY725726	Lombard et al. 2010
Cephalosporium curtipes	CBS 154.61	AJ292404	AF339548	EF468947	EF468802	Sung et al. 2007
Claviceps fusiformis	ATCC 26019	JN049817	U17402	-	DQ522320	Spatafora et al. 2007
Clonostachys phyllophila	CBS 921.97^T	AF210664	OQ055445	OQ453921	OQ470826	Hou et al. 2023
C. rosea	GJS90-227	-	AY489716	-	AY489611	Castlebury et al. 2004
C. spinulosispora	CBS 133762^T	MH634702	KY006568	-	-	Zhao et al. 2025
Cocoonihabitus sinensis	HMAS254523^T	KY924870	KY924869	-	-	Zhuang and Zeng 2017
C. sinensis	HMAS254524	MF687395	MF687396	-	-	Zhuang and Zeng 2017
Conoideocrella fenshuilingensis	YHH CFFSL2310002^T	-	PP178583	-	PP776168	Wang et al. 2024
C. fenshuilingensis	YHH CFFSL2310003	-	PP178584	-	PP776169	Wang et al. 2024
C. gongyashanensis	CGMCC 3.28305^T	-	PQ278801	PQ334678	PQ301442	Lin et al. 2025
C. gongyashanensis	CGMCC 3.28306	-	PQ278802	PQ334679	PQ301443	Lin et al. 2025
C. krungchingensis	BCC 36100^T	-	KJ435080	-	KJ435097	Mongkolsamrit et al. 2016
C. krungchingensis	BCC 36101	-	KJ435081	-	KJ435098	Mongkolsamrit et al. 2016
C. luteorostrata	NHJ 11343	-	EF468850	-	EF468801	Sung et al. 2007
C. luteorostrata	NHJ 12516	-	EF468849	EF468946	EF468800	Sung et al. 2007
C. tenuis	NHJ 6791	-	EU369046	EU369089	EU369028	Johnson et al. 2009
C. tenuis	NHJ 6293	-	EU369044	EU369087	EU369029	Johnson et al. 2009
C. tenuis	NHJ 345.01	-	EU369045	EU369088	EU369030	Johnson et al. 2009
C. tiankengensis	KY04071^T	PV688356	PV688364	PV705684	PV705692	This study
C. tiankengensis	KY04072	PV688357	PV688365	PV705685	PV705693	This study
Cordyceps brongniartii	BCC16585	JN049867	JF415967	JF415991	JF416009	Sung et al. 2007
C. militaris	OSC93623^T	JN049825	AY184966	-	DQ522332	Sung et al. 2007
Dactylonectria alcacerensis	CBS 129087	JF735333	KM231629	-	JF735819	Cabral et al. 2012
Elaphocordyceps ophioglossoides	NBRC 106332^T	JN943322	JN941409	-	-	Schoch et al. 2012
E. paradoxa	NBRC 106958	JN943324	JN941411	-	-	Schoch et al. 2012
Emericellopsis brunneiguttula	CBS 111360^T	OQ429545	OQ055457	OQ453932	OQ470838	Hou et al. 2023
E. microspora	CBS 380.62^T	OQ429567	OQ055481	OQ453967	OQ470875	Hou et al. 2023
E. salmosynnemata	CBS 182.56^T	OQ429579	OQ055492	OQ453977	OQ470887	Hou et al. 2023
E. terricola	CBS 120.40^T	OQ429582	OQ055495	OQ453980	OQ470890	Hou et al. 2023
Epichloe typhina	ATCC 56429	JN049832	U17396	DQ522440	AF543777	Spatafora et al. 2007
Flammocladiella aceris	CPC 24422^T	KR611883	KR611901	-	-	Crous et al. 2015
Fusarium circinatum	CBS 405.97	U61677	-	JX171623	KM231943	Lombard et al. 2015
F. sublunatum	CBS 189.34	HQ897830	KM231680	-	-	Lombard et al. 2015
Gelasinospora tetrasperma	AFTOL-ID 1287^T	-	DQ470980	DQ470932	DQ471103	Spatafora et al. 2006
Haptocillium sinense	CBS 567.95	AJ292417	AF339545	-	-	Sun et al. 2017
Hydropisphaera erubescens	ATCC 36093^T	-	AF193230	AY545731	DQ518174	Sun et al. 2017
H. lutea	ATCC 208838	-	AF543791	DQ522446	AF543781	Sun et al. 2017
H. peziza	GJS92-101^T	-	AY489730	-	AY489625	Sun et al. 2017
H. rufa	DAOM JBT1003	JN942883	JN938865	-	-	Sun et al. 2017
Hypocrea americana	AFTOL-ID 52	DQ491488	AY544649	-	DQ471043	Sun et al. 2017
Hypocrella discoidea	BCC 8237	JN049840	DQ384937	DQ452461	DQ384977	Sun et al. 2017
Hypomyces polyporinus	ATCC 76479	-	AF543793	-	AF543784	Sun et al. 2017
Lecanicillium attenuatum	CBS 402.78	AJ292434	AF339565	EF468935	EF468782	Sun et al. 2017
L. lecanii	CBS 101247	JN049836	KM283794	KM283859	DQ522359	Sun et al. 2017
L. psalliotae	CBS 367.86	-	KM283800	-	KM283823	Park et al. 2015
Metapochonia gonioides	CBS 891.72^T	AJ292409	AF339550	DQ522458	DQ522354	Sun et al. 2017
Metarhiziopsis microspora	CEHS133a	EF464589	EF464571	-	-	Li et al. 2008
M. microspora	INEHS133a	EF464583	EF464572	-	-	Li et al. 2008
Metarhizium anisopliae	CBS 130.71^T	MT078884	MT078853	MT078918	MT078845	Sung et al. 2017
M. flavoviride	CBS 125.65	MT078885	MT078854	MT078919	MT078846	Sung et al. 2017
M. flavoviride	CBS 218.56^T	MH857590	MH869139	-	KJ398787	Sung et al. 2017
Myrotheciomyces corymbiae	CPC 33206^T=CBS 144420	NR_160351	NG_064542	-	-	Crous et al. 2018
M. corymbiae	CBS 144420	-	OR052125	-	OQ471031	Hou et al. 2023
Myrothecium inundatum	IMI158855^T	-	AY489731	-	AY489626	Castlebury et al. 2004
M. roridum	ATCC 16297	-	AY489708	-	AY489603	Castlebury et al. 2004
M. verrucaria	ATCC 9095	-	AY489713	-	AY489608	Castlebury et al. 2004
Nectria cinnabarina	CBS 125165	HM484548	HM484562	KM232402	HM484527	Sun et al. 2017
N. nigrescens	CBS 125148^T	HM484707	HM484720	KM232403	HM484672	Sun et al. 2017
Nectriopsis violacea	CBS 424.64^T	-	AY489719	-	-	Castlebury et al. 2004
Neoaraneomyces araneicola	DY101711^T	MW730520	MW730609	MW753026	MW753033	Chen et al. 2022
N. araneicola	DY101712	MW730522	MW730610	MW753027	MW753034	Chen et al. 2022
Neobarya parasitica	Marson s/n^T	KP899626	KP899626	-	-	Lawrey et al. 2015
Neonectria candida	CBS 151.29	JF735313	AY677333	-	JF735791	Sun et al. 2017
N. faginata	CBS 217.67	HQ840385	HQ840382	DQ789797	JF268746	Sun et al. 2017
N. neomacrospora	CBS 118984	HQ840388	HQ840379	DQ789810	JF268754	Sun et al. 2017
N. ramulariae	CBS 182.36^T	HM054157	HM042435	DQ789793	HM054092	Sun et al. 2017
Neurospora crassa	ICMP 6360	AY681193	AY681158	-	-	Cai et al. 2006
Niesslia exilis	CBS 560.74	-	AY489720	-	AY489614	Castlebury et al. 2004
Ophiocordyceps heteropoda	EFCC 10125	JN049852	EF468812	EF468914	EF468752	Sung et al. 2007
O. sinensis	EFCC 7287	JN049854	EF468827	EF468924	EF468767	Sung et al. 2007
O. stylophor	OSC 111000	JN049828	DQ518766	DQ522433	DQ522337	Sung et al. 2007
Orbiocrella petchii	NHJ 6240	-	EU369038	EU369082	EU369022	Johnson et al. 2009
O. petchii	NHJ 6209	-	EU369039	EU369081	EU369023	Johnson et al. 2009
O. petchii	NHJ 5318	-	EU369040	EU369080	EU369021	Johnson et al. 2009
Ovicillium asperulatum	CBS 130362^T	OQ429756	OQ055655	OQ454167	OQ471082	Hou et al. 2023
O. asperulatum	CBS 426.95	KU382192	KU382233	OQ454166	OQ471081	Hou et al. 2023
O. attenuatum	CBS 399.86^T	OQ429757	OQ055656	OQ454168	OQ471083	Hou et al. 2023
O. attenuatum	CBS 112092	PV272703	PV272923	-	PV273483	Hou et al. 2023
O. oosporum	CBS 110151^T	OQ429758	OQ055657	OQ454169	OQ471084	Hou et al. 2023
O. oosporum	CBS 403.89	PV272717	PV272937	PV273301	PV273497	Hou et al. 2023
O. pseudoattenuatum	GMBC 3007^T	PQ726817	PQ726842	PQ779073	PQ758607	Wang et al. 2025
O. pseudoattenuatum	GMBC 3008	PQ726818	PQ726843	PQ779074	PQ758608	Wang et al. 2025
O. sinense	SD09701^T	PP836762	PP836764	-	PP852887	Chen et al. 2024
O. sinense	SD09702	PP836763	PP836765	-	PP852888	Chen et al. 2024
O. subglobosum	CBS 101963^T	OQ429759	OQ055658	OQ454170	OQ471085	Hou et al. 2023
O. subglobosum	CBS 578.89	PV272705	PV272925	PV273289	PV273485	Zhao et al. 2025
O. theobromae	CBS 110153^T	PV272706	PV272926	PV273290	PV273486	Zhao et al. 2025
O. theobromae	CBS 119658	PV272707	PV272927	PV273291	PV273487	Zhao et al. 2025
O. variecolor	CBS 130360	OQ429760	OQ055659	OQ454171	OQ471086	Hou et al. 2023
O. variecolor	CBS 535.81	PV272708	PV272928	PV273292	PV273488	Zhao et al. 2025
O. zunyiense	ZY09271^T	PV688358	PV688366	PV705686	PV705694	This study
O. zunyiense	ZY09272	PV688359	PV688367	PV705687	PV705695	This study
Paraneoaraneomyces sinensis	ZY 22.006	OQ709254	OQ709260	OQ719621	OQ719626	Hou et al. 2023
P. sinensis	ZY 22.007	OQ709255	OQ709261	OQ719622	OQ719627	Hou et al. 2023
P. sinensis	ZY 22.008^T	OQ709256	OQ709262	OQ719623	OQ719628	Hou et al. 2023
Parasarocladium breve	CBS 150.62^T	OQ429781	OQ055677	OQ454192	OQ471107	Hou et al. 2023
P. chondroidum	CBS 652.93^T	OQ429785	OQ055681	OQ454196	OQ471111	Hou et al. 2023
P. debruynii	CBS 144942^T	MK069420	MK069416	OQ454197	-	Hou et al. 2023
P. funiculosum	CBS 141.62 ^T	OQ429786	OQ055682	OQ454198	OQ471307	Hou et al. 2023
P. gamsii	CBS 726.71 ^T	OQ429787	OQ055683	OQ454199	OQ471112	Hou et al. 2023
P. radiatum	CBS 142.62 ^T	OQ429788	OQ055684	OQ454200	OQ471308	Hou et al. 2023
Peethambara spirostriata	CBS110115	-	AY489724	EF692516	AY489619	Sun et al. 2017
Pleurocordyceps aurantiaca	MFLUCC 17-2113	MG136916	MG136910	-	MG136875	Xiao et al. 2018
P. marginaliradians	MFLU 17-1582 ^T	MG136920	MG136914	-	MG136878	Xiao et al. 2018
Polycephalomyces albiramus	GACP 21-XS08T	OQ172092	OQ172037	OQ459807	OQ459735	Xiao et al. 2023
P. formosus	NBRC 109993T	MN586833	MN586842	MN598064	MN598057	Xiao et al. 2023
Proxiovicillium blochii	CBS 427.93 ^T	OQ429816	OQ430079	OQ454213	OQ471144	Hou et al. 2023
P. blochii	CBS 324.33	OQ429815	OQ430078	OQ454212	OQ471143	Hou et al. 2023
P. lepidopterorum	CBS 101239 ^T	OQ429817	OQ430080	OQ454214	OQ471145	Hou et al. 2023
Rosasphaeria moravica	LMM ^T	JF440985	-	JF440986	JF440987	Jaklitsch and Voglmayr 2012
Roumegueriella rufula	CBS 346.85	-	DQ518776	DQ522461	DQ522355	Spatafora et al. 2007
R. rufula	GJS 91-164	-	EF469082	EF469116	EF469070	Sung et al. 2007
Sarocladium agarici	CBS 113717 ^T	OQ429828	OQ430089	OQ454227	OQ471158	Hou et al. 2023
S. bacillisporum	CBS 425.67 ^T	NR_145039	MH870718	-	-	Hou et al. 2023
S. dejongiae	CBS 144929 ^T	NR_161153	NG_067854	-	-	Hou et al. 2023
S. gamsii	CBS 707.73 ^T	OQ429839	HG965063	OQ454238	OQ471169	Hou et al. 2023
S. glaucum	CBS 796.69 ^T	OQ429841	HE608657	OQ451839	OQ471304	Hou et al. 2023
S. implicatum	CBS 959.72 ^T	HG965023	MH878470	-	-	Hou et al. 2023
S. kiliense	CBS 122.29 ^T	AJ621775	HQ232052	OQ454241	OQ471172	Hou et al. 2023
S. ochraceum	CBS 428.67 ^T	OQ429846	HQ232070	OQ454245	OQ471176	Hou et al. 2023
S. strictum	CBS 346.70 ^T	OQ429853	HQ232141	OQ454252	OQ471184	Hou et al. 2023
S. subulatum	CBS 217.35 ^T	MH855652	NG_070566	-	-	Hou et al. 2023
S. terricola	CBS 243.59 ^T	MH857853	MH869389	-	-	Hou et al. 2023
Shimizuomyces paradoxus	EFCC 6279 ^T	JN049847	EF469084	EF469117	EF469071	Sung et al. 2007
S. paradoxus	EFCC 6564	-	EF469083	EF469118	EF469072	Sung et al. 2007
Simplicillium lamellicola	CBS 116.25	AJ292393	MH866307	DQ522462	DQ522356	Spatafora et al. 2007
S. lanosoniveum	CBS 101267	AJ292395	-	DQ522463	DQ522357	Spatafora et al. 2007
S. lanosoniveum	CBS 704.86	AJ292396	AF339553	DQ522464	DQ522358	Spatafora et al. 2007
Sordaria fimicola	AFTOL-ID 216 ^T	DQ518178	-	-	DQ518175	James et al. 2006
Sphaerostilbella aureonitens	GJS74-87	FJ442633	HM466683	FJ442763	-	Schoch et al. 2012
S. berkeleyana	GJS82-274	-	U00756	-	AF543783	James et al. 2006
S. chlorohalonata	DAOM 235557	JN942888	JN938870	-	-	Schoch et al. 2012
Stachybotrys eucylindrospora	ATCC 18851	JN942887	JN938869	-	-	Schoch et al. 2012
S. microspora	CBS 186.79	-	-	DQ676580	DQ676604	Schoch et al. 2012
Stephanonectria keithii	GJS92-133 ^T	-	AY489727	-	AY489622	Castlebury et al. 2004
Tilachlidium brachiatum	CBS 506.67	KM231839	HQ232177	KM232415	KM231976	Lombard et al. 2015
T. brachiatum	CBS 363.97	KM231838	KM231719	KM232414	KM231975	Lombard et al. 2015
Tolypocladium inflatum	SCALT1007-002^T	KC963032	-	-	-	Ma et al. 2012
Trichoderma aggressivum	CBS100525	-	JN939837	JQ014130	-	Schoch et al. 2012
T. viride	GJS89-127	-	AY489726	-	AY489621	Castlebury et al. 2004
Trichothecium crotocinigenum	CBS 129.64 ^T	OQ429885	OQ430137	-	OQ471217	Hou et al. 2023
T. downum	SICAUCC 23-0076^T	PP060692	PP057975	-	-	Wang et al. 2025b
T. downum	SICAUCC 23-0155	PP844883	PP826169	-	-	Wang et al. 2025b
T. hongkongense	CBS 101444 ^T	OQ429887	OQ430139	OQ454288	OQ471219	Hou et al. 2023
T. hongkongense	CBS 102186	OQ429886	OQ430138	OQ454287	OQ471218	Hou et al. 2023
T. indicum	CBS 123.78	OQ429889	OQ430141	-	OQ471221	Hou et al. 2023
T. ovalisporum	DAOM 186447 ^T	NR_111321	-	-	-	Summerbell et al. 2011
T. ovalisporum	-	EU445372	-	-	EU445373	Summerbell et al. 2011
T. roseum	DUCC 502	JN937590	JX458860	-	-	Summerbell et al. 2011
T. roseum	DAOM 208997	JN942882	JN938864	-	-	Summerbell et al. 2011
T. roseum	CBS 566.50	MH856757	MH868278	-	-	Summerbell et al. 2011
T. sinense	DY05461^T	PV688360	PV688368	PV705688	PV705696	This study
T. sinense	DY05462	PV688361	PV688369	PV705689	PV705697	This study
T. sinense	DY05591	PV688362	PV688370	PV705690	PV705698	This study
T. sinense	DY05592	PV688363	PV688371	PV705691	PV705699	This study
T. sympodiale	ATCC 36477 ^T	-	NG_059884	-	-	Summerbell et al. 2011
T. sympodiale	CBS 227.76	MH860973	MH872742	-	-	Summerbell et al. 2011

Note. New strains or species are in bold type. “^T” denotes ex-type. Abbreviations: ATCC, American Type Culture Collection, USA; BCC, BIOTEC Culture Collection, Klong Luang, Thailand; CBS, Westerdijk Fungal Biodiversity Institute (previously Centraal bureau voor Schimmelcultures), Utrecht, the Netherlands; CGMCC, China General Microbiological Culture Collection Center, China; DAOM, Department of Agriculture, Ottawa, Mycological Collections, Ottawa, Canada; EFCC, Entomopathogenic Fungal Culture Collection, Chuncheon, Korea; GMBC, Guizhou Medical University Culture Collection, Guiyang, China; NHJ, Nigel Hywel-Jones personal collection; OSC, Oregon State University Herbarium, Corvallis, OR; YHH, Yunnan Herbal Herbarium, Kunming, China.

Sequence alignments and phylogenetic analyses

DNASTAR™ Lasergene (v.6.0) was used to edit DNA sequences in this study. The ITS, LSU, RPB2 and tef-1α sequences for this analysis were downloaded from GenBank based on recent, related studies (e.g. Hou et al. 2023; Lin et al. 2025; Zhao et al. 2025; Wang et al. 2025b), and other sequences were selected based on BLASTn similarity searches. All the sequences were aligned by MAFFT v.7.037b (Katoh and Standley 2013) and alignments edited with MEGAv. 6 (Tamura et al. 2013).

We carried out four phylogenetic analyses to confirm the placement of the strains in different taxonomic hierarchies.

Analyses 1: Analyses based on ITS, LSU, RPB2 and tef-1α gene regions to confirm the familialplacement of the new strains.
Analysis 2: Analyses based on ITS, LSU, RPB2 and tef-1α gene regions to show the placement of new strains in Ovicilliums. str.
Analysis 3: Analyses based on ITS, LSU, RPB2 and tef-1α gene regions to show the placement of new strains in Conoideocrellas. str.
Analysis 4: Analyses based on ITS, LSU, RPB2 and tef-1α gene regions to show the placement of new strains in Trichotheciums. str.

The combined datasets of ITS, LSU, RPB2 and tef-1α gene regions were obtained using SequenceMatrixv.1.7.8 (Vaidya et al. 2011). The model for each data partition was selected for Bayesian analysis by ModelFinder (Kalyaanamoorthy et al. 2017) in the PhyloSuite v. 1.2.2 software (Zhang et al. 2020).

The datasets 1–4 were analyzed using Bayesian inference (BI) and maximum likelihood (ML) methods, respectively. For BI, a Markov chain Monte Carlo (MCMC) algorithm was used to generate phylogenetic trees with Bayesian probabilities for the combined sequence datasets using MrBayes v.3.2 (Ronquist et al. 2012). The Bayesian analysis resulted in 20,001 trees after 10,000,000 generations. The first 4,000 trees, representing the burn-in phase of the analysis, were discarded, while the remaining 16,001 trees were used to calculate posterior probabilities in the majority rule consensus tree. After the analysis was finished, each run was examined to see if it was greater than 200 using the program Tracer v.1.5 (Drummond and Rambaut 2007) to determine burn-in and confirm that both runs had converged. The ML analyses were constructed with IQ-TREE v. 2.0 (Nguyen et al. 2015; Trifinopoulos et al. 2016), using the ML+rapid bootstrap setting with 1,000 replicates and an automatic selection of the model according to BIC.

Results

Phylogenetic analyses

Analysis 1

The familial placements of the new strains are confirmed in this analysis (Fig. 1). Gelasinospora tetrasperma Dowding (AFTOL-ID 1287), Neurospora crassa Shear & B.O. Dodge (ICMP 6360) and Sordariafimicola (Roberge ex Desm.) Ces. & De Not. (AFTOL-ID 216) were used as the outgroup taxa in the analysis. The dataset included 79 taxa, and consisted of 3,235 (ITS, 686; LSU, 842; RPB2, 882, and tef-1α, 825) characters with alignment gaps.

Figure 1.

Phylogram retrieved from IQ-TREE to confirm the familial placements of the new strains using the combined dataset of ITS, LSU, RPB2 and tef-1α gene regions. The statistical values are provided at nodes as ML/PP (ML value above 70% and BI value above 0.70). The tree is rooted with Gelasinospora tetrasperma (AFTOL-ID 1287), Neurospora crassa (ICMP 6360) and Sordaria fimicola (AFTOL-ID 216). Ex-types and new strains are indicated by the superscript “T” and in bold, respectively.

The selected model for the ML analysis was TIM2+F+G4. The final value of the highest scoring tree was –55,119.994, which was obtained from the ML analysis of the dataset. The parameters of the GTR model used to analyze the dataset were estimated based on the following frequencies: A = 0.236, C = 0.272, G = 0.276, T = 0.215; substitution rates AC = 1.27070, AG = 2.13314, AT = 1.27070, CG = 1.00000, CT = 5.12614 and GT = 1.00000, as well as the gamma distribution shape parameter α = 0.468. The selected model of the dataset for BI analysis was GTR+F+I+G4 (ITS), GTR+F+G4 (LSU, tef-1α) and SYM+I+G4 (RPB2). The phylogenetic tree (Fig. 1) constructed using ML and BI analyses was largely congruent and strongly supported in most branches.

Strains KY04071 and KY04072 clustered sister to Conoideocrella luteorostrata (Zimm.) D. Johnson et al. (NHJ 11343 and NHJ 12516) and formed a stable clade in the family Clavicipitaceae.

Strains DY05461, DY05462, DY05591 and DY05592 clustered sister to Trichothecium roseum (Pers.) Link (DUCC 502) and Myrotheciomyces corymbiae Crous (CPC 33206) in the family Myrotheciomycetaceae.

Strains ZY09271 and ZY09272 clustered sister to Ovicillium asperulatum (Giraldo et al.) L.W. Hou et al. (CBS 130362) and O. attenuatum Zare & W. Gams (CBS 399.86) in the family Bionectriaceae.

Analysis 2

Phylogenetic trees were generated in analysis 2for establishing the new species in the genus Ovicillium (Fig. 2). Acremonium alternatum Link (CBS 407.66) and A. egyptiacum (J.F.H. Beyma) W. Gams (CBS 114785) were used as the outgroup taxa in the analysis. The dataset included 20 taxa and consisted of 2,872 (ITS, 517; LSU, 777; RPB2, 767, and tef-1α, 811) characters with alignment gaps.

Figure 2.

Phylogram retrieved from IQ-TREE for establishing the new species in the genus Ovicillium s. str. using the combined dataset of ITS, LSU, RPB2 and tef-1α gene regions. The statistical values are provided at nodes as ML/PP (ML value above 70% and BI value above 0.70). The tree is rooted with Acremonium alternatum (CBS 407.66) and A. egyptiacum (CBS 114785). Ex-types and new strains are indicated by the superscript “T” and in bold, respectively.

The selected model for the ML analysis was TN+F+I+G4. The final value of the highest scoring tree was –12,780.840, which was obtained from the ML analysis of the dataset. The parameters of the GTR model used to analyze the dataset were estimated based on the following frequencies: A = 0.235, C = 0.276, G = 0.268, T = 0.220; substitution rates AC = 1.00000, AG = 2.52675, AT = 1.00000, CG = 1.00000, CT = 5.98208 and GT = 1.00000, as well as the gamma distribution shape parameter α = 0.800. The selected model of the dataset for BI analysis was GTR+F+I+G4 (ITS, LSU, tef-1α) and SYM+I+G4 (RPB2). The phylogenetic tree (Fig. 2) constructed using ML and BI analyses was largely congruent and strongly supported in most branches. Strains ZY09271 and ZY09272 formed an independent clade with high statistical support (100% ML/1 PP) and were clustered with Ovicillium oosporum Zare & W. Gams, O. subglobosum Zare & W. Gams, O. theobromae Lin Zhao bis & Crous, O. variecolor (Giraldo et al.) L.W. Hou et al. in a clade with high statistical support in ML and BI analysis (98% ML/1 PP).

Analysis 3

Phylogenetic trees were generated in analysis 3 for establishing the new species in the genus Conoideocrella (Fig. 3). Pleurocordyceps aurantiaca (Y.P. Xiao et al.) Y.H. Wang et al. (MFLUCC 17-2113) and P. marginaliradians (Y.P. Xiao et al.) Y.H. Wang et al. (MFLU 17-1582) were used as the outgroup taxa in the analysis. The dataset included 20 taxa and consisted of 3,279 (ITS, 642; LSU, 819; RPB2, 917, and tef-1α, 901) characters with alignment gaps.

Figure 3.

Phylogram retrieved from IQ-TREE of the placement of new strains in Conoideocrella s. str. using the combined dataset of ITS, LSU, RPB2 and tef-1α gene regions. The statistical values are provided at nodes as ML/PP (ML value above 70% and BI value above 0.70). The tree is rooted with Pleurocordyceps aurantiaca (MFLUCC 17-2113) and P. marginaliradians (MFLU 17-1582). Ex-types and new strains are indicated by the superscript “T” and in bold, respectively.

The selected model for the ML analysis was TN+F+I+G4. The final value of the highest scoring tree was –14,463.202, which was obtained from the ML analysis of the dataset. The parameters of the GTR model used to analyze the dataset were estimated based on the following frequencies: A = 0.236, C = 0.271, G = 0.276, T = 0.217; substitution rates AC = 1.00000, AG = 2.83420, AT = 1.00000, CG = 1.00000, CT = 8.61744 and GT = 1.00000, as well as the gamma distribution shape parameter α = 0.591. The selected model of the dataset for BI analysis was HKY+F+G4 (ITS), GTR+F+I+G4 (LSU, tef-1α) and SYM+I+G4 (RPB2). The phylogenetic tree (Fig. 3) constructed using ML and BI analyses was largely congruent and strongly supported in most branches. Strains KY04071 and KY04072 formed an independent clade with high statistical support (100% ML/1 PP) and clustered with Conoideocrella luteorostrata in a clade with high statistical support in ML and BI analysis (100% ML/1 PP).

Analysis 4

Phylogenetic trees were generated in analysis 4 for establishing the new species in the genus Trichothecium (Fig. 4). Clonostachys phyllophila Schroers (CBS 921.97) and Clonostachys spinulosispora Lechat & J. Fourn. (CBS 133762) were used as the outgroup taxa in the analysis. The dataset included 25 taxa, and consisted of 2,994 (ITS, 569; LSU, 779; RPB2, 780, and tef-1α, 866) characters with alignment gaps.

Figure 4.

Phylogram retrieved from IQ-TREE of the placement of new strains in Trichothecium s. str. using the combined dataset of ITS, LSU, RPB2 and tef-1α gene regions. The statistical values are provided at nodes as ML/PP (ML value above 70% and BI value above 0.70). The tree is rooted with Clonostachys phyllophila (CBS 921.97) and Clonostachys spinulosispora (CBS 133762). Ex-types, new strains are indicated by the superscript “T” and in bold, respectively.

The selected model for the ML analysis was TIM2+F+I+G4. The final value of the highest scoring tree was –17,969.800, which was obtained from the ML analysis of the dataset. The parameters of the GTR model used to analyze the dataset were estimated based on the following frequencies: A = 0.228, C = 0.283, G = 0.280, T = 0.209; substitution rates AC = 1.39668, AG = 2.51979, AT = 1.39668, CG = 1.00000, CT = 6.81690 and GT = 1.00000, as well as the gamma distribution shape parameter α = 0.586. The selected model of the dataset for BI analysis was GTR+F+I+G4 (ITS, LSU, tef-1α) and SYM+I+G4 (RPB2). The phylogenetic tree (Fig. 4) constructed using ML and BI analyses was largely congruent and strongly supported in most branches. Strains DY05461, DY05462, DY05591 and DY05592 formed an independent clade with high statistical support (100% ML/1 PP) and were clustered with Trichothecium crotocinigenum (Schol-Schwarz) Summerb. et al. in a clade with high statistical support in ML and BI analysis (99% ML/1 PP).

In addition, the type strain of Myrotheciomyces corymbiae Crous (CPC 33206), the type species of Myrotheciomyces and another strain of the same species (i.e. CBS144420) (Crous et al. 2018) reside in the Trichothecium s. str. clade. This placement agrees with Hou et al. (2023), hence, we propose to regard the younger, asexual typified name as a synonym of the older, asexual typified name, i.e. Trichothecium over Myrotheciomyces.

Taxonomy

Bionectriaceae Samuels & Rossman, Stud. Mycol. 42: 15, 1999

Ovicillium Zare & W. Gams, Mycol. Progr. 15: 1020, 2016

Ovicillium zunyiense W.H. Chen, Y.F. Han, J.D. Liang & J.H. Zhao, sp. nov.

MycoBank No: 859496

Fig. 5

Etymology.

Referring to its location, Zunyi City, where the fungus was first discovered.

Type.

China • Guizhou Province, Zunyi City, Honghuagang District, Dabanshui National Forest Park (27°46'35.904"N, 106°48'30.89"E). On a dead larva (Lepidoptera), on the leaf litter, 2 September 2023, Wanhao Chen, GZAC ZY0927, holotype; ZY09271, ex-type.

Figure 5.

Ovicillium zunyiense A. Infected larva; B, C. PDA culture plate showing the top (B) and reverse (C) sides of the colony; D–J. Phialides and conidia. Scale bars: 10 mm (B, C) and 10 μm (D–J).

Diagnosis.

Differs from Ovicillium oosporum by its shorter conidiophore, smaller conidia and its insect substrate. Differs from O. subglobosum by its shorter phialides, smaller ovoid to subglobose conidia and insect substrate. Differs from O. theobromae by its shorter conidiophores, shorter phialides and insect substrate. Differs from O. variecolor by its shorter conidiophores, shorter phialides, absence of sessile conidia and insect substrate.

Description.

Colonies on PDA, attaining a diameter of 42–45 mm after 14 days at 25 °C, grayish-white to light brown, consisting of a basal felt, floccose hyphal overgrowth; reverse light brown to brown. Hyphae septate, hyaline, smooth-walled, 1.6–1.7 μm wide. Conidiophores hyaline, smooth-walled, with single phialide or whorls of 2–4 phialides or verticillium-like from hyphae directly, 17.4–26.2 × 2.3–3.0 μm (x̄= 20.8 × 2.6 μm, n = 30). Phialides cylindrical, somewhat inflated base, 21.6–33.3 × 1.2–2.6 μm (x̄= 28.2 × 1.7 μm, n = 30), tapering to a thin neck. Conidia hyaline, smooth-walled, ovoid to subglobose, 2.3–3.7 × 1.7–2.6 μm (x̄= 2.7 × 2.1 μm, n = 30). Sexual state not observed.

Host.

Larva (Lepidoptera).

Habitat.

Near the road, located on the leaf litter.

Additional strain examined.

China • Guizhou Province, Zunyi City, Honghuagang District, Dabanshui National Forest Park (27°46'35.904"N, 106°48'30.89"E). On a dead larva (Lepidoptera),on the leaf litter, 2 September 2023, Wanhao Chen, ZY09272 (living culture).

Remarks.

Based on BLASTn results, strains ZY09271 and ZY09272 were identified as members of Ovicillium s. str., and the phylogenetic analysis of the combined datasets 1 and 2 (Figs 1, 2). It clustered into an independent clade with a close relationship with Ovicillium oosporum, O. subglobosum, O. theobromae and O. variecolor with a high support value (98% ML/1 PP). Compared with the typical characteristics, Ovicillium zunyiense can be distinguished from O. oosporum by its shorter conidiophores (17.4–26.2 × 2.3–3.0 μm vs. 20–50 × 1.2–2.2 μm), smaller conidia (2.3–3.7 × 1.7–2.6 μm vs. 4–6 × 2.5–4.0 μm) and its substrates (insect vs. plant). Ovicillium zunyiense can be distinguished from O. subglobosum by its short phialides (21.6–33.3 × 1.2–2.6 μm vs. 25–55 × 1.5–2.2 μm), smaller ovoid to subglobose conidia (2.3–3.7 × 1.7–2.6 μm vs. 3.5–5.5 × 3.5–4.5 μm) and its substrates (insect vs. soil). Ovicillium zunyiense can be distinguished from O. theobromae by its short conidiophores (17.4–26.2 × 2.3–3.0 μm vs. 460 × 1.5–3.2 μm), short phialides (21.6–33.3 × 1.2–2.6 μm vs. 28.4–65.5 × 1.2–1.8 μm) and its substrates (insect vs. plant). Ovicillium zunyiense can be distinguished from O. variecolor by its short conidiophores (17.4–26.2 × 2.3–3.0 μm vs. 290 μm long), short phialides (21.6–33.3 × 1.2–2.6 μm vs. 18–95 × 1–2 μm), absence of sessile conidia and its substrates (insect vs. soil). Thus, the morphological characteristics and molecular phylogenetic results support to establishment of O. zunyienseas a new species.

Taxonomic key to distinguish the species of Ovicillium

1	Chlamydospores present	2
–	Chlamydospores absent	3
2	Chlamydospores abundant, Conidia globose	*Ovicillium asperulatum*
–	Scarce chlamydospores may be present, Conidia subglobose, oval to broadly oval	*Ovicillium oosporum*
3	The sessile conidia absent	4
–	The sessile conidia present	*Ovicillium variecolor*
4	Conidia oval, subglobose or globose	5
–	Conidia ellipsoidal to cylindrical	*Ovicillium pseudoattenuatum*
5	Conidiophore smooth	6
–	Conidiophore near the base roughened	*Ovicillium attenuatum*
6	Soil or plant substrates	7
–	Insect substrates	8
7	Soil substrates, conidia subglobose, 3.5–5.5 × 3.5–4.5 μm	*Ovicillium subglobosum*
–	Plant substrates, conidia subglobose or ellipsoid, (2.8–)3.0–3.7(–4.4) × (2.2–)2.3–2.9(–3.1) μm	*Ovicillium theobromae*
8	Conidia globose to ovoid, 2.1–2.9 × 1.1–1.7 μm	*Ovicillium sinense*
–	Conidia ovoid to subglobose, 2.3–3.7 × 1.7–2.6 μm	*Ovicillium zunyiense*

Clavicipitaceae Rogerson, Mycologia 62(5): 900, 1970

Conoideocrella D. Johnson, G.H. Sung, Hywel-Jones & Spatafora, Mycol. Res. 113(3): 286, 2009

Conoideocrella tiankengensis W.H. Chen, Y.F. Han, J.D. Liang & J.H. Zhao, sp. nov.

MycoBank No: 859499

Fig. 6

Etymology.

Referring to its location, Monkey-Ear Tiankeng, where the fungus was first discovered.

Figure 6.

Conoideocrella tiankengensis A. Infected scale insect; B, C. PDA culture plate showing the top (B) and reverse (C) sides of the colony; D–J. Conidiogenous structures and conidia. Scale bars: 10 mm (B, C) and 10 μm (D–J).

Type.

China • Guizhou Province, Guiyang City, Monkey-Ear Tiankeng (27°5'12.138'’ N, 107°0'48.42'’ E). On a dead scale insect (Coccoidea),on the leaf, 6 April 2024, Wanhao Chen, GZAC KY0407, holotype; KY04071, ex-type.

Diagnosis.

Differs from Conoideocrella luteorostrata by its shorter and hyaline conidiophore, two types of phialides and fusiform to filiform conidia.

Description.

Colonies grow slowly on PDA at 25 ^◦C, attaining a diam. of 26–39 mm in 14 days, white to cream-white mycelium at first, turning pale yellow with age. Colonies loose on the edge and compact in the middle. Hyphae smooth, septate, hyaline, 1.7–2.4 μm wide. Conidiophores hyaline, smooth-walled, with single phialide or whorls of 2–4 phialides or verticillium-like from hyphae directly, 13.6–23.2 × 1.6–2.6 μm (x̄= 17.2 × 2.0 μm, n = 30). Two types of conidiogenous structures were present. Hirsutella-like asexual state arises from hyphae, conidiogenous structures with slender base tapering more or less evenly to a neck, hyaline, produced directly on the hyphae, 15.1–27.1 × 1.6–1.8 μm (x̄= 21.4 × 1.7 μm, n = 30). Isaria-like conidiogenous structures also arises from hyphae, cylindrical to ellipsoidal, somewhat inflated base, tapering to a thin neck, 9.8–13.5 × 1.4–1.8 μm (x̄= 10.8 × 1.7 μm, n = 30). Conidia hyaline, smooth, fusiform to filiform, forming short divergent and basipetal chains, 5.3–6.7 × 1.6–2.2 μm (x̄= 5.9 × 1.8 μm, n = 30).

Host.

Scale insect (Coccoidea).

Habitat.

Near the road, located on the leaf.

Additional strain examined.

China • Guizhou Province, Guiyang City, Monkey-Ear Tiankeng (27°5'12.138'’ N, 107°0'48.42'’ E). On a dead scale insect (Coccoidea), on the leaf, 6 April 2024, Wanhao Chen, KY04072 (living culture).

Remarks.

Conoideocrella tiankengensis was identified as Conoideocrella, based on the BLASTn result in NCBI and the phylogenetic analysis of the combined datasets 1 and 3 (Figs 1, 3). It clustered into an independent clade with a close relationship with C. luteorostrata with high statistical values (100% ML/1 PP). Compared with the typical characteristics, C. tiankengensis can be distinguished from C. luteorostrata by its shorter and hyaline conidiophore (13.6–23.2 × 1.6–2.6 μm vs. 150–240 × 2.0–3.0 μm), two types of phialides and fusiform to filiform conidia (Hywel-Jones 1993). Thus, the morphological characteristics and molecular phylogenetic results support C. tiankengensis as a new species.

Taxonomic key to distinguish the species of Conoideocrella

1	The sexual morphabsent	2
–	The sexual morph present	3
2	Spider host, Hirsutella-like conidiogenous structure, 12.7–89.9 × 0.4–1.3 μm	*Conoideocrella gongyashanensis*
–	Scale insect host, Hirsutella-like and isaria-like conidiogenous structure, 15.1–27.1 × 1.6–1.8 μm and 9.8–13.5 × 1.4–1.8 μm, respectively	*Conoideocrella tiankengensis*
3	Stromata flattened pulvinate to discoid, planar, pulvinate, almost planar	4
–	Stromata scutate or hemi-globose	*Conoideocrella fenshuilingensis*
4	Perithecia < 600 μm long	5
–	Perithecia > 600 μm long	*Conoideocrella luteorostrata*
5	Stromata pale yellow, orange to reddish brown; Asci < 180 μm long; Conidia 8–15 × 2–4 μm	*Conoideocrella krungchingensis*
–	Stromata white to orangish-pink; Asci > 180 μm long; Conidia 6.1–12.5 × 1.3–2.3 μm	*Conoideocrella tenuis*

Myrotheciomycetaceae Crous, Persoonia 40: 351, 2018

Trichothecium Link, Mag. Gesell. naturf. Freunde, Berlin 3(1-2): 18, 1809

=Myrotheciomyces Crous, Persoonia 40: 351, 2018; MycoBank no.: 825409

Note.

The family Myrotheciomycetaceae was introduced by Crous et al. (2018) with four genera, Emericellopsis J.F.H. Beyma, Leucosphaerina Arx, Myrotheciomyces Crous and Trichothecium Link. Bao et al. (2023) exclude Emericellopsis from Myrotheciomycetaceae based on the phylogenetic analysis and showed that the type strain of Myrotheciomyces corymbiae (CPC 33206) is accommodated in Trichothecium s. str. In the present study, the type strain of Myrotheciomyces corymbiae clustered in the Trichothecium clade (Fig. 4). Thus, we propose to synonymize Myrotheciomyces with Trichothecium as the latter is the older generic epithet.

Trichothecium sinense W.H. Chen, Y.F. Han, J.D. Liang & J.H. Zhao, sp. nov.

MycoBank No: 859500

Fig. 7

Etymology.

Referring to its location, China, where the fungus was first discovered.

Figure 7.

Trichothecium inense A. Infected spider; B, C. PDA culture plate showing the top (B) and reverse (C) sides of the colony; D–L. Phialides and conidia. Scale bars: 10 mm (B, C) and 10 μm (D–L).

Type.

China • Guizhou Province, Qiannan Buyi and Miao Autonomous Prefecture, Duyun City, Mayao River Valley (26°21'24.71"N, 107°22'48.22"E). On a dead spider (Araneae),on or under rocks, 1 May 2022, Wanhao Chen, GZAC DY0546, holotype;DY05461, ex-type.

Diagnosis.

Differs from Trichothecium crotocinigenum by its shorter phialides, larger conidia and spider host.

Description.

Colonies on PDA, attaining a diameter of 86–90 mm after 14 days at 25 °C, white, consisting of a basal felt, floccose hyphal overgrowth; reverse light yellow. Conidiophores solitary, (sub-)erect, arising directly from submerged or superficial hyphae, 14.3–23.1 × 1.4–2.6 μm (x̄= 17.7 × 1.8 μm, n = 30). Phialides lateral or terminal, cylindrical, occasionally swollen in the lower part, hyaline, thick-, smooth-walled, 32.8–55.1 × 1.9–3.0 μm (x̄= 46.9 × 2.6 μm, n = 30). Conidia aseptate, cylindrical, oblong or ovoid, rounded at both ends, hyaline, thin-, smooth-walled, 4.8–5.8 × 1.2–2.9 μm (x̄= 5.5 × 2.4 μm, n = 30), arranged in slimy heads. Chlamydospores not observed. Sexual morph not observed.

Host.

Spider (Araneae).

Habitat.

Near the road, located on or under rocks.

Additional material examined.

Remarks.

Trichothecium sinensewas identified as Trichothecium, based on the BLASTn result in NCBI and the phylogenetic analysis of the combined datasets 1and 4 (Figs 1, 4). It clustered into an independent clade with a close relationship with Trichothecium crotocinigenum with high statistical values (99% ML/1 PP). Compared with the typical microscopic characteristics, Trichothecium sinense can be distinguished from T. crotocinigenum by its shorter phialides (32.8–55.1 × 1.9–3.0 μm vs. 168 μm long), larger conidia [4.8–5.8 × 1.2–2.9 μm vs. 3–8(–11) × 2–3 μm] and its substrates (mushroom vs. spider). Thus, the morphological characteristics and molecular phylogenetic results support T. sinense as a new species.

New combination

Trichothecium corymbiae (Crous) W.H. Chen &Wijayaw., comb. nov.

MycoBank No: 859678

= Myrotheciomyces scorymbiae Crous, Persoonia 40: 351, 2018.

Note.

We proposed to treat Myrotheciomyces as a synonym of Trichothecium based on the phylogenetic analyses (Figs 1, 4) and therefore transferred Myrotheciomyces corymbiae to the genus Trichothecium as Trichothecium corymbiae.

Discussion

Guizhou Province, as a typical karst region, exhibits exceptional habitat diversity, including plains, mountains, hills, caves, valleys, and forests. Hypocrealean fungi in this region have been extensively studied and current research reveal a significant concentration of Clavicipitaceae, Cordycipitaceae, and Ophiocordycipitaceae (Chen et al. 2022b, 2024d, 2025; Zhang et al. 2023; Bu et al. 2025; Xu et al. 2025). At the same time, other families remain understudied or poorly known. Moreover, these investigations have been predominantly limited to soil and forest ecosystems. Previous studies have revealed a remarkably high species diversity of Hypocrealean fungi in karst tiankengs and valley habitats, warranting further scientific investigation (Chen et al. 2022b, 2023, 2024d; Jiang et al. 2025). Recent taxonomic assessments highlight the need for expanded biodiversity surveys in karst ecosystems, particularly in under-characterized microhabitats (Wijayawardene et al. 2021).

In the present study, three new species, Conoideocrella tiankengensis, Ovicillium zunyiense and Trichothecium sinense were collected from Tiankeng, a karst forest and valley; the three species belong to the families Clavicipitaceae, Bionectriaceae and Myrotheciomycetaceae respectively. All three aforementioned fungal species demonstrate obligate associations with arthropod hosts. Notably, species in the genus Conoideocrella D. Johnson, G.H. Sung, Hywel-Jones & Spatafora all parasitize scale insects, with the exception of C. gongyashanensis (L.B. Lin & J.Z. Qiu), which parasitizes spiders (Hywel-Jones 1993; Mongkolsamrit et al. 2016; Wang et al. 2024; Lin et al. 2025). Conoideocrella species had only been documented in Yunnan and Fujian Province (Wang et al. 2024; Lin et al. 2025), and the new species was introduced from a karst habitat for the first time.

The genus Trichothecium Link was introduced with the type species Trichothecium roseum (Pers.) Link. Summerbell et al. (2011) revised Trichothecium and restricted this genus into five species: Trichothecium crotocinigenum, T. indicum (Arx, Mukerji & N. Singh) Summerbell, Seifert, & Schroers, T. ovalisporum (Seifert & Rehner) Seifert & Rehner, T. roseum and T. sympodiale Summerbell, Seifert, & Schroers. Hou et al. (2023) introduced a new species Trichothecium hongkongense L.W. Hou, L. Cai & Crous. These species have been mainly reported from covers manure, living leaves, mushroom, cereal silage and leaf-cutter bee (MycoBank, https://www.mycobank.org/). In this study, anarthropod-associated species, T. sinense, is introduced for the first time. Further research is needed to elucidate the environmental adaptation mechanisms in these species. Moreover, a new species in the family Myrotheciomycetaceae was introduced from Guizhou karst habitat for the first time.

The genus Ovicillium Zare & W. Gams was introduced with the type species, O. attenuatum Zare & W. Gams (Zare and Gams 2016). Chen et al. (2024a) summarized that the genus Ovicillium consists of five species and reported a new species Ovicillium sinense Wan H. Chen, Y.F. Han & J.D. Liang. Two new species Ovicillium pseudoattenuatum Y. Wang & D.X. Tang and O. theobromae Lin Zhao & Crous, were isolated from soil and plant by Wang et al. (2025c) and Zhao et al. (2025). Among these, only two species, Ovicillium sinense and O. zunyiense were arthropod-associated species. Whether this correlates with their ambient environment warrants further investigation.

Fungi in the order Hypocreales exhibit an evolutionary progression of trophic modes, transitioning from plant-based nutrition (including both living tissues and plant debris) to animal hosts (particularly insects), and ultimately to fungal substrates (Spatafora et al. 2007). This stepwise adaptation reflects an ecological optimization strategy for acquiring optimal nutrient resources (Behie et al. 2013; Behie and Bidochka 2014; Moonjely et al. 2016; Vidhate et al. 2023). Our study introduced two arthropod-associated species, Ovicillium zunyiense and Trichothecium sinense, which are seldom reported in the genera Ovicillium and Trichothecium. How environmental factors drive host-specific adaptations in these fungi is worthy of further research.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Use of AI

No use of AI was reported.

Funding

No funding was reported.

Author contributions

This work was funded by National Natural Science Foundation of China (31860002), Science and Technology Foundation of Guizhou Province (No. qiankehejichu-ZK [2022] general 482), Construction Program of Key Laboratory of Guizhou Province (Qiankehepingtairencai-ZDSYS[2023]004), Guizhou Province Science and Technology Innovation Leading Talent Work-station for Traditional Chinese Medicine and Ethnic Medicine (QiankehepingtaiKXJZ [2024] 034), Central Guidance for Local Science and Technology Development Fund Projects (Qianke-hezhongyindi [2025] 024), Research Center Project of Guizhou University of Traditional Chi-nese Medicine (Guizhongyi ZX hezi [2024] 021).

Author ORCIDs

Wan-Hao Chen https://orcid.org/0000-0001-7240-6841

Jian-Dong Liang https://orcid.org/0000-0002-3939-3900

Nalin N. Wijayawardene https://orcid.org/0000-0003-0522-5498

Yan-Feng Han https://orcid.org/0000-0002-8646-3975

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

Bao DF, Hyde KD, Maharachchikumbura SS, Perera RH, Thiyagaraja V, Hongsanan S, Wanasinghe DN, Shen HW, Tian XG, Yang LQ, Luo ZL (2023) Taxonomy, phylogeny and evolution of freshwater Hypocreomycetidae (Sordariomycetes). Fungal Diversity 121(1): 1–94. https://doi.org/10.1007/s13225-023-00521-8

Behie SW, Bidochka MJ (2014) Nutrient transfer in plant–fungal symbioses. Trends in Plant Science 19(11): 734–740. https://doi.org/10.1016/j.tplants.2014.06.007

Behie SW, Padilla-Guerrero IE, Bidochka MJ (2013) Nutrient transfer to plants by phylogenetically diverse fungi suggests convergent evolutionary strategies in rhizospheric symbionts. Communicative & Integrative Biology 6(1): e22321. https://doi.org/10.4161/cib.22321

Bu J, Wei DP, Liu ZH, Yang Y, Liu ZL, Kang JC, Peng XC, Xie SW, Zhang HG, He ZJ, Huang SK, Zhang X, Hyde KD, Wijayawardene NN, Wen TC (2025) Molecular phylogeny and morphology reveal four novel species in Cordycipitaceae in China. MycoKeys 116: 91–124. https://doi.org/10.3897/mycokeys.116.147006

Cabral A, Rego C, Nascimento T, Oliveira H, Groenewald JZ, Crous PW (2012) Multi-gene analysis and morphology reveal novel Ilyonectria species associated with black foot disease of grapevines. Fungal Biology 116(1): 62–80. https://doi.org/10.1016/j.funbio.2011.09.010

Cai L, Jeewon R, Hyde KD (2006) Phylogenetic investigations of Sordariaceae based on multiple gene sequences and morphology. Mycological Research 110(2): 137–150. https://doi.org/10.1016/j.mycres.2005.09.014

Castlebury LA, Rossman AY, Sung GH, Hyten AS, Spatafora JW (2004) Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycological Research 108(8): 864–872. https://doi.org/10.1017/S0953756204000607

Chen WH, Liu C, Han YF, Liang JD, Tian WY, Liang ZQ (2019) Three novel insect-associated species of Simplicillium (Cordycipitaceae, Hypocreales) from Southwest China. MycoKeys 58: 83–102. https://doi.org/10.3897/mycokeys.58.37176

Chen W, Liang J, Ren X, Zhao J, Han Y, Liang Z (2021) Cryptic diversity of Isaria-like species in Guizhou, China. Life 11(10): 1093. https://doi.org/10.3390/life11101093

Chen WH, Liang JD, Ren XX, Zhao JH, Han YF, Liang ZQ (2022a) Phylogenetic, ecological and morphological characteristics reveal two new spider-associated genera in Clavicipitaceae. MycoKeys 91: 49–66. https://doi.org/10.3897/mycokeys.91.86812

Chen WH, Liang JD, Ren XX, Zhao JH, Han YF, Liang ZQ (2022b) Species diversity of Cordyceps-like fungi in the Tiankeng karst region of China. Microbiology Spectrum 10(5): e01975–22. https://doi.org/10.1128/spectrum.01975-22

Chen WH, Liang JD, Ren XX, Zhao JH, Han YF (2023) Two new species of Samsoniella (Cordycipitaceae, Hypocreales) from the Mayao River Valley, Guizhou, China. MycoKeys 99: 209–226. https://doi.org/10.3897/mycokeys.99.109961

Chen WH, Li D, Wei YJ, Liang JD, Han YF (2024a) Ovicillium sinense, a new species from Guizhou, China. Phytotaxa 662(2): 195–200. https://doi.org/10.11646/phytotaxa.662.2.8

Chen WH, Li D, Liang JD, Ren XX, Zhao JH, Han YF (2024b) Chlorocillium sinense sp. nov. (Clavicipitaceae) and Calcarisporium guizhouense sp. nov. (Calcarisporiaceae) in Hypocreales from China. MycoKeys 109: 91–107. https://doi.org/10.3897/mycokeys.109.128060

Chen WH, Li D, Liang JD, Ren XX, Zhao JH, Han YF (2024c) Two new Cordyceps-like species, Perennicordyceps zongqii sp. nov. (Polycephalomycetaceae) and Purpureocillium zongqii sp. nov. (Ophiocordycipitaceae), in Hypocreales from karst region of China. MycoKeys 110: 141–158. https://doi.org/10.3897/mycokeys.110.135724

Chen WH, Li D, Shu HL, Liang JD, Han YF (2024d) Taxonomic and phylogenetic characterizations reveal two new species and a new record of Simplicillium (Cordycipitaceae, Hypocreales) from the Mayao River Valley, Guizhou, China. Phytotaxa 677(3): 278–288. https://doi.org/10.11646/phytotaxa.677.3.7

Chen WH, Li D, Shu HL, Liang JD, Zhao JH, Tian WY, Han YF (2025) Four new araneogenous species and a new genus in Hypocreales (Clavicipitaceae, Cordycipitaceae) from the karst region of China. MycoKeys 112: 335–359. https://doi.org/10.3897/mycokeys.112.140799

Crous PW, Gams W, Stalpers JA, Robert V, Stegehuis G (2004) MycoBank: an online initiative to launch mycology into the 21^st century. Studies in Mycology 50(1): 19–22.

Crous PW, Schumacher RK, Wingfield MJ, Lombard L, Giraldo A, Christensen M, Gardiennet A, Nakashima C, Pereira OL, Smith AJ, Groenewald JZ (2015) Fungal systematics and evolution: FUSE 1. Sydowia 67: 81–118. https://doi.org/10.12905/0380.sydowia67-2015-0081

Crous PW, Wingfield MJ, Burgess TI, Hardy GEStJ, Gené J, Guarro J, Baseia IG, García D, Gusmão LFP, Souza-Motta CM, Thangavel R, Adamčík S, Barili A, Barnes CW, Bezerra JDP, Bordallo JJ, Cano-Lira JF, de Oliveira RJV, Ercole E, Hubka V, Iturrieta-González I, Kubátová A, Martín MP, Moreau PA, Morte A, Ordoñez ME, Rodríguez A, Stchigel AM, Vizzini A, Abdollahzadeh J, Abreu VP, Adamčíková K, Albuquerque GMR, Alexandrova AV, Álvarez Duarte E, Armstrong-Cho C, Banniza S, Barbosa RN, Bellanger JM, Bezerra JL, Cabral TS, Caboň M, Caicedo E, Cantillo T, Carnegie AJ, Carmo LT, Castañeda Ruíz RF, Clement CR, Čmoková A, Conceição LB, Cruz RHSF, Damm U, da Silva BDB, da Silva GA, da Silva RMF, de Santiago ALCM, Déniel F, de Oliveira LF, de Souza CAF, Déniel F, Dima B, Dong G, Edwards J, Félix CR, Fournier J, Gibertoni TB, Hosaka K, Iturriaga T, Jadan M, Jany JL, Jurjević Ž, Kolařík M, Kušan I, Landell MF, Leite Cordeiro TR, Lima DX, Loizides M, Luo S, Machado AR, Madrid H, Magalhães OMC, Marinho P, Matočec N, Mešić A, Miller AN, Morozova OV, Neves RP, Nonaka K, Nováková A, Oberlies NH, Oliveira-Filho JRC, Oliveira TGL, Papp V, Pereira OL, Perrone G, Peterson SW, Pham THG, Raja HA, Raudabaugh DB, Řehulka J, Rodríguez-Andrade E, Saba M, Schauflerová A, Shivas RG, Simonini G, Siqueira JPZ, Sousa JO, Stajsic V, Svetasheva T, Tan YP, Tkalčec Z, Ullah S, Valente P, Valenzuela-Lopez N, Abrinbana M, Viana Marques DA, Wong PTW, Xavier de Lima V, Groenewald JZ (2018) Fungal Planet description sheets: 716–784. Persoonia 40: 240–393. https://doi.org/10.3767/persoonia.2018.40.10

Ding M, Li Y, Bai Y, Gai P, Wang J, Jiang ZZ, Hu YF, XU LJ (2024) Albacillium hingganense gen. et sp. nov.(Clavicipitaceae) from forest litters in Northeast China. Phytotaxa 650(2): 157–168. https://doi.org/10.11646/phytotaxa.650.2.3

Drummond A, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7(1): e214. https://doi.org/10.1186/1471-2148-7-214

Duan YF, Li M, Xu KW, Zhang L, Zhang LB (2021) Protect China’s karst cave habitats. Science 374(6568): 699. https://doi.org/10.1126/science.abm5389

Hou LW, Giraldo A, Groenewald JZ, Rämä T, Summerbell RC, Huang GZ, Cai L, Crous PW (2023) Redisposition of acremonium-like fungi in Hypocreales. Studies in Mycology 105: 23–203. https://doi.org/10.3114/sim.2023.105.02

Hywel-Jones NL (1993) Torrubiella luteorostrata: A pathogen of scale insects and its association with Paecilomyces cinnamomeus with a note on Torrubiella tenuis. Mycological Research 97(9): 1126–1130. https://doi.org/10.1016/S0953-7562(09)80514-5

Jaklitsch WM, Voglmayr H (2012) Phylogenetic relationships of five genera of Xylariales and Rosasphaeria gen. nov. (Hypocreales). Fungal Diversity 52: 75–98. https://doi.org/10.1007/s13225-011-0104-2

James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G, Gueidan C, Fraker E, Miadlikowska J, Lumbsch HT, Rauhut A, Valérie Reeb A, Arnold E, Amtoft A, Stajich JE, Hosaka K, Sung GH, Johnson D, O’Rourke B, Crockett M, Binder M, Curtis JM, Slot JC, Wang Z, Wilson AW, Schüßler A, Longcore JE, O’Donnell K, Mozley-Standridge S, Porter D, Letcher PM, Powell MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA, Morton JB, Sugiyama J, Rossman AY, Rogers JD, Pfister DH, Hewitt D, Hansen K, Hambleton S, Shoemaker RA, Kohlmeyer J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW, Hughes KW, Matsuura K, Langer E, Langer G, Untereiner WA, Lücking R, Büdel B, Geiser DM, Aptroot A, Diederich P, Schmitt I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin DJ, Joseph W, Spatafora JW, Vilgalys R (2006) Reconstructing the early evolution of Fungi using a six̄gene phylogeny. Nature 443(7113): 818–822. https://doi.org/10.1038/nature05110

Jiang C, Qiu C, Wu Y, Zhu S, Shui W (2025) Karst Tiankeng is the refuge of microbial diversity in the degraded Karst Landscape. Land Degradation & Development 36: 3516–3526. https://doi.org/10.1002/ldr.5582

Johnson D, Sung GH, Hywel-Jones NL, Luangsa-ard JJ, Bischoff JF, Kepler RM, Spatafora JW (2009) Systematics and evolution of the genus Torrubiella (Hypocreales, Ascomycota). Mycological Research 113(3): 279–289. https://doi.org/10.1016/j.mycres.2008.09.008

Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285

Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010

Lawrey JD, Etayo J, Dal-Forno M, Driscoll KE, Diederich P (2015) Molecular data support establishment of a new genus for the lichenicolous species Neobaryausneae (Hypocreales). The Bryologist 118(1): 83–92. https://doi.org/10.1639/0007-2745-118.1.083

Li DW, Cowles RS, Vossbrinck CR (2008) Metarhiziopsis microspora gen. et sp. nov. associated with the elongate hemlock scale. Mycologia 100(3): 460–466. https://doi.org/10.3852/07-078R1

Liang JD, Han YF, Zhang JW, Du W, Liang ZQ, Li ZZ (2011) Optimal culture conditions for keratinase production by a novel thermophilic Myceliophthora thermophila strain GZUIFR-H49-1. Journal of Applied Microbiology 110(4): 871–880. https://doi.org/10.1111/j.1365-2672.2011.04949.x

Liang ZQ, Liang JD, Chen WH, Han YF, Zou X (2016) Phenotypic polymorphism of the stilbellaceousentomogenous fungi in an ant nest of Ponera II. A cryptic new Tilachlidium species, Tilachlidium poneraticum. Microbiology China 43(2): 379–385. https://doi.org/10.13344/j.microbiol.china.150379

Lin L, Lin Y, Keyhani NO, Pu H, Yang J, Xiong CJ, Shang JY, Mao YC, Yang LX, Zheng MH, Mu TC, Li Y, Liang HL, Fan LF, Ma XL, Xiong W, Qiu JZ, Guan XY (2025) New entomopathogenic species in the Clavicipitaceae family (Hypocreales, Ascomycota) from the subtropical forests of Fujian, China. Frontiers in Microbiology 16: 1532341. https://doi.org/10.3389/fmicb.2025.1532341

Liu YJ, Whelen S, Hall BD (1999) Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 16(12): 1799–1808. https://doi.org/10.1093/oxfordjournals.molbev

Liu JK, Lu YZ, Cheewangkoon R, To-Anun C (2018) Phylogeny and morphology of Helicotubeufia gen. nov., with three new species in Tubeufiaceae from aquatic habitats. Mycosphere 9: 495–509. https://doi.org/10.5943/mycosphere/9/3/4

Lombard L, Crous PW, Wingfield BD, Wingfield MJ (2010) Phylogeny and systematics of the genus Calonectria. Studies in Mycology 66(1): 31–69. https://doi.org/10.3114/sim.2010.66.03

Lombard L, van der Merwe NA, Groenewald JZ, Crous PW (2015) Generic concepts in Nectriaceae. Studies in Mycology 80(1): 189–245. https://doi.org/10.1016/j.simyco.2014.12.002

Long MK, Bai XY, Li ZL, Xue YY, Chen F, Li CJ, Ran C, Zhang SR, Du ZC, Song FJ, Xiao BQ, Xiong L (2024) Positive contribution and negative impact of karst rocky desertification control on biodiversity in southwest China. Acta Geographica Sinica 79(1): 97–113. https://doi.org/10.11821/dlxb202401007

Luo J, Zhuang WY (2010) Bionectria vesiculosa sp. nov. from Yunnan, China. Mycotaxon 113(1): 243–249. https://doi.org/10.5248/113.243

Ma Y, Suo F, Wang AL, Huang LD, Ye X, Zhang L, Li P, Gong J (2012) Segregation and bacteriostasis research of endophytes from Ophiocordyceps gracilis (Grev.) GH Sung, JM Sung, Hywel–Jones and Spatafora. Biotechnology 2: 107–111. https://doi.org/10.3969/j.issn.1004-311X.2012.02.045

Mongkolsamrit S, Thanakitpipattana D, Khonsanit A, Promharn R, Luangsa-ard JJ (2016) Conoideocrella krungchingensis sp. nov., an entomopathogenic fungus from Thailand. Mycoscience 57(4): 264–270. https://doi.org/10.1016/j.myc.2016.03.003

Moonjely S, Barelli L, Bidochka MJ (2016) Insect pathogenic fungi as endophytes. Advances in Genetics 94: 107–135. https://doi.org/10.1016/bs.adgen.2015.12.004

Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300

Özkan K, Gulsoy S, Mert A, Ozturk M, Muys B (2010) Plant distribution-altitude and landform relationships in karstic sinkholes of Mediterranean region of Turkey. Journal of Environmental Biology 31(1): 51–60.

Park MJ, Hong SB, Shin HD (2015) Lecanicillium uredinophilum sp. nov. associated with rust fungi from Korea. Mycotaxon 130(4): 997–1005. https://doi.org/10.5248/130.997

Peng XC, Wen TC, Wei DP, Liao YH, Wang Y, Zhang X, Wang GY, Zhou Y, Tangtrakulwanich K, Liang JD (2024) Two new species and one new combination of Ophiocordyceps (Hypocreales, Ophiocordycipitaceae) in Guizhou. MycoKeys 102: 245–266. https://doi.org/10.3897/mycokeys.102.113351

Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029

Sanjuan T, Tabima J, Restrepo S, Læssøe T, Spatafora JW, Franco-Molano AE (2014) Entomopathogens of Amazonian stick insects and locusts are members of the Beauveria species complex (Cordyceps sensu stricto). Mycologia 106(2): 260–275. https://doi.org/10.3852/13-020

Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, Fungal Barcoding Consortium Fungal Barcoding Consortium Author List , Bolchacova E, Voigt K, Crous PW, Miller AN, Wingfield MJ, Aime MC, An KD, Bai FY, Barreto RW, Begerow D, Bergeron MJ, Blackwell M, Boekhout T, Bogale M, Boonyuen N, Burgaz AR, Buyck B, Cai L, Cai Q, Cardinali G, Chaverri P, Coppins BJ, Crespo A, Cubas P, Cummings C, Damm U, de Beer ZW, de Hoog GS, Del-Prado R, Dentinger B, Diéguez-Uribeondo J, Divakar PK, Douglas B, Dueñas M, Duong TA, Eberhardt U, Edwards JE, Elshahed MS, Fliegerova K, Furtado M, García MA, Ge ZW, Griffith GW, Griffiths K, Groenewald JZ, Groenewald M, Grube M, Gryzenhout M, Guo LD, Hagen F, Hambleton S, Hamelin RC, Hansen K, Harrold P, Heller G, Herrera C, Hirayama K, Hirooka Y, Ho HM, Hoffmann K, Hofstetter V, Högnabba F, Hollingsworth PM, Hong SB, Hosaka K, Houbraken J, Hughes K, Huhtinen S, Hyde KD, James T, Johnson EM, Johnson JE, Johnston PR, Jones EBG, Kelly LJ, Kirk PM, Knapp DG, Kõljalg U, Kovács GM, Kurtzman CP, Landvik S, Leavitt SD, Liggenstoffer AS, Liimatainen K, Lombard L, Luangsa-ard JJ, Lumbsch HT, Maganti H, Maharachchikumbura SSN, Martin MP, May TW, McTaggart AR, Methven AS, Meyer W, Moncalvo JM, Mongkolsamrit S, Nagy LG, Nilsson RH, Niskanen T, Nyilasi I, Okada G, Okane I, Olariaga I, Otte J, Papp T, Park D, Petkovits T, Pino-Bodas R, Quaedvlieg W, Raja HA, Redecker D, Rintoul TL, Ruibal C, Sarmiento-Ramírez JM, Schmitt I, Schüßler A, Shearer C, Sotome K, Stefani FOP, Stenroos S, Stielow B, Stockinger H, Suetrong S, Suh SO, Sung GH, Suzuki M, Tanaka K, Tedersoo L, Telleria MT, Tretter E, Untereiner WA, Urbina H, Vágvölgyi C, Vialle A, Vu TD, Walther G, Wang QM, Wang Y, Weir BS, Weiß M, White MM, Xu JP, Yahr R, Yang ZL, Yurkov A, Zamora JC, Zhang N, Zhuang WY, White DS, Schindel D (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences 109(16): 6241–6246. https://doi.org/10.1073/pnas.1117018109

Spatafora JW, Sung GH, Johnson D, Hesse C, O’Rourke B, Serdani M, Spotts R, Lutzoni F, Hofstetter V, Miadlikowska J, Reeb V, Gueidan C, Fraker E, Lumbsch T, Lücking R, Schmitt I, Hosaka K, Aptroot A, Roux C, Miller AN, Geiser DM, Hafellner J, Hestmark G, Arnold AE, Büdel B, Rauhut A, Hewitt D, Untereiner WA, Cole MS, Scheidegger C, Schultz M, Sipman H, Schoch CL (2006) A five-gene phylogeny of Pezizomycotina. Mycologia 98(6): 1018–1028. https://doi.org/10.1080/15572536.2006.11832630

Spatafora JW, Sung GH, Sung JM, Hywel‐Jones NL, White Jr JF (2007) Phylogenetic evidence for an animal pathogen origin of ergot and the grass endophytes. Molecular Ecology 16(8): 1701–1711. https://doi.org/10.1111/j.1365-294X.2007.03225.x

Su Y, Tang Q, Mo F, Xue Y (2017) Karst tiankengs as refugia for indigenous tree flora amidst a degraded landscape in southwestern China. Scientific Reports 7(1): 1–10. https://doi.org/10.1038/s41598-017-04592-x

Summerbell RC, Gueidan C, Schroers HJ, de Hoog GS, Starink M, Rosete YA, Guarro J, Scott JA (2011) Acremonium phylogenetic overview and revision of Gliomastix, Sarocladium, and Trichothecium. Studies in Mycology 68(1): 139–162. https://doi.org/10.3114/sim.2011.68.06

Sun JZ, Dong CH, Liu XZ, Liu JK, Hyde KD (2016) Calcarisporium cordycipiticola sp. nov., an important fungal pathogen of Cordyceps militaris. Phytotaxa 268(2): 135–144. https://doi.org/10.11646/phytotaxa.268.2.4

Sun JZ, Liu XZ, Hyde KD, Zhao Q, Sajeewa S, Maharachchikumbura N, Camporesi E, Bhat J, Nilthong S, Lumyong S (2017) Calcarisporium xylariicola sp. nov. and introduction of Calcarisporiaceae fam. nov. in Hypocreales. Mycological Progress 16(4): 433–445. https://doi.org/10.1007/s11557-017-1290-4

Sun YR, Jayawardena RS, Sun JE, Wang Y (2023) Pestalotioid species associated with medicinal plants in southwest China and Thailand. Microbiology Spectrum 11(1): e03987–e22. https://doi.org/10.1128/spectrum.03987-22

Sun JE, Fu L, Norphanphoun C, Chen XJ, Yu LF, Hyde KD, McKenzie EHC, Wang Y, Yang ZF, Liu FQ (2024) Study on the diversity of rust pathogens from different hosts in Guizhou Province, China. Mycosphere 15(1): 473–653. https://doi.org/10.5943/mycosphere/15/1/4

Sung GH, Spatafora JW, Zare R, Hodge KT, Gams W (2001) A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72(3): 311–328. https://doi.org/10.1127/nova.hedwigia/72/2001/311

Sung GH, Hywel-Jones NL, Sung JM, Luangsa-ard JJ, Shrestha B, Spatafora JW (2007) Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Studies in Mycology 57: 5–59. https://doi.org/10.3114/sim.2007.57.01

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197

Tarafder E, Zhang WJ, Karunarathna SC, Elgorban AM, Huilian M, Nan W, Zeng XY, Wang Y, Tian FH (2024) Unveiling two new species of Trichoderma (Hypocreales, Hypocreaceae) that cause green mold disease on Stropharia rugosoannulata from Guizhou Province, China. MycoKeys 110: 361–383. https://doi.org/10.3897/mycokeys.110.134154

Trifinopoulos J, Nguyen LT, von Haeseler A, Minh BQ (2016) W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research 44(W1): W232–W235. https://doi.org/10.1093/nar/gkw256

Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics : The International Journal of the Willi Hennig Society 27(2): 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x

Vidhate RP, Dawkar VV, Punekar SA, Giri AP (2023) Genomic determinants of entomopathogenic fungi and their involvement in pathogenesis. Microbial Ecology 85: 49–60. https://doi.org/10.1007/s00248-021-01936-z

Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8): 4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990

Wang ZQ, Ma JM, Yang ZL, Zhao J, Yu ZY, Li JH, Yu H (2024) Morphological and phylogenetic analyses reveal three new species of entomopathogenic fungi belonging to Clavicipitaceae (Hypocreales, Ascomycota). Journal of Fungi 10(6): 423. https://doi.org/10.3390/jof10060423

Wang HY, Dong C, Zhang YW, Chen WH, Han YF (2025a) Biconidium sinense gen. et sp. nov. (Hypocreales, Bionectriaceae) and Didymocyrtis shanxiensis sp. nov. (Phaeosphaeriaceae, Didymocyrtis) isolated from urban soil in China. MycoKeys 116: 327–344. https://doi.org/10.3897/mycokeys.116.146683

Wang FH, Xu XL, Zeng Q, Liu LJ, Liu F, Deng Y, Sun QR, Yan YQ, Li XY, Xiang SS, Shui Q, Liu YG, Li SJ, Yang H, Han S, Liu L, Yang CL (2025b) Microfungi associated with walnut trees in southwestern China. Mycosphere 16(1): 2002–2258. https://doi.org/10.5943/mycosphere/16/1/12

Wang Y, Tang DX, Chen H, Li QR, Loinheuang C, Shen XC (2025c) Phylogenetic evidence reveal a close relationship between Amphichorda and Ovicillium in Bionectriaceae (Hypocreales). MycoKeys 117: 337–352. https://doi.org/10.3897/mycokeys.117.151366

White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR protocols: a guide to methods and applications. Academic Press, New York, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1

Wijayawardene NN, Dissanayake LS, Li QR, Dai DQ, Xiao YP, Wen TC, Karunarathna SC, Wu HX, Zhang H, Tibpromma S, Kang JC, Wang Y, Shen XC, Tang LZ, Deng CY, Liu YX, Kang YQ (2021) Yunnan–Guizhou Plateau: A mycological hotspot. Phytotaxa 523(1): 1–31. https://doi.org/10.11646/phytotaxa.523.1.1

Wu J, Zhang CH (2020) Research status and prospect of karst Tiankengs in Guizhou Province. Carsologica Sinica 39(1): 119–126.

Xiao YP, Wen TC, Hongsanan S, Jeewon R, Luangsa-ard JJ, Brooks S, Wanasinghe DN, Long FY, Hyde KD (2018) Multigene phylogenetics of Polycephalomyces (Ophiocordycipitaceae, Hypocreales), with two new species from Thailand. Scientific Reports 8(1): 18087. https://doi.org/10.1038/s41598-018-36792-4

Xiao YP, Wang YB, Hyde KD, Eleni G, Sun JZ, Yang Y, Meng J, Yu H, Wen TC (2023) Polycephalomycetaceae, a new family of clavicipitoid fungi segregates from Ophiocordycipitaceae. Fungal Diversity 120(1): 1–76. https://doi.org/10.1007/s13225-023-00517-4

Xu Y, Shen ZH, Ying LX, Wang ZH, Huang JH, Zang RG, Jiang YX (2017) Hotspot analyses indicate significant conservation gaps for evergreen broadleaved woody plants in China. Scientific Reports 7: 1859. https://doi.org/10.1038/s41598-017-02098-0

Xu ZS, Deng LP, Wang HY, Tian HL, Qu JJ, Dai YD, Zou X (2025) Description of two new species of Ophiocordyceps: O. sinocampes and O. cystidiata (Ophiocordycipitaceae, Hypocreales) from typical karst landform forests in Guizhou, China. MycoKeys 114: 1–27. https://doi.org/10.3897/mycokeys.114.134323

Zare R, Gams W (2016) More white verticillium-like anamorphs with erect conidiophores. Mycological Progress 15(10): 993–1030. https://doi.org/10.1007/s11557-016-1214-8

Zhang N, Castlebury LA, Miller AN, Huhndorf SM, Schoch CL, Seifert KA, Rossman AY, Rogers JD, Kohlmeyer J, Volkmann-Kohlmeyer B, Sung GH (2006) An overview of the systematics of the Sordariomycetes based on a four-gene phylogeny. Mycologia 98(6): 1076–1087. https://doi.org/10.1080/15572536.2006.11832635

Zhang D, Gao F, Jakovlic I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096

Zhang ZY, Feng Y, Tong SQ, Ding CY, Tao G, Han YF (2023) Morphological and phylogenetic characterisation of two new soil-borne fungal taxa belonging to Clavicipitaceae (Hypocreales, Ascomycota). MycoKeys 98: 113–132. https://doi.org/10.3897/mycokeys.98.106240

Zhao L, Groenewald JZ, Hou LW, Summerbell RC, Crous PW (2025) Bionectriaceae: A poorly known family of hypocrealean fungi with major commercial potential. Studies in Mycology 111: 115–198. https://doi.org/10.3114/sim.2025.111.04

Zhuang WY, Zeng ZQ (2017) Cocoonihabitus sinensis gen. et sp. nov. on remaining leaf veins of cocoons in a new family (Cocoonihabitaceae fam. nov.) of Hypocreales. Mycosystema 36(12): 1591–1598. https://doi.org/10.13346/j.mycosystema.170176

Zou X, Liu AY, Liang ZQ, Han YF, Yang M (2010) Hirsutella libоensis, a new entomopathogenic species affecting Cossidae (Lepidoptera) in China. Mycotaxon 111(1): 39–44. https://doi.org/10.5248/111.39

Supplementary materials

Supplementary material 1

List of recent studies reported new arthropods-associated fungi in nine families