Thirty novel fungal lineages: formal description based on environmental samples and DNA

Leho Tedersoo; Mahdieh S. Hosseyni Moghadam; Kristel Panksep; Victoria Prins; Sten Anslan; Vladimir Mikryukov; Mohammad Bahram; Kessy Abarenkov; Urmas Kõljalg; Keyvan Esmaeilzadeh-Salestani; Julia Pawłowska; Christian Wurzbacher; Yi Ding; Saad Hussin Alkahtani; R. Henrik Nilsson

doi:10.3897/mycokeys.124.161674

Research Article

Thirty novel fungal lineages: formal description based on environmental samples and DNA

Leho Tedersoo^‡§, Mahdieh S. Hosseyni Moghadam^‡, Kristel Panksep^|‡¶, Victoria Prins^‡, Sten Anslan^‡#¤, Vladimir Mikryukov^‡, Mohammad Bahram^‡«¶, Kessy Abarenkov^‡, Urmas Kõljalg^‡, Keyvan Esmaeilzadeh-Salestani^‡, Julia Pawłowska^», Christian Wurzbacher^˄, Yi Ding^˅, Saad Hussin Alkahtani^§, R. Henrik Nilsson^¦

‡ University of Tartu, Tartu, Estonia

§ King Saud University, Riyadh, Saudi Arabia

| Estonian University of Life Sciences, Kreutzwaldi, Estonia

¶ Swedish University of Agricultural Sciences, Uppsala, Sweden

# University of Jyväskylä, Jyväskylä, Finland

¤ Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia

« Aarhus University, Slagelse, Denmark

» University of Warsaw, Warsaw, Poland

˄ Technical University of Munich, Garching, Germany

˅ Chinese Academy of Sciences, Wuhan, China

¦ University of Gothenburg, Göteborg, Sweden

Corresponding author: Leho Tedersoo ( leho.tedersoo@ut.ee )

Academic editor: Thorsten Lumbsch

© 2025 Leho Tedersoo, Mahdieh S. Hosseyni Moghadam, Kristel Panksep, Victoria Prins, Sten Anslan, Vladimir Mikryukov, Mohammad Bahram, Kessy Abarenkov, Urmas Kõljalg, Keyvan Esmaeilzadeh-Salestani, Julia Pawłowska, Christian Wurzbacher, Yi Ding, Saad Hussin Alkahtani, R. Henrik Nilsson.

This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Citation: Tedersoo L, Hosseyni Moghadam MS, Panksep K, Prins V, Anslan S, Mikryukov V, Bahram M, Abarenkov K, Kõljalg U, Esmaeilzadeh-Salestani K, Pawłowska J, Wurzbacher C, Ding Y, Alkahtani SH, Nilsson RH (2025) Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121. https://doi.org/10.3897/mycokeys.124.161674

Abstract

Molecular analyses of soil and water commonly reveal large proportions of fungal taxa that cannot be assigned to any taxonomic or functional groups. Some of these so-called dark taxa have been encoded alphanumerically, while others have remained completely overlooked. Using long-read sequencing that covers much of the ribosomal RNA operon, we shed light on the phylogenetic and ecological distribution of fungal dark taxa and formally describe 30 of the most prominent phylum- to order-level lineages based on their characteristic DNA features. This increases the known large-scale fungal phylogenetic diversity by roughly one-third. Formal names will enhance taxonomic reproducibility, facilitate communication among researchers, and enable the estimation of conservation and quarantine needs for uncultivable species and higher-ranking taxa. The new species in the respective highest-level novel taxonomic groups include Pantelleria saittana (Pantelleriomycetes), Paraspizellomyces parrentiae (Paraspizellomycetales), Aquieurochytrium lacustre (Aquieurochytriomycetes), Edaphochytrium valuojaense (Edaphochytriomycetes), Tibetochytrium taylorii (Tibetochytriomycetes), Tropicochytrium toronegroense (Tropicochytriomycetes), Algovorax scenedesmi (comb. nov.) and Solivorax pantropicus (Algovoracomycetes), Aquamastix sanduskyensis (Aquamastigomycetes), Cantoromastix holarctica (Cantoromastigomycetes), Dobrisimastix vlkii (Dobrisimastigomycetes), Palomastix lacustris (Palomastigomycetes), Sedimentomastix tueriensis (Sedimentomastigomycetes), Terrincola waldropii (Terrincolales), Curlevskia holarctica (Curlevskiomycota), Mycosocceria estonica (Mycosocceriales), Maerjamyces jumpponenii (Maerjamycetes), Ruderalia cosmopolita (Ruderaliomycetes), Bryolpidium mundanum (Bryolpidiomycetes), Chthonolpidium enigmatum (Chthonolpidiomycetes), Savannolpidium raadiense (Savannolpidiomycetes), Gelotisporidium boreale (Gelotisporidiomycetes), Sumavosporidium sylvestre (Sumavosporidiomycetes), Parakickxella borikenica (Parakickxellomycetes), Aldinomyces tarquinii (Aldinomycota), Borikenia urbinae (Borikeniomycota), Mirabilomyces abrukanus (Mirabilomycota), Nematovomyces vermicola (comb. nov.) and N. soinasteënsis (Nematovomycota), Viljandia globalis (Viljandiomycota), Waitukubulimyces cliftonii (Waitukubulimycota), and Tartumyces setoi (Tartumyceta).

Key words:

Dark taxa, DNA-based taxonomy, early-diverging fungal lineages, higher-level classification, legitype, nucleotype, phylogeny of fungi

Introduction

Fungi are tremendously diverse regarding species numbers and evolutionary divergence (Tedersoo et al. 2018; Voigt et al. 2021; Niskanen et al. 2023; Quandt et al. 2023; Seto et al. 2023). Despite their fundamental biological roles and importance in ecosystem functioning, the taxonomy and classification of fungi lag far behind those of macroscopic plants and animals. This disparity is related to their microscopic size, challenges in isolation, establishing pure cultures, and the relatively limited number of taxonomists specializing in this area (Niskanen et al. 2023; Seto et al. 2023). Advances in nucleic acid sequencing technologies have revolutionized our understanding of fungal diversity, revealing previously unrecognized lineages and shedding light on their ecological roles (Tedersoo et al. 2017; Ahrendt et al. 2018; Galindo et al. 2021; Seto et al. 2023).

Unlike prokaryotes, which can be described solely based on nearly full-length genome sequences according to SeqCode (Hedlund et al. 2022), the solutions for DNA-based taxonomy remain poorly regulated for hitherto uncultured and unobserved fungi by the International Code of Nomenclature (ICN) for algae, fungi, and plants (ICNAFP; Turland et al. 2025) and the ICN for animals (ICZN), which handles microsporidia (International Commission on Zoological Nomenclature 1999). For example, it remains unclear to what extent voucher specimens and samples may contain other organisms (e.g., lichenized fungi) and whether DNA, as a part of an organism, can be used as type material.

In the research and practitioner communities, there is a high demand for communicating fungal taxa (Ryberg and Nilsson 2018; Kõljalg et al. 2020). In particular, identifying and categorizing species into higher-ranking taxonomic groups is essential for understanding the biodiversity and functioning of the surrounding microbiome, as well as for incorporating them into legislative frameworks (Lücking et al. 2021; Nilsson et al. 2023). The absence of a universally accepted framework for naming limits the potential for consistent identification and comparison of these organisms across studies and ecosystems (Nilsson et al. 2023).

In mycology, higher-ranking taxonomic groups of previously undescribed lineages (PULs) are often indicated by non-standardized alphanumeric identifiers or other types of informal names. These names typically vary across research groups, which complicates data synthesis and across-study comparisons (Arroyo et al. 2018; Kõljalg et al. 2020; Tedersoo et al. 2024). Some of the order-to-phylum-level PULs within or close to the fungal kingdom were, as a rule, evinced from relatively short, sometimes non-overlapping marker gene fragments from specific habitats (Tedersoo et al. 2017; Arroyo et al. 2018; Quandt et al. 2023). Here, we combine a long-read, high-throughput sequencing approach of soil and sediment samples with recently released long-read data in public databases to accommodate the PULs into the fungal tree of life. Our main objective is to characterize and formally describe these enigmatic fungal lineages based on voucher samples and eDNA, long-read sequences, and phylogenetic analyses to progress towards completion of the fungal tree of life.

Materials and methods

We downloaded the sequence data identified to any fungal phylum (but not to class or lower taxonomic levels), unspecified fungi, or unspecified eukaryotes from three nucleotide sequence databases: NCBI (https://www.ncbi.nlm.nih.gov/), UNITE v9.1 (Abarenkov et al. 2024; https://unite.ut.ee/), and EUKARYOME v1.9.2 (Tedersoo et al. 2024; https://eukaryome.org/). These sequences were first assigned to rough taxonomic groups based on BLASTn queries against identified sequences in EUKARYOME. Within these groups, long reads containing > 1000 bp of the 18S rRNA gene (SSU) and/or > 1000 bp of the 28S rRNA gene (LSU) were selected for preliminary phylogenetic analyses using long-read reference sequences from all eukaryotic phyla. The sequences were aligned using MAFFT v7 (Katoh and Standley 2013), followed by manual trimming of overarching and misaligned ends, trimming of introns in internal transcribed spacer (ITS) regions, and manual correction in case of apparent misalignments using AliView v1.26 (Larsson 2014). The alignments were processed in ClipKIT v1.4.0 (Steenwyk et al. 2020) to remove phylogenetically uninformative positions. Preliminary phylogenetic analyses were performed using IQ-TREE v2.2.5 (Minh et al. 2020), including 1000 trees and 1000 ultrafast bootstrap replicates. The trees were visualized in FigTree v1.4.4 (Rambaut 2018) for phylogeny-guided taxonomic regrouping of unknown fungi into PULs. During this process, we marked and removed low-quality and chimeric reads (around 10% of all reads). We then performed more focused phylogenetic analyses for the fungal kingdom by adding at least one representative sequence per order (or class in Basidiomycota and Ascomycota) as described above and keeping representative sequences of Choanoflagellozoa and Nucleariae, a sister group of fungi, as an outgroup.

Based on fungal phylogenies, we removed reads from any unknown fungi that formed ultra-long branches but had no evidence of quality issues. Due to their long branches and destabilizing effect on the phylogenetic estimates, we also removed representatives of Microsporidia, Caulochytriales, Nephridiophagales, Dimargaritales, Asellariales, and Coelomomycetales after ensuring that these groups affiliate with none of the PULs. From each taxonomic group of PULs, we kept the longest reads characteristic of sublineages to avoid oversizing the phylograms. For the final phylogenetic analysis, we added a few shorter reads by using the MAFFT “align” option if these were deemed important for genus-level taxonomic interpretation of the PULs (i.e., delimiting new genera). To keep the main focus at the phylum level, we excluded most class-level PULs of Rozellomycota (syn. Cryptomycota), Ascomycota, and Basidiomycota, all of which warrant separate analyses of similar magnitude. We only handled two large PULs of Rozellomycota that were placed in other phylogenetic positions based on previous analyses using much smaller datasets (clades GS01 and GS15 in Tedersoo et al. 2017).

For each fungal PUL, we prepared additional separate phylogenetic analyses by compiling all existing sequence data and associated geographical and ecological metadata (as of 30 September 2024) in NCBI, UNITE, EUKARYOME, the Global Soil Mycobiome Consortium (GSMc) project (Tedersoo et al. 2021), and the FunAqua project (water and sediment samples; https://sisu.ut.ee/funaqua/). We also queried representative sequences of PULs against GlobalFungi v5.0 (Vetrovsky et al. 2020) to obtain additional sequences and associated information on the distribution of these species based on previous short-read amplicon studies. For inclusive phylogenetic analysis of each PUL, a few representatives of sister taxa, determined based on the main analysis, were selected as an outgroup. Reads with compromised quality were excluded based on MAFFT alignments covering the SSU, ITS, and LSU regions and preliminary phylograms. We determined the potential type species and assignment of terminal taxa into genera and higher-level taxonomic groups based on the final alignments and phylograms. Potential type species were selected considering i) their commonness, ii) representation of the entire PUL (i.e., assignment to one of the main sublineages), iii) representation by at least one ultra-long read with an available DNA sample and rich metadata, and iv) unequivocal distinction from closely related species based on the ITS region. The ITS region is the formal fungal DNA barcode (Schoch et al. 2012) and the most broadly used marker for species-level identification (Nilsson et al. 2019).

Diagnoses of species were prepared based on molecular characters in the ITS and LSU regions by selecting the most characteristic short, unique barcodes of typically 20 bases that we refer to as diagnostic nucleotide signatures (Labeda et al. 2001) for the target species based on the PUL-specific alignments. Within the ITS region, we specifically focused on ITS2 because of more available sequence data and fewer homopolymers that give rise to sequencing errors. The diagnostic nucleotide signatures were required to have a minimum number of ambiguous positions for the target species and a maximum number of mismatches to closely related species. Based on the alignments, we estimated the number of allowed mutations for the target species to be distinguishable from any related species. For the entire alignment length of ITS2 and LSU, we estimated intraspecific sequence variability based on the maximum proportion of differences among individual reads. For the LSU, characteristic barcodes and intraspecific variability are less clear due to smaller read coverage and the lower number of species available for comparison. Similar but typically shorter diagnostic nucleotide signatures were determined for genera and higher-ranking taxa. The positions of diagnostic nucleotide signatures refer to the positions of the ex-holotype sequence for the ITS region and additionally to Saccharomyces cerevisiae reference strain S288C accession NR_132207 (locus tag YNCL0010C) for SSU (NR_132213), 5.8S (NR_132211), and LSU (NR_132209). We used the information on ITS intraspecific variability of the type species for clustering and manual assessment of phylograms to produce rough estimates of potential species richness at the levels of PUL and genus. No attempt was made to extrapolate to unsampled species.

The vouchered physical samples that served as a basis for long-read sequence data were selected as holotypes to describe the type species, following Kirk and Griffith (2021). These vouchered-type samples, along with the extracted and vouchered eDNA samples, are deposited in the repository of the University of Tartu (acronym TUE, with 6-digit accession numbers) unless mentioned otherwise. We propose the term “nucleotype” (nucleotypus in Latin) to stand for these ex-type DNA samples, which under certain circumstances (e.g., when the holotype is lost) could also be used as types (Tedersoo et al. 2025). We also propose the term “legitype” (legitypus in Latin) to denote the main holotype-derived DNA sequence that is used to represent the species. Legitypes constitute amplicon-derived DNA barcodes or whole-genome sequences that are intended to act as ex-type DNA sequences or as types (for example, when the holotype and nucleotype are lost, or when the research community decides to shift to sequence-based typification). Here, we determined legitypes among the longest and highest-quality sequences derived from the nucleotype of preserved physical voucher samples. Most of the holotypes and underlying environmental samples used for typification originate from composite topsoil samples of the GSMc project, water and sediment samples of the FunAqua project, and various material samples sequenced by Jamy et al. (2022). These samples are accordingly referred to in the species descriptions and their voucher information in TUE. Legitype and other DNA sequences with metadata were first deposited in the EUKARYOME database (denoted by “EUK” with 7-digit accession numbers) and subsequently submitted to the UNITE and European Nucleotide Archive (accessions OZ253786–OZ253832) databases.

For the naming of taxa, all co-authors were invited to propose names separately for species epithets and genera, including justification and etymology. Based on the geographical and ecological metadata and collector information of type material and additional samples, co-authors were instructed to propose characteristic names by favoring local languages but avoiding names of co-authors and those potentially insulting or related to the dominant plant species. All proposed names were checked for homonymy and spelling correctness. Then, all co-authors voted for the most suitable names; in case of equal votes, the first author decided on the final name. Such naming conventions are common in mycology, although adjectives prevail in classical names described based on culture or fruiting body specimens or illustrations (Smith 2024). Apart from typification, species descriptions follow the best practices for fungi (Aime et al. 2021).

For establishing higher-ranking taxa, such as genera, families, orders, classes, phyla, and subkingdoms, we used the following criteria: i) monophyly; ii) bootstrap support > 95; iii) phylogenetic breadth and divergence roughly comparable to previously described taxa; and iv) minimizing the number of novel taxa (i.e., preferably retaining larger groups if there were multiple alternative splitting possibilities). Names of higher taxa were derived from generic names.

Results and discussion

Novel fungal lineages

Maximum likelihood phylogenetic analyses of long-read rRNA markers across eukaryotes and within fungi grouped the PULs into 30 coherent, monophyletic taxonomic groups within the fungal kingdom (Table 1, Fig. 1, Suppl. material 1: fig. S1). Six of these groups correspond to previously noted distinct fungal lineages with alphanumeric identifiers (Tedersoo et al. 2017; Arroyo et al. 2018; Seto et al. 2023). Others constitute entirely novel taxa, although searches against nucleotide sequence databases usually reveal strong matches to previous entries of environmental sequences produced by cloning and Sanger sequencing (Waldrop et al. 2006; Curlevski et al. 2014) or various high-throughput sequencing technologies (Anderson et al. 2018; Eshghi Sahraei et al. 2022). Based on a conservative taxonomic approach, eight of these PULs correspond to novel phyla and add significantly to the hitherto recognized phylogenetic diversity of fungi (11–18 phyla, depending on classification; Tedersoo et al. 2018; James et al. 2020; Hyde et al. 2024). Outside these novel phyla, we describe and delimit 22 well-supported class- or order-level groups in the non-Dikarya. In total, we describe 29 new species, 31 genera, 31 families, 31 orders, 27 classes, and 8 phyla, and propose two new taxonomic combinations (Table 1; see below). The fungal taxonomic table, updated from the Outline of Fungi (Hyde et al. 2024), is provided as Suppl. material 2.

Table 1.

Download as

CSV

XLSX

Newly proposed phyla, classes, orders, genera and species.

Phylum	Class	Order	Genus and species
Aldinomycota	Aldinomycetes	Aldinomycetales	Aldinomyces tarquinii
Aphelidiomycota ¹	Pantelleriomycetes	Pantelleriales	Pantelleria saittana
Borikeniomycota	Borikeniomycetes	Borikeniales	Borikenia urbinana
Calcarisporiellomycota ¹	Calcarisporiellomycetes ²	Terrincolales	Terrincola waldropii
Chytridiomycota ¹	Aquaeurochytriomycetes	Aquaeurochytriales	Aquieurochytrium lacustre
Chytridiomycota ¹	Edaphochytriomycetes	Edaphochytriales	Edaphochytrium valuojaense
Chytridiomycota ¹	Spizellomycetes ²	Paraspizellomycetales	Paraspizellomyces parrentiae
Chytridiomycota ¹	Tibetochytriomycetes	Tibetochytriales	Tibetochytrium taylorii
Chytridiomycota ¹	Tropicochytriomycetes	Tropicochytriales	Tropicochytrium toronegroense
Curlevskiomycota	Curlevskiomycetes	Curlevskiales	Curlevskia holarctica
Kickxellomycota ¹	Parakickxellomycetes	Parakickxellales	Parakickxella borikenica
Mirabilomycota	Mirabilomycetes	Mirabilomycetales	Mirabilomyces abrukanus
Monoblepharomycota ¹	Algovoracomycetes	Algovoracales	Algovorax scenedesmi
Monoblepharomycota ¹	Algovoracomycetes	Solivoracales	Solivorax pantropicus
Mortierellomycota ¹	Maerjamycetes	Maerjamycetales	Maerjamyces jumpponenii
Mortierellomycota ¹	Mortierellomycetes ²	Mycosocceriales	Mycosocceria estonica
Mortierellomycota ¹	Ruderaliomycetes	Ruderaliales	Ruderalia cosmopolita
Nematovomycota	Nematovomycetes	Nematovomycetales	Nematovomyces soinasteënsis³
Neocallimastigomycota ¹	Aquamastigomycetes	Aquamastigales	Aquamastix sanduskyensis
Neocallimastigomycota ¹	Cantoromastigomycetes	Cantoromastigales	Cantoromastix holarctica
Neocallimastigomycota ¹	Dobrisimastigomycetes	Dobrisimastigales	Dobrisimastix vlkii
Neocallimastigomycota ¹	Palomastigomycetes	Palomastigales	Palomastix lacustris
Neocallimastigomycota ¹	Sedimentomastigomycetes	Sedimentomastigales	Sedimentomastix tueriensis
Olpidiomycota ¹	Bryolpidiomycetes	Bryolpidiales	Bryolpidium mundanum
Olpidiomycota ¹	Chthonolpidiomycetes	Chthonolpidiales	Chthonolpidium enigmatum
Olpidiomycota ¹	Savannolpidiomycetes	Savannolpidiales	Savannolpidium raadiense
Rozellomycota ¹	Gelotisporidiomycetes	Gelotisporidiales	Gelotisporidium boreale
Rozellomycota ¹	Sumavosporidiomycetes	Sumavosporidiales	Sumavosporidium sylvestre
Tartumycota	Tartumycetes	Tartumycetales	Tartumyces setoi
Waitukubulimycota	Waitukubulimycetes	Waitukubulimycetales	Waitukubulimyces cliftonii
Viljandiomycota	Viljandiomycetes	Viljandiales	Viljandia globalis

Figure 1.

Maximum Likelihood SSU-5.8S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95%/99% are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.

Most PULs were detected mainly from soil, except Aquieurochytriomycetes, Aquamastigomycetes, Palomastigomycetes, and Sedimentomastigomycetes, which were more frequent in freshwater or sediment samples (Suppl. material 3). This may be related to the fact that soil is the principal habitat for most fungal species (Anthony et al. 2023). A majority of PULs featured terrestrial as well as aquatic fungi, suggesting the occurrence of multiple habitat transitions in these groups as commonly observed in other fungi and eukaryotes (Jamy et al. 2022). Nearly all PULs had a broad distribution across multiple biomes and continents, indicating low endemicity at higher taxonomic levels. Borikeniomycota and Tropicochytriomycetes were globally distributed but displayed most records in neotropical habitats.

We estimate that the present PULs comprise from five species (Maerjamycetes, Sedimentomastigomycetes, and Tibetochytriomycetes) to around 1,000 and beyond (Mirabilomycota, Parakickxellomycetes, and Sumavosporidiomycetes) based on phylogenies and clustering analyses. This is markedly less than the richness of most extant fungal phyla, whose members number in the thousands based on DNA sequences (Abarenkov et al. 2024). Still, the values compare well with some less speciose fungal phyla, such as Zoopagomycota and Blastocladiomycota, and especially Calcarisporiellomycota, which comprises only two described species. Here, the newly described Calcarisporiellomycota order Terrincolales (50–70 species) is more diverse than the previously described Calcarisporiellales (2 species). Furthermore, many previously described fungal classes are monospecific (e.g., Barbatosporomycetes and Novakomycetes), indicating that very small deep lineages are common in fungi and, thus, many more such lineages are expected to be found. A few putatively phylum- and class-level orphan lineages, with insufficient records for formal description, are indicated in the phylogram (Fig. 1). Collectively, the newly described taxa harbor around 5,000–6,000 species, roughly corresponding to 3.1–3.7% of the 165,000 accepted fungal species and up to 0.20–0.25% of the estimated fungal richness of 2–3 million species (Niskanen et al. 2023).

Overview of novel taxa

Out of the 30 major PULs, our analysis revealed that Tartumycota (represented by Tartumyces setoi sp. nov.), formerly known as clade BCG2 or freshol1, forms a sister group to all other fungi with strong statistical support (Fig. 1, Suppl. material 1: fig. S1) and warrants a subkingdom of its own (Tartumyceta subreg. nov.). Although most records originate from the soil environment, single-cell images of Tartumycota sp. indicate its potentially parasitic associations with green algae in aquatic habitats (Seto et al. 2023). This group likely parasitizes soil surface chlorophytes as well.

The phylum Rozellomycota (syn. Cryptomycota) harbors phylogenetically and functionally highly diverse groups, including extracellular and intracellular parasites (Fig. 1; Quandt et al. 2023). Using a deep sampling of Rozellomycota, we find that the two previously reported long-branching clades, GS01 (described as class Sumavosporidiomycetes, represented by Sumavosporidium sylvestre sp. nov.) and GS15 (Gelotisporidiomycetes, represented by Gelotisporidium boreale sp. nov.), form deep, well-supported lineages within this phylum. Both classes occur mainly in soil. As with all other members of rozellids, these groups are believed to be parasites.

Aphelids (subkingdom Aphelidiomyceta) comprise the phylum Aphelidiomycota, in which we propose a new class, Pantelleriomycetes (type species, Pantelleria saittana sp. nov.). Pantelleriomycetes forms a deep-diverging but well-supported sister clade to the rest of the Aphelidiomycota. Individual records of this group are derived mainly from soil but also from water, sediment, and plant leaves across all continents. There is no unequivocal indication of a putative lifestyle for Pantelleriomycetes species. Still, we hypothesize that the members of this group are parasites, consistent with the behavior observed in all other known aphelids (Karpov et al. 2014).

Chytrids (subkingdom Chytridiomyceta) harbor multiple novel lineages. In Chytridiomycota s. stricto, our analyses reveal the new classes Aquieurochytriomycetes (Aquieurochytrium lacustre sp. nov.), Edaphochytriomycetes (Edaphochytrium valuojaense sp. nov.), Tibetochytriomycetes (Tibetochytrium taylorii sp. nov.), and Tropicochytriomycetes (Tropicochytrium toronegroense sp. nov.) and the order Paraspizellomycetales (also known as clade GS14: Paraspizellomyces parrentiae sp. nov.) within the class Spizellomycetes. Edaphochytriomycetes has highly divergent subclades and is placed as a sister group of Mesochytriomycetes with poor statistical support. Together with Rhizophlyctidomycetes and Spizellomycetes, Tibetochytriomycetes form a sister group of Rhizophydiomycetes. Tropicochytriomycetes and Aquieurochytriomycetes have an uncertain position within Chytridiomycota. While Aquieurochytriomycetes is common in soil, sediment, and freshwater habitats, Edaphochytriomycetes, Paraspizellomycetales, Tropicochytriomycetes, and Tibetochytriomycetes are found almost exclusively in soil. We also found several novel clades in Neocallimastigomycota, the most prominent of which we name Aquamastigomycetes (Aquamastix sanduskyensis sp. nov.), Cantoromastigomycetes (Cantoromastix holarctica sp. nov.), Dobrisimastigomycetes (Dobrisimastix vlkii sp. nov.), Palomastigomycetes (Palomastix lacustris sp. nov.), and Sedimentomastigomycetes (Sedimentomastix tueriensis sp. nov.). Unlike other soil-inhabiting classes, Palomastigomycetes, Aquamastigomycetes, Sedimentomastigomycetes, and a yet-unnamed Neocallimastigomycetes clade GS58 are found mainly in sediments. As the latter three groups are successive sisters to Neocallimastigales—known as anaerobic gut symbionts of herbivorous mammals and turtles (Pratt et al. 2023)—ancestors of this order may have acquired animal symbiosis in an already anaerobic state. Our extended analyses also reveal that the novel class Algovoracomycetes (known as clade GS13 or NC-ChyL1) is a member of Monoblepharomycota rather than Chytridiomycota (Tedersoo et al. 2017; Seto et al. 2023). The Algovoracomycetes appear to be parasites of green algae (Ding et al. 2018; Seto et al. 2023). Here, we propose recombining the species Algovorax scenedesmi (basionym Phlyctidium scenedesmi) and suggest an epitype based on available material (see below). Within Algovoracomycetes, we also describe another, more common order, namely Solivoragomycetales, based on Solivorax pantropicus sp. nov. Both Chytridiomycota and Neocallimastigomycota harbor several additional class-level clades (Fig. 1, Suppl. material 1: fig. S1).

Distinguishable from other fungi based on diagnostic nucleotide signature in SSU V9 (positions 1671–1684 in S. cerevisiae gaamctcggatcgtt; one mismatch allowed), and 5.8S (positions 119–133 in type species and 120–134 in S. cerevisiae ataggtattcctrtg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Pantelleriales, covering sequences EUK1200019 and EUK1137930 (Fig. 1).

Notes.

Recognized based on eDNA sequences only. Currently includes Pantelleria (gen. nov.).

Pantelleria Tedersoo, gen. nov.

MycoBank No: 858894

Type species.

Pantelleria saittana Tedersoo.

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signature in SSU V9 (positions 1671–1684 gaamctcggatcgtt in S. cerevisiae; one mismatch allowed), ITS2 (positions 99–113 tcatttacttttaag in type species; one mismatch allowed), and 5.8S (positions 119–133 in type species and 120–134 in S. cerevisiae ataggtattcctrtg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Pantelleriaceae, covering sequences EUK1200019 and EUK1137930 (Figs 1, 2).

Figure 2.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Pantelleria saittana within Pantelleriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Aphelidiomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Contains 6–7 potential species represented by sequences MW163794 (cropland soil in Italy), OU496195 (unspecified soil in China), EUK0348072 (cropland soil in Benin), EUK0348070 (woodland soil in Turkey), EUK1137930 (urban soil in Estonia), and EUK0516893 (park soil in Estonia).

Pantelleria saittana Tedersoo, sp. nov.

MycoBank No: 858898

Diagnosis.

Separation from other species of Pantelleria based on ITS2 (positions 131–155 tttacatctttttctaaacttaatc; one mismatch allowed) and LSU D2 (positions 722–741 aagagtgatggtgatcaagt; one mismatch allowed) as indicated in Fig. 3. Intraspecific variation up to 3.8% in ITS2 and up to 1.5% in LSU. Interspecific distance at least 10.1% in ITS2.

Paraspizellomyces Tedersoo, gen. nov.

MycoBank No: 858904

Type species.

Paraspizellomyces parrentiae Tedersoo.

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D1 (positions 228–237 in type species and 227–236 in S. cerevisiae taacgaccca; one mismatch allowed) and SSU V9 (positions 1695–1709 in S. cerevisiae aatttcggttgctgg or agtttcggccgctgg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Paraspizellomycetaceae, covering sequences EUK1187441, EUK1187447, UDB014658, and EUK1100628 (Figs 1, 4).

Figure 4.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Paraspizellomyces parrentiae within Paraspizellomycetales, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially 20–30 species represented by sequences EUK1187447 (forest soil in Puerto Rico), UDB014658 (forest soil in Madagascar), EUK1100628 (forest soil in Puerto Rico), and GQ921827 (forest soil in Australia).

Paraspizellomyces parrentiae Tedersoo, sp. nov.

MycoBank No: 858905

Diagnosis.

Separation from other species of Paraspizellomyces based on ITS2 (positions 220–239 tttatgaattartgattgta; no mismatch allowed) and LSU (positions 562–581 ccgagtgttatagcctgagg; no mismatch allowed) as indicated in Fig. 5. Intraspecific variation up to 3.7% in ITS2. Interspecific distance at least 3.7% in ITS2; i.e., there is no clear barcode gap in ITS2. In ITS1, the maximum intraspecific difference 2.4%, and the minimum interspecific distance 3.3%.

Figure 6.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Aquieurochytrium lacustre within Aquieurochytriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially 25–30 species represented by sequences EUK1102276 (lake water in Sweden), EUK0569233 (lake water in Estonia), and EUK0569237 (lake water in Benin).

Aquieurochytrium lacustre Tedersoo & Esmaeilzadeh-Salestani, sp. nov.

MycoBank No: 858913

Diagnosis.

Separation from other species of Aquieurochytrium based on the ITS2 (positions 297–316 gaaaggggatctgttttttt; one mismatch allowed) and LSU D2 (positions 470–489 in type species and 450–469 in S. cerevisiae atgtcgagtccccgatcagt; no mismatch allowed) as indicated in Fig. 7. Intraspecific variation up to 1.1% in ITS2. Interspecific distance at least 3.4% in ITS2.

Figure 8.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Edaphochytrium valuojaense within Edaphochytriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially 4–5 species represented by sequences EUK1200051 (forest soil in Estonia), EUK1630709 (forest soil in Estonia), and EUK0133658 (plantation soil in the Canary Islands).

Edaphochytrium valuojaense Tedersoo, sp. nov.

MycoBank No: 858919

Diagnosis.

Separation from other species of Edaphochytrium based on ITS2 (positions 99–118 tttctataatatttttgaca; one mismatch allowed) and LSU (positions 614–633 tgagatatttctgatttttg; one mismatch allowed) as indicated in Fig. 9. Intraspecific variation up to 2.1% in ITS2 and up to 0.6% in LSU. Interspecific distance at least 11.8% in ITS2 and 6.9% in LSU.

Figure 10.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Tibetochytrium taylorii within Tibetochytriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises a single species, Tibetochytrium taylorii (sp. nov.).

Tibetochytrium taylorii Tedersoo, sp. nov.

MycoBank No: 858925

Diagnosis.

Separation from other species of Tibetochytrium based on ITS2 (positions 85–104 ttggctatatctcgctttga; one mismatch allowed) and LSU (positions 656–675 ctgattgtcagtggagccat; no mismatch allowed) as indicated in Fig. 11. Intraspecific variation up to 3.8% in ITS2 and up to 1.0% in LSU. Interspecific distance > 20% in ITS2.

Figure 12.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Tropicochytrium toronegroense within Tropicochytriomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Chytridiomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially 20–25 species represented by sequences EUK0519487 (forest soil in the Philippines), EUK1186758 (forest soil in Guadeloupe), EUK1186753 (forest soil in Puerto Rico), and EUK0131338 (grassland soil in Colombia).

Tropicochytrium toronegroense Tedersoo, sp. nov.

MycoBank No: 858931

Diagnosis.

Separation from other species of Tropicochytrium based on ITS2 (positions 182–201 gggggcctcgtctccccttt; one mismatch allowed) and LSU D2 (positions 536–555 gaccccgccctcacgggtgg; no mismatch allowed) as indicated in Fig. 13. Intraspecific variation up to 2.1% in ITS2. Interspecific distance at least 3.1% in ITS2.

Figure 14.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Algovorax scenedesmi and Solivorax pantropicus within Algovoracomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Monoblepharomycota spp. were used as an outgroup.

Notes.

There are potentially around 6–8 species in Algovorax based on ITS sequences, with examples including taxa represented by sequences OQ702880 (algal sample in MI, USA), EUK0319806 (lake sediment in Estonia), EUK0319324 (river sediment in Italy), EUK0319845, and EUK0320075 (both lake sediment in Germany).

Algovorax scenedesmi (Fott) Tedersoo & Y. Ding, comb. nov.

MycoBank No: 858939

Basionym.

Phlyctidium scenedesmi Fott [480416].

Synonym.

Rhizophydium scenedesmi (Fott) Karling [480758].

Diagnosis.

Separation from species of Phlyctidium and Rhizophydium based on the lack of rhizoids, large sporangium (5–8 µm), and thin-walled zoospores. Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS2 (positions 79–98 tgttttgcataaaaacagga; one mismatch allowed) as indicated in Fig. 15. Intraspecific variation up to 1.7% in ITS2. Interspecific distance at least 6.7% in ITS2.

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS2 (positions 85–102 in type species gtaccgctaagtttaagc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Solivoracaceae, covering sequences UDB014650, EUK1124454, EUK1216854, EUK1216849, and OQ687309 (Figs 1, 14).

Notes.

Recognized based on eDNA sequences only. Comprises about 60 species represented by sequences EUK1124454 (forest soil in Estonia), EUK1216854 (forest soil in Czechia), EUK1216849 (wetland soil in Estonia), OQ687309 (lake water in MI, USA), EUK0484219 (forest soil in Thailand), KX514861 (rainwater in China), EUK0331291 (woodland soil in Brazil), EUK0331301 (forest soil in Czechia), and EUK0484210 (grassland soil in Estonia).

Solivorax pantropicus Tedersoo, sp. nov.

MycoBank No: 858946

Diagnosis.

Separation from other species of Solivorax based on ITS2 (positions 273–292 gtctgaccgaaatatctgaa; one mismatch allowed) and LSU D2 (positions 672–691 gcctgctatgctagcgccgc; one mismatch allowed) as indicated in Fig. 16. Intraspecific variation up to 2.4% in ITS2. Interspecific distance at least 8.2% in ITS2 and 6.2% in LSU.

Notes.

Recognized based on eDNA sequences only. Currently harbors the genus Aquamastix (gen. nov.).

Aquamastix Tedersoo & Esmaeilzadeh-Salestani, gen. nov.

MycoBank No: 858950

Type species.

Aquamastix sanduskyensis Tedersoo & Esmaeilzadeh-Salestani.

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 120–139 ttcctctttg in type species and 118–127 in S. cerevisiae; no mismatch allowed), SSU V9 (positions 1685–1699 agtaacttccccttg in S. cerevisiae; no mismatch allowed), and LSU D1 (positions 125–139 in type species and 123–137 in S. cerevisiae gtgacggtttaactg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Aquamastigaceae, covering sequences EUK1124847 and EUK0320721 (Figs 1, 17).

Figure 17.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Aquamastix sanduskyensis within Aquamastigomycetes, with ultra-rapid bootstrap values indicated. Other genus-level groups are collapsed. Neocallimastigomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises a single species, Aquamastix sanduskyensis (sp. nov.).

Aquamastix sanduskyensis Tedersoo & Esmaeilzadeh-Salestani, sp. nov.

MycoBank No: 858951

Diagnosis.

Separation from other species of Aquamastix based on ITS2 (positions 112–131 aatattaatatatttattaa; one mismatch allowed) and LSU (positions 471–490 aagacttataattaaaggac; one mismatch allowed) as indicated in Fig. 18. Intraspecific variation up to 1.2% in ITS2. Closest species differ by > 20% in ITS2 and > 10% in LSU.

Figure 19.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Cantoromastix holarctica within Cantoromastigomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Neocallimastigomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises 2–3 potential species represented by sequences EUK0136917 (forest soil in Costa Rica) and EUK0017791 (forest soil in Guadeloupe).

Cantoromastix holarctica Tedersoo, sp. nov.

MycoBank No: 858959

Diagnosis.

Separation from other species of Cantoromastix based on ITS2 (positions 33–52 actcgtaaaccattagtttt; one mismatch allowed) and LSU D2 (positions 679–698 ttactcggccatgttagtct; one mismatch allowed) as indicated in Fig. 20. Intraspecific variation up to 1.1% in ITS2. Interspecific distance > 20% in ITS2 and > 15% in LSU.

Figure 21.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Dobrisimastix vlkii within Dobrisimastigomycetes, with ultra-rapid bootstrap values indicated. Other genus-level groups are collapsed. Neocallimastigomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Harbors 10–12 potential species represented by sequences EUK1138904 (forest soil in New Zealand), EUK0534669 (forest soil in Guatemala), EUK0534670 (forest soil in Colombia), EUK0534680 (forest soil in Colombia), EUK0534676 (greenhouse soil in Estonia), EUK0534677 (forest soil in Mexico), and EUK0534667 (forest soil in Tanzania).

Dobrisimastix vlkii Tedersoo, sp. nov.

MycoBank No: 858968

Diagnosis.

Separation from other species of Dobrisimastix based on ITS2 (positions 85–104 tgcctggttgtctaactata; one mismatch allowed) and LSU D2 (positions 477–496 ttaattcttcgaccgcaagg; one mismatch allowed) as indicated in Fig. 22. Intraspecific variation up to 1.5% in ITS2. Interspecific distance at least 8.4% in ITS2.

Figure 23.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Palomastix lacustris within Palomastigomycetes, with ultra-rapid bootstrap values indicated. Other genus-level groups are collapsed. Neocallimastigomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises four potential species represented by sequences EUK0320699 (river sediment in Portugal), EUK0320700 (lake sediment in Estonia), EUK0320701 (lake sediment in Lithuania), EUK0320702 (lake sediment in Spain), and EUK0320705 (lake sediment in Norway).

Palomastix lacustris Tedersoo, sp. nov.

MycoBank No: 858973

Diagnosis.

Separation from other species of Palomastix based on ITS2 (positions 225–244 ctaaaagtcgggtttgattt; one mismatch allowed) and ITS1 (positions 464–483 cagcaggtcttgactgactt; one mismatch allowed) as indicated in Fig. 24. Intraspecific variation up to 1.4% in ITS2. Interspecific distance at least 9.2% in ITS2.

Figure 25.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Sedimentomastix tueriensis within Sedimentomastigomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Neocallimastigomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises 5–6 potential species represented by sequences EUK1191154 (rotting algae in Estonia), EUK0319721 (river sediment in Germany), EUK0319782 (lake sediment in Estonia), EUK0574066 (lake sediment in Tibet), and EUK0574067 (river sediment in Brazil).

Sedimentomastix tueriensis Tedersoo, sp. nov.

MycoBank No: 858980

Diagnosis.

Separation from other species of Sedimentomastix based on ITS2 (positions 15–34 ctaaaagtcgggtttgattt; one mismatch allowed) and LSU D2 (positions 572–591 gaaacaatggataaagggca; one mismatch allowed) as indicated in Fig. 26. Intraspecific variation up to 1.7% in ITS2. Interspecific distance > 15% in ITS2.

Type species.

Terrincola waldropii Tedersoo & Esmaeilzadeh-Salestani.

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signature in ITS2 (positions 23–32 ggccgtacgg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Terrincolaceae, covering sequences MW791967, EUK0473585, and EUK1138132 (Figs 1, 27).

Figure 27.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Terrincola waldropii within Terrincolales with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Calcarisporiellomycetes spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially four species represented by sequences EUK0473585 (shrubland soil in Uyghur Autonomous Region, China), EUK1604143 (forest soil in VT, USA), and EUK1604137 (forest soil in South Africa).

Terrincola waldropii Tedersoo & Esmaeilzadeh-Salestani, sp. nov.

MycoBank No: 859031

Diagnosis.

Separation from other species of Terrincola based on diagnostic nucleotide signatures in ITS2 (positions 359–383 atagatgggacccggtcgaggatca; one mismatch allowed) and LSU D2 (positions 569–588 agtcctctatttgtacaatg; one mismatch allowed) as indicated in Fig. 28. Intraspecific variation up to 1.2% in ITS2 and up to 0.5% in LSU sequences. Interspecific distance at least 4.9% in ITS2 and 3.9% in LSU.

Figure 29.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Curlevskia holarctica within Curlevskiomycota, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Glomeromycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises 40–60 species represented by sequences EUK1603985 (wasteland soil in Estonia), EUK1603986 (cropland soil in Estonia), EUK1603987 (grassland soil in Estonia), EUK1603988 (wasteland soil in Estonia), KJ701460, KJ701455, and KF849654 (all from plant roots in China), GU187865 (woodland soil in VIC, Australia), and EUK1103703 (forest soil in Puerto Rico).

Curlevskia holarctica Tedersoo, sp. nov.

MycoBank No: 859037

Diagnosis.

Separation from other species of Curlevskia based on ITS2 (positions 187–206 acgcttytgtgacttcctcc; two mismatches allowed) and LSU D2 (positions 493–512 caatgttcagcgcccctcgt; no mismatch allowed) as indicated in Fig. 30. Intraspecific variation up to 2.1% in ITS2 and 1.3% in LSU. Interspecific distance at least 4.4% in ITS2 and 2.8% in LSU.

Notes.

Recognized based on eDNA sequences only. Currently includes Mycosocceria (gen. nov.) and other potentially genus-level groups represented by sequences EUK1102426 (forest soil in Puerto Rico), EUK0531595 (orchard soil in Estonia), and EUK1202279 (forest soil in Italy).

Mycosocceria Tedersoo, Bahram & Esmaeilzadeh-Salestani, gen. nov.

MycoBank No: 859041

Type species.

Mycosocceria estonica Tedersoo, Bahram & Esmaeilzadeh-Salestani.

Diagnosis.

Distinguishable from other species of fungi based on diagnostic nucleotide signatures in 5.8S (positions 120–129 in type species and S. cerevisiae cccggtaggc). Forms a monophyletic, least inclusive clade in Mycosocceriaceae, covering sequences EUK1008618, EUK0531631, and EUK1124462 (Figs 1, 31).

Figure 31.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Mycosocceria estonica within Mycosocceriales, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Mortierellomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Includes M. estonica and another species represented by sequence EUK0531631 (savanna soil in Uganda).

Mycosocceria estonica Tedersoo, Bahram & Esmaeilzadeh-Salestani, sp. nov.

MycoBank No: 859042

Diagnosis.

Separation from other species of Mycosocceria based on ITS2 (positions 338–357 agaactttgttctttttaac; one mismatch allowed) and LSU D2 (positions 466–485 aatctggtcccggtggatgg; one mismatch allowed) as indicated in Fig. 32. Intraspecific variation up to 2.3% in ITS2 and 0.2% in LSU. Interspecific distance at least 10.2% in ITS2 and 10.3% in LSU.

Figure 33.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Maerjamyces jumpponenii within Maerjamycetes, with ultra-rapid bootstrap values indicated. Other genus-level groups are collapsed. Mortierellomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially three species, represented by sequences EUK0484301 (tundra soil in Svalbard) and EUK0484311 (forest soil in OR, USA).

Maerjamyces jumpponenii Tedersoo & Esmaeilzadeh-Salestani, sp. nov.

MycoBank No: 859047

Diagnosis.

Separation from other species of Maerjamyces based on ITS2 (positions 43–75 atacctgtttgagtaccatattcttttcccttt; one mismatch allowed) and LSU D1 (positions 233–252 ttgcactcgtgggttatgta; one mismatch allowed) as indicated in Fig. 34. Intraspecific variation up to 5.4% in ITS2 and up to 1.6% in LSU. Closest species differ by at least 7.4% in ITS2 and 5.0% in LSU.

Figure 35.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Ruderalia cosmopolita within Ruderaliomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Mortierellomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially three species represented by sequences EUK0531803 (cropland soil in Benin) and EUK0531800 (forest soil in Ghana).

Ruderalia cosmopolita Tedersoo, sp. nov.

MycoBank No: 859052

Diagnosis.

Separation from other species of Ruderalia based on ITS2 (positions 154–176 ggaggcttgaaattgagaaaaag; one mismatch allowed) and LSU D2 (positions 583–607 cctcgggaatgtgatccgcctttac; one mismatch allowed) as indicated in Fig. 36. Intraspecific variation up to 9.8% (including up to 7% in the type locality) in ITS2 due to multiple microsatellite-like repeats and long homopolymers and up to 1.5% in LSU. Interspecific distance > 20% in ITS2.

Bryolpidium Tedersoo, gen. nov.

MycoBank No: 859058

Type species.

Bryolpidium mundanum Tedersoo.

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V9 (positions 1706–1719 in S. cerevisiae gtcgagaagttatc; one mismatch allowed), ITS2 (positions 102–113 in type species agngaacagcgg; one mismatch allowed), and LSU D1 (positions 169–183 in type species and 167–181 in S. cerevisiae cgcggctgccgaagt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Bryolpidiaceae, covering sequences EUK1124873 and EUK1608195 (Figs 1, 37).

Figure 37.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Bryolpidium mundanum within Bryolpidiomycetes, with ultra-rapid bootstrap values indicated. Other genus-level groups are collapsed. Olpidiomycota spp. were used as an outgroup. Abbreviations for GlobalFungi accessions: d4847020b2, d4847020b222e5b7830540d220e20499; 32232805ae, 32232805aef1d4510876e11cba753f7d; and 156ae55aaf, 156ae55aafdd258247d24e567a23cdf3.

Notes.

Recognized based on eDNA sequences only. Comprises 9–10 species represented by sequences EUK1608195 (forest soil in Morocco), EUK0044951 (grassland soil in Kyrgyzstan), EUK0534697 (forest soil in Pakistan), EUK0045451 (tundra soil in Leonie Island, Antarctica), EUK0320829 (lake sediment in Germany), EUK0534698 (grassland soil in Kyrgyzstan), EUK0574099 (river sediment in Scotland), and EUK0534695 (forest soil in Turkey).

Bryolpidium mundanum Tedersoo, sp. nov.

MycoBank No: 859060

Diagnosis.

Separation from other species of Bryolpidium based on ITS2 (positions 226–245 ctgaaaacaattcgagtgat; no mismatch allowed) and LSU (positions 465–494 gacggggctctcgctcgtga; no mismatch allowed) as indicated in Fig. 38. Intraspecific variation up to 4.4% in ITS2. Interspecific distance > 20% in ITS2.

Figure 39.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Chthonolpidium enigmatum within Chthonolpidiomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Olpidiomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially four species represented by sequences EUK1124876 (mosses in Estonia), EUK0534819 (tundra soil in AK, USA), and EUK0534804 (grassland soil in Tibet).

Chthonolpidium enigmatum Tedersoo, sp. nov.

MycoBank No: 859065

Diagnosis.

Separation from other species of Chthonolpidium based on ITS2 (positions 245–264 cacttggctgaaaaggttt; one mismatch allowed) and LSU (positions 608–627 ccttctagccctacggtacg; no mismatch allowed) as indicated in Fig. 40. Intraspecific variation up to 4.8% in ITS2. Interspecific distance at least 10.3% in ITS2.

Figure 41.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Savannolpidium raadiense within Savannolpidiomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Olpidiomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises about 15–25 species represented by sequences EUK1217296 (grassland soil in Austria), EUK0034005 (forest soil in South Africa), EUK0036392 (forest soil in South Africa), EUK0034147 (woodland soil in New Caledonia), EUK0036996 (forest soil in Puerto Rico), EUK0534723 (forest soil in South Africa), EUK0534729 (forest soil in Spain), EUK0036910 (forest soil in Estonia), and EUK0534732 (forest soil in Iran).

Savannolpidium raadiense Tedersoo & Esmaeilzadeh-Salestani, sp. nov.

MycoBank No: 859071

Diagnosis.

Separation from other species of Savannolpidium based on ITS2 (positions 16–40 agatctcatcttctttagagttggc; no mismatch allowed) and LSU (positions 468–492 tataaagggaggctagtgtgagcgc; no mismatch allowed) as indicated in Fig. 42. Intraspecific variation up to 1.6% in ITS2 and 0.9% in LSU. Interspecific distance at least 2.8% in ITS2.

Gelotisporidium Tedersoo, gen. nov.

MycoBank No: 859081

Type species.

Gelotisporidium boreale Tedersoo.

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V9 (positions 1699–1718 in S. cerevisiae acccgtctttcgttg; one mismatch allowed) and 5.8S-ITS2 (positions starting from 151 in type species and 153 in S. cerevisiae agaattgaaa; one mismatch allowed). Forms a monophyletic, least inclusive clade in Gelotisporidiaceae, covering sequences EUK1201985 and EUK1101158 (Figs 1, 43).

Figure 43.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Gelotisporidium boreale within Gelotisporidiomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Rozellomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises Gelotisporidium boreale (sp. nov.).

Gelotisporidium boreale Tedersoo, sp. nov.

MycoBank No: 859083

Diagnosis.

Separation from other species of Gelotisporidiaceae based on ITS2 (positions 111–130 ggcaagcccaaccgggagta; one mismatch allowed) and LSU (positions 481–500 gagttgtgtcacatatagca; one mismatch allowed) as indicated in Fig. 44. Intraspecific variation up to 4.7% in ITS2 and up to 1.0% in LSU. Interspecific distance > 15% in ITS2 and > 10% in LSU.

Figure 45.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Sumavosporidium sylvestre within Sumavosporidiomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Rozellomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially 160–180 species represented by sequences UDB029043 (forest soil in Argentina), UDB028927 (woodland soil in Greece), UDB029030 (forest soil in Scotland), EUK1104656 (forest soil in Sweden), EUK0481687 (grassland soil in Norway), EUK1106151 (peatland soil in Sweden), UDB028954 (forest soil in Argentina), EUK0481807 (forest soil in Argentina), EUK0022003 (forest soil in OR, USA), EUK0481723 (forest soil in Magadan, Russian Federation), and EUK0481554 (forest soil in Chukotka, Russian Federation).

Sumavosporidium sylvestre Tedersoo & Esmaeilzadeh-Salestani, sp. nov.

MycoBank No: 859076

Diagnosis.

Separation from other species of Sumavosporidium based on ITS2 (positions 7–31 gaatgaagatgtgatcgaactgtgc; one mismatch allowed) and LSU (positions 465–484 caactagttggccttcaggt; one mismatch allowed) as indicated in Fig. 46. Intraspecific variation up to 2.0% in ITS2 and up to 0.2% in LSU. Interspecific distance at least 12.0% in ITS2.

Parakickxella Tedersoo, gen. nov.

MycoBank No: 859089

Type species.

Parakickxella borikenica Tedersoo.

Diagnosis.

Separation from other fungi based on diagnostic nucleotide signatures in SSU V3 (positions 677–691 in S. cerevisiae gttccgcccggtctc; one mismatch allowed) and LSU D2 (positions 697–711 in the type species and 687–701 in S. cerevisiae cgacacgtcatggtg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Parakickxellaceae, covering sequences EUK1189325, EUK1189316, and EUK1189321 (Figs 1, 47).

Figure 47.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Parakickxella borikenica within Parakickxellomycetes, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Zoopagomyceta spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises potentially about 150–170 species represented by sequences EUK1189325 (forest soil in Puerto Rico), EUK1189316 (forest soil in Dominica), EUK1189312 (forest soil in Dominica), EUK0483976 (forest soil in Guadeloupe), EUK1189319 (forest soil in Guadeloupe), EUK0530705 (forest soil in Costa Rica), EUK1189316 (forest soil in Dominica), and EUK1189306 (forest soil in Puerto Rico).

Parakickxella borikenica Tedersoo, sp. nov.

MycoBank No: 859090

Diagnosis.

Separation from other species of Parakickxella based on ITS2 (positions 98–117 cgtgaacatatggtgccccc; one mismatch allowed) and LSU D2 (positions 444–463 in the type species and 436–455 in S. cerevisiae cgccgcgctgtttgtgcgcg; one mismatch allowed) as indicated in Fig. 48. Intraspecific difference up to 1.4% in ITS2 and up to 0.5% in LSU. Interspecific distance at least 15.0% in ITS2.

Figure 49.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Aldinomyces tarquinii within Aldinomycota, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Members of various fungal phyla were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises about four potential species represented by sequences EUK0483667 (forest soil in Argentina), EUK0138900 (forest soil in Norway), and EUK0529911 (woodland soil in Estonia).

Aldinomyces tarquinii Tedersoo, sp. nov.

MycoBank No: 859096

Diagnosis.

Separation from other species of Aldinomyces based on ITS2 (positions 225–244 taaagaagatttcttcttta; two mismatches allowed) and LSU D2 (positions 709–728 gcggctggacagctgtgcaa; one mismatch allowed) as indicated in Fig. 50. Intraspecific variation up to 1.1% in ITS2 and up to 0.4% in LSU. Interspecific distance at least 3.9% in ITS2.

Figure 51.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Borikenia urbinae within Borikeniomycota, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Members of various fungal phyla were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises four potential species represented by sequences EUK0530090 (forest soil in India), EUK0530094 (forest soil in Colombia), and EUK0530095 (forest soil in Costa Rica).

Borikenia urbinana Tedersoo, sp. nov.

MycoBank No: 859102

Diagnosis.

Separation from other species of Borikenia based on ITS2 (positions 56–75 acgttgtgtacacacacgtg; one mismatch allowed) and LSU (positions 170–189 ctgatcttggttgttgggta; one mismatch allowed) as indicated in Fig. 52. Intraspecific variation up to 2.3% in ITS2 and up to 0.4% in LSU. Interspecific distance at least 6.1% in ITS2.

Figure 53.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Mirabilomyces abrukanus within Mirabilomycota, with ultra-rapid bootstrap values indicated (for higher-level classifications mainly). Other genus-level groups are collapsed. Kickxellomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises 170–200 potential species represented by sequences EUK1201728 (forest soil in Estonia), EUK1124366 (grassland soil in Estonia), EUK1101799 (forest soil in Puerto Rico), EUK1101831 (forest soil in Puerto Rico), EUK1101652 (forest soil in Puerto Rico), EUK1101776 (forest soil in Puerto Rico), and OU943050 (grassland soil in Sweden).

Mirabilomyces abrukanus Tedersoo & R.H. Nilsson, sp. nov.

MycoBank No: 859108

Diagnosis.

Separation from other species of Mirabilomyces based on ITS2 (positions 68–87 cttcggttwtaaaacaaggt; two mismatches allowed) and LSU (positions 534–553 ctacgctgtggttgcgcttt; one mismatch allowed) as indicated in Fig. 54. Intraspecific variation up to 11.4% in ITS2 due to length polymorphism in multiple mono- and dinucleotide repeats and up to 1.0% in LSU. Interspecific distance > 20% in ITS2 and at least 6.0% in LSU.

Figure 55.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Nematovomyces vermicola and N. soinasteënsis within Nematovomycota, with ultra-rapid bootstrap values indicated. Other genus-level groups are collapsed. Entomophthoromycota spp. were used as an outgroup.

Description.

Sporangia in the host cell singly or in rows, spherical or pyriform, 15–35 µm diam., with a smooth wall and curved exit tube. Zoospores spherical, 2.5–3.5 µm diam, with one posterior flagellum. Flagellum arched near the insertion point to the zoospore body. Thallus produces a single evacuation tube that leaves a narrow exit tube. Resting spores spherical or oblong, with surface ornamented by delicate reticular pattern or linear or branched spines, arranged in chains outside the animal cuticle or in culture. Infects nematodes, rotifers, and their eggs internally.

Notes.

Includes species parasitizing on nematodes, rotifers, and their eggs. Comprises about 50 potential species represented by sequences OQ702947 (peatland rotifer in MI, USA), GQ330624 (peatland water in Switzerland), OQ702883 (rotifer egg in lake water in ONT, Canada), JN054659 (activated sludge in NSW, Australia), JN054675 (activated sludge in Canada), EUK1100016 (permafrost in Canada), EUK1107129 (lake water in Sweden), EUK1102228 (forest soil in Puerto Rico), EUK1204135 (lake sediment in Lithuania), EUK1124398 (forest soil in Estonia), EUK1124395 (grassland soil in Estonia), and EUK1200775 (forest soil in Italy).

Nematovomyces vermicola (G.L. Barron & Szuarto) Tedersoo & Esmaeilzadeh-Salestani, comb. nov.

MycoBank No: 859114

Basionym.

Olpidium vermicola G.L. Barron & Szuarto, Mycologia 78 (6): 972 (1986) [128304].

Diagnosis.

Separated from other species of Nematovomyces by echinulate resting spores and parasitism exclusively on nematode eggs.

Type.

Microscope slide OAC 10841 (holotype), rotting wood at Lake Manitowabing, Ontario, Canada, 45.5, –79.9; eDNA sequence OQ702805 (legitype) from the type locality.

Description.

As in Barron and Szuarto (1986).

Etymology.

Nematoda and ovum (Latin) refer to roundworms and their eggs, respectively, and describe the specific association with nematode eggs, indicating parasitic relationship with these structures.

Notes.

There are no ITS sequences or other eDNA sequences matching N. vermicola.

Nematovomyces soinasteënsis Tedersoo, sp. nov.

MycoBank No: Mycobank No: 859115

Diagnosis.

Separation from other species of Nematovomyces based on ITS2 (positions 491–510 aaaaccctttttcccccaca; one mismatch allowed) and LSU (positions 601–620 tgttcttggtactgagttta; one mismatch allowed) as indicated in Fig. 56. Intraspecific variation up to 2.8% in ITS2 and up to 0.3% in LSU. Interspecific distance at least 8.0% in ITS2.

Figure 57.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Viljandia globalis within Viljandiomycota, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Kickxellomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Currently comprises Viljandia globalis (sp. nov.).

Viljandia globalis Tedersoo, sp. nov.

MycoBank No: 859121

Diagnosis.

Separation from other species of Viljandia based on ITS2 (positions 73–92 ggattgcatggactgccgtc; one mismatch allowed) and LSU (positions 594–613 gcaaagctaccgtgtccaga; one mismatch allowed) as indicated in Fig. 58. Intraspecific variation up to 7.5% in ITS2 and up to 2.2% in LSU. Interspecific distance > 20% in ITS2.

Figure 59.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Waitukubulimyces cliftonii within Waitukubulimycota, with ultra-rapid bootstrap values indicated (for higher-level classifications only). Other genus-level groups are collapsed. Aldinomycota spp. were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises five potential species represented by sequences EUK1120710 (botanical garden soil in Estonia), EUK1173015 (forest soil in China), and EUK1186290 and EUK1186292 (both forest soil in Puerto Rico).

Waitukubulimyces cliftonii Tedersoo, sp. nov.

MycoBank No: 859127

Diagnosis.

Separation from other species of Waitukubulimyces based on ITS1 (positions 59–78 actgtgaaattgctctggta; one mismatch allowed) and LSU (positions 470–489 tttttgtttgatgagtagag; one mismatch allowed) as indicated in Fig. 60. Intraspecific variation up to 5.3% in ITS1. Interspecific distance > 20% in ITS1.

Figure 61.

Maximum Likelihood SSU-ITS-LSU phylogram indicating the position of Tartumyces setoi within Tartumycota, with ultra-rapid bootstrap values indicated. Other genus-level groups are collapsed. Members of various fungal phyla were used as an outgroup.

Notes.

Recognized based on eDNA sequences only. Comprises around 10 potential species.

Tartumyces setoi Tedersoo, sp. nov.

MycoBank No: 859136

Diagnosis.

Separation from other species of Tartumyces based on ITS2 (positions 310–329 ggggggtataaaaactcgtt; one mismatch allowed) and LSU D2 (positions 518–539 tattcgccggataatggtac; no mismatch allowed) as indicated in Fig. 62. Intraspecific variation up to 2.8% in ITS2. Interspecific distance at least 4.5% in ITS2.

Figure 62.

Diagnostic nucleotide sequences of Tartumyces setoi relative to the closest related species in ITS2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).

Type.

Vouchered soil sample TUE002210 (holotype); eDNA sequence EUK1123648 = OZ253817 (legitype); eDNA sample TUE102210 (nucleotype); GSMc plot G5233, wasteland in Tartu, Estonia, 58.3972°N, 26.7693°E.

Description.

Other sequences: EUK1703744 (GSMc plot G4372, mixed forest soil in Kiisli, Estonia, 58.6955°N, 26.9128°E); EUK1703739 (GSMc plot G3569, Quercus robur park soil in Äksi, Estonia, 58.5290°N, 26.6385°E); and EUK1703737 (GSMc plot G3413, Salix caprea forest soil in Väägvere, Estonia, 58.4389°N, 26.8976°E).

Etymology.

>Tartu (Estonian) refers to the city and county in Estonia, where the type material and most other specimens were collected. The epithet refers to Kensuke Seto, the first to obtain coarse single-cell photographs of species belonging to this phylum (Seto et al. 2023).

Notes.

Found in soil in Estonia (n = 4 records). An additional record in GlobalFungi also indicates occurrence in Estonian plantation soil.

Conclusion

By integrating long-read sequences, DNA-based taxonomy, and phylogenetics, we formally describe species and corresponding higher taxa of the most common previously unrecognized fungal lineages. These potentially unculturable groups add roughly one-third to the known large-scale phylogenetic diversity of fungi, yet contribute to < 5% of the described and expected fungal species richness. Our analysis sheds light on the strong contribution of taxonomic dark matter to the fungal tree of life and provides a simple means for its detection and communication. Ultimately, our findings highlight the necessity for a transformative approach in fungal taxonomy that integrates rapidly advancing molecular data to capture the vast extent of fungal diversity more accurately and reproducibly. We also advocate a broader use of fluorescence-activated single-cell capture and sequencing of fungi for concomitant analysis of taxonomically and functionally important genes to understand their basic lifestyle features and obtain hints for their cultivation and visualization.

Acknowledgements

We thank T.Y. James and K. Seto for comments on the manuscript, J. Lees for assistance with sequence submission, and J. Lees and K. Bensch for registering the names

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Use of AI

No use of AI was reported.

Funding

This work was supported by the European Research Council (ERC-AdG-101200758), Estonian Science Foundation (MOBERC116) and King Saud University Highly Cited programme (DSFP-2023-2025).

Author contributions

L.T., K.A., U.K., S.H.A. and R.H.N. developed the concept; M.S.H.M., K.P., V.P., J.P., C.W. and Y.D. provided data; S.A., V.M. and M.B. performed bioinformatic analyses; L.T., K.E.-S., M.B., Y.D. and R.H.N. described taxa; and L.T. and S.H.A. secured funding.

Author ORCIDs

Victoria Prins https://orcid.org/0009-0003-8968-6773

Vladimir Mikryukov https://orcid.org/0000-0003-2786-2690

Mohammad Bahram https://orcid.org/0000-0002-9539-3307

Kessy Abarenkov https://orcid.org/0000-0001-5526-4845

Keyvan Esmaeilzadeh-Salestani https://orcid.org/0000-0002-6882-7616

Julia Pawłowska https://orcid.org/0000-0003-4914-5182

Christian Wurzbacher https://orcid.org/0000-0001-7418-0831

Saad Hussin Alkahtani https://orcid.org/0000-0001-7381-5110

R. Henrik Nilsson https://orcid.org/0000-0002-8052-0107

Data availability

All materials and data are publicly available as follows: material and eDNA samples in the TUE repository; DNA sequences in Suppl. material 3, EUKARYOME and UNITE databases, with legitypes in the European Nucleotide Archive (accessions OZ253786-OZ253832); multiple sequence alignments in the EUKARYOME homepage.

References

Abarenkov K, Nilsson RH, Larsson KH, Taylor AF, May TW, Frøslev TG, Pawlowska J, Lindahl B, Põldmaa K, Truong C, Vu D, Hosoya T, Niskanen T, Piirmann T, Ivanov F, Zirk A, Peterson M, Cheeke TE, Ishigami Y, Jansson AT, Jeppesen TS, Kristiansson E, Mikryukov V, Miller JT, Oono R, Ossandon FJ, Paupério J, Saar I, Schigel D, Suija A, Tedersoo L, Kõljalg U (2024) The UNITE database for molecular identification and taxonomic communication of fungi and other eukaryotes: Sequences, taxa and classifications reconsidered. Nucleic Acids Research 52(D1): D791–D797. https://doi.org/10.1093/nar/gkad1039

Ahrendt SR, Quandt CA, Ciobanu D, Clum A, Salamov A, Andreopoulos B, Cheng JF, Woyke T, Pelin A, Henrissat B, Reynolds NK, Benny GL, Smith ME, James TY, Grigoriev IV (2018) Leveraging single-cell genomics to expand the fungal tree of life. Nature Microbiology 3(12): 1417–1428. https://doi.org/10.1038/s41564-018-0261-0

Aime MC, Miller AN, Aoki T, Bensch K, Cai L, Crous PW, Hawksworth DL, Hyde KD, Kirk PM, Lücking R, May TW, Malosso E, Redhead SA, Rossman AY, Stadler M, Thines M, Yurkov AM, Zhang N, Schoch CL (2021) How to publish a new fungal species, or name, version 3.0. IMA Fungus 12(1): 1–5. https://doi.org/10.1186/s43008-021-00063-1

Anderson CR, Peterson ME, Frampton RA, Bulman SR, Keenan S, Curtin D (2018) Rapid increases in soil pH solubilise organic matter, dramatically increase denitrification potential and strongly stimulate microorganisms from the Firmicutes phylum. PeerJ 6: e6090. https://doi.org/10.7717/peerj.6090

Anthony MA, Bender SF, van der Heijden MG (2023) Enumerating soil biodiversity. Proceedings of the National Academy of Sciences of the United States of America 120(33): e2304663120. https://doi.org/10.1073/pnas.2304663120

Arroyo AS, López-Escardó D, Kim E, Ruiz-Trillo I, Najle SR (2018) Novel diversity of deeply branching Holomycota and unicellular holozoans revealed by metabarcoding in Middle Paraná River, Argentina. Frontiers in Ecology and Evolution 6: 99. https://doi.org/10.3389/fevo.2018.00099

Barron GL, Szuarto E (1986) A new species of Olpidium parasitic in nematode eggs. Mycologia 78(6): 972–975. https://doi.org/10.1080/00275514.1986.12025361

Bueno de Mesquita CP, Sartwell SA, Schmidt SK, Suding KN (2020) Growing‐season length and soil microbes influence the performance of a generalist bunchgrass beyond its current range. Ecology 101: e03095. https://doi.org/10.1002/ecy.3095

Curlevski NJ, Drigo B, Cairney JW, Anderson IC (2014) Influence of elevated atmospheric CO₂ and water availability on soil fungal communities under Eucalyptus saligna. Soil Biology & Biochemistry 70: 263–271. https://doi.org/10.1016/j.soilbio.2013.12.010

Ding Y, Peng X, Wang Z, Wen X, Geng Y, Zhang D, Li Y (2018) Occurrence and characterization of an epibiotic parasite in cultures of oleaginous microalga Graesiella sp. WBG-1. Journal of Applied Phycology 30(2): 819–830. https://doi.org/10.1007/s10811-017-1302-4

Doweld AB (2013) Nomenclatural novelties. Index Fungorum 42: 1–2.

Doweld AB (2014) Nomenclatural novelties. Index Fungorum 46: 1.

Eshghi Sahraei S, Furneaux B, Kluting K, Zakieh M, Rydin H, Hytteborn H, Rosling A (2022) Effects of operational taxonomic unit inference methods on soil microeukaryote community analysis using long‐read metabarcoding. Ecology and Evolution 12(3): e8676. https://doi.org/10.1002/ece3.8676

Fott B (1967) Phlyctidium scenedesmi spec. nova, a new chytrid destroying mass cultures of algae. Zeitschrift für Allgemeine Mikrobiologie 7(2): 97–102. https://doi.org/10.1002/jobm.19670070203

Galindo LJ, López-García P, Torruella G, Karpov S, Moreira D (2021) Phylogenomics of a new fungal phylum reveals multiple waves of reductive evolution across Holomycota. Nature Communications 12(1): 4973. https://doi.org/10.1038/s41467-021-25308-w

Glockling SL (1998) Isolation of a new species of rotifer-attacking Olpidium. Mycological Research 102(2): 206–208. https://doi.org/10.1017/S0953756297004693

Hedlund BP, Chuvochina M, Hugenholtz P, Konstantinidis KT, Murray AE, Palmer M, Parks DH, Probst AJ, Reysenbach A-L, Rodriguez LM, Rossello-Mora R, Sutcliffe IC, Venter SN, Whitman WB (2022) SeqCode: a nomenclatural code for prokaryotes described from sequence data. Nature Microbiology 7: 1702–1708. https://doi.org/10.1038/s41564-022-01214-9

Hibbett DS, Binder M, Bischoff J (2007) A higher-level phylogenetic classification of the Fungi. Mycological Research 111: 509–547. https://doi.org/10.1016/j.mycres.2007.03.004

Hyde KD, Noorabadi MT, Thiyagaraja V, He MQ, Johnston PR, Wijesinghe SN, Armand A, Biketova AY, Moncada B, Radek R (2024) The 2024 Outline of Fungi and fungus-like taxa. Mycosphere : Journal of Fungal Biology 15(1): 5146–6239. https://doi.org/10.5943/mycosphere/15/1/25

International Commission on Zoological Nomenclature (1999) International Code of Zoological Nomenclature. Fourth edition. The International Trust for Zoological Nomenclature, London.

James TY, Stajich JE, Hittinger CT, Rokas A (2020) Toward a Fully Resolved Fungal Tree of Life. Annual Review of Microbiology 74(1): 291–313. https://doi.org/10.1146/annurev-micro-022020-051835

Jamy M, Biwer C, Vaulot D, Obiol A, Jing H, Peura S, Massana R, Burki F (2022) Global patterns and rates of habitat transitions across the eukaryotic tree of life. Nature Ecology & Evolution 6(10): 1458–1470. https://doi.org/10.1038/s41559-022-01838-4

Jumpponen A, Jones KL, Mattox JD, Yaege C (2010) Massively parallel 454-sequencing of fungal communities in Quercus spp. ectomycorrhizas indicates seasonal dynamics in urban and rural sites. Molecular Ecology 19(s1): S41–S53. https://doi.org/10.1111/j.1365-294X.2009.04483.x

Karpov SA, Mamkaeva MA, Aleoshin VV, Nassonova E, Lilje O, Gleason FH (2014) Morphology, phylogeny, and ecology of the aphelids (Aphelidea, Opisthokonta) and proposal for the new superphylum Opisthosporidia. Frontiers in Microbiology 5: 112. https://doi.org/10.3389/fmicb.2014.00112

Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010

Kirk PM, Griffith GW (2021) Nomenclatural novelties: Piromyces cryptodigmaticus Fliegerova, K. Voigt & P.M. Kirk, sp. nov. Index Fungorum : Published Numbers 467: 1.

Kõljalg U, Nilsson HR, Schigel D, Tedersoo L, Larsson KH, May TW, Taylor AF, Jeppesen TS, Frøslev TG, Lindahl BD, Põldmaa K, Abarenkov K (2020) The Taxon Hypothesis paradigm—On the unambiguous detection and communication of taxa. Microorganisms 8(12): 1910. https://doi.org/10.3390/microorganisms8121910

Labeda DP, Hatano K, Kroppenstedt RM, Tamura T (2001) Revival of the genus Lentzea and proposal for Lechevalieria gen. nov. International Journal of Systematic and Evolutionary Microbiology 51(3): 1045–1050. https://doi.org/10.1099/00207713-51-3-1045

Larsson A (2014) AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics (Oxford, England) 30(22): 3276–3278. https://doi.org/10.1093/bioinformatics/btu531

Lay CY, Hamel C, St-Arnaud M (2018) Taxonomy and pathogenicity of Olpidium brassicae and its allied species. Fungal Biology 122(9): 837–846. https://doi.org/10.1016/j.funbio.2018.04.012

Lücking R, Aime MC, Robbertse B, Miller AN, Aoki T, Ariyawansa HA, Cardinali G, Crous PW, Druzhinina IS, Geiser DM, Hawksworth DL, Hyde KD, Irinyi L, Jeewon R, Johnston PR, Kirk PM, Malosso E, May TW, Meyer W, Nilsson HR, Öpik M, Robert V, Stadler M, Thines M, Vu D, Yurkov AM, Zhang N, Schoch CL (2021) Fungal taxonomy and sequence-based nomenclature. Nature Microbiology 6(5): 540–548. https://doi.org/10.1038/s41564-021-00888-x

Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Von Haeseler A, Lanfear R (2020) IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37(5): 1530–1534. https://doi.org/10.1093/molbev/msaa015

Moore RT (1980) Taxonomic proposals for the classification of marine yeasts and other yeast-like fungi including the smuts. Botanica Marina 23(6): 361–374. https://doi.org/10.1515/bot-1980-230605

Nilsson RH, Anslan S, Bahram M, Wurzbacher C, Baldrian P, Tedersoo L (2019) Mycobiome diversity: High-throughput sequencing and identification of fungi. Nature Reviews. Microbiology 17(2): 95–109. https://doi.org/10.1038/s41579-018-0116-y

Nilsson RH, Ryberg M, Wurzbacher C, Tedersoo L, Anslan S, Põlme S, Spirin V, Mikryukov V, Svantesson S, Hartmann M, Lennartsdotter C, Belford P, Khomich M, Retter A, Corcoll N, Gómez Martinez D, Jansson T, Ghobad-Nejhad M, Vu D, Sanchez-Garcia M, Kristiansson E, Abarenkov K (2023) How, not if, is the question mycologists should be asking about DNA-based typification. MycoKeys 96: 143–157. https://doi.org/10.3897/mycokeys.96.102669

Niskanen T, Lücking R, Dahlberg A, Gaya E, Suz LM, Mikryukov V, Liimatainen K, Druzhinina I, Westrip JR, Mueller GM, Martins-Cunha K, Tedersoo L, Antonelli A (2023) Pushing the frontiers of biodiversity research: Unveiling the global diversity, distribution, and conservation of fungi. Annual Review of Environment and Resources 48(1): 149–176. https://doi.org/10.1146/annurev-environ-112621-090937

Parrent JL, Vilgalys R (2007) Biomass and compositional responses of ectomycorrhizal fungal hyphae to elevated CO2 and nitrogen fertilization. The New Phytologist 176(1): 164–174. https://doi.org/10.1111/j.1469-8137.2007.02155.x

Pratt CJ, Chandler EE, Youssef NH, Elshahed MS (2023) Testudinimyces gracilis gen. nov, sp. nov. and Astrotestudinimyces divisus gen. nov, sp. nov., two novel, deep-branching anaerobic gut fungal genera from tortoise faeces. International Journal of Systematic and Evolutionary Microbiology 73(5): 005921. https://doi.org/10.1099/ijsem.0.005921

Quandt CA, Marino JA, Simmons DR, Davis WJ, Hassett BT, Picard KT, James TY (2023) Evaluating the diversity of the enigmatic fungal phylum Cryptomycota across habitats using 18S rRNA metabarcoding. Fungal Ecology 64: 101248. https://doi.org/10.1016/j.funeco.2023.101248

Rambaut A (2018) FigTree v1.4.4. https://github.com/rambaut/figtree/releases

Ryberg M, Nilsson RH (2018) New light on names and naming of dark taxa. MycoKeys 30: 31–39. https://doi.org/10.3897/mycokeys.30.24376

Schaffner JH (1909) The classification of plants, IV. Ohio Naturalist. 9: 446–455.

Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, Bolchacova E, Voigt K, Crous PW, Miller AN, Wingfield MJ, Aime MC, An K-D, Bai F-Y, Barreto RW, Begerow D, Bergeron M-J, Blackwell M, Boekhout T, Bogale M, Boonyuen N, Burgaz AR, Buyck B, Cai L, Cai Q, Cardinali G, Chaverri P, Coppins BJ, Crespo A, Cubas P, Cummings C, Damm U, de Beer ZW, de Hoog GS, Del-Prado R, Dentinger B, Diéguez-Uribeondo J, Divakar PK, Douglas B, Dueñas M, Duong TA, Eberhardt U, Edwards JE, Elshahed MS, Fliegerova K, Furtado M, García MA, Ge Z-W, Griffith GW, Griffiths K, Groenewald JZ, Groenewald M, Grube M, Gryzenhout M, Guo L-D, Hagen F, Hambleton S, Hamelin RC, Hansen K, Harrold P, Heller G, Herrera C, Hirayama K, Hirooka Y, Ho H-M, Hoffmann K, Hofstetter V, Högnabba F, Hollingsworth PM, Hong S-B, Hosaka K, Houbraken J, Hughes K, Huhtinen S, Hyde KD, James T, Johnson EM, Johnson JE, Johnston PR, Jones EBG, Kelly LJ, Kirk PM, Knapp DG, Kõljalg U, Kovács GM, Kurtzman CP, Landvik S, Leavitt SD, Liggenstoffer AS, Liimatainen K, Lombard L, Luangsa-ard JJ, Lumbsch HT, Maganti H, Maharachchikumbura SSN, Martin MP, May TW, McTaggart AR, Methven AS, Meyer W, Moncalvo J-M, Mongkolsamrit S, Nagy LG, Nilsson RH, Niskanen T, Nyilasi I, Okada G, Okane I, Olariaga I, Otte J, Papp T, Park D, Petkovits T, Pino-Bodas R, Quaedvlieg W, Raja HA, Redecker D, Rintoul TL, Ruibal C, Sarmiento-Ramírez JM, Schmitt I, Schüßler A, Shearer C, Sotome K, Stefani FOP, Stenroos S, Stielow B, Stockinger H, Suetrong S, Suh S-O, Sung G-H, Suzuki M, Tanaka K, Tedersoo L, Telleria MT, Tretter E, Untereiner WA, Urbina H, Vágvölgyi C, Vialle A, Vu TD, Walther G, Wang Q-M, Wang Y, Weir BS, Weiß M, White MM, Xu J, Yahr R, Yang ZL, Yurkov A, Zamora J-C, Zhang N, Zhuang W-Y, Schindel D (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the United States of America 109(16): 6241–6246. https://doi.org/10.1073/pnas.1117018109

Seto K, Simmons DR, Quandt CA, Frenken T, Dirks AC, Clemons RA, McKindles KM, McKay RM, James TY (2023) A combined microscopy and single-cell sequencing approach reveals the ecology, morphology, and phylogeny of uncultured lineages of zoosporic fungi. mBio 14: e01313–e01323. https://doi.org/10.1128/mbio.01313-23

Smith NEC (2024) Call me by your name: Considerations of DNA sequences as types within wider discussions on fungal nomenclature. Mycology 15(2): 137–143. https://doi.org/10.1080/21501203.2023.2295412

Steenwyk JL, Buida TJ III, Li Y, Shen XX, Rokas A (2020) ClipKIT: A multiple sequence alignment trimming software for accurate phylogenomic inference. PLoS Biology 18(12): e3001007. https://doi.org/10.1371/journal.pbio.3001007

Taylor DL, Herriott IC, Long J, O’ Neill K (2007) TOPO TA is A-OK: A test of phylogenetic bias in fungal environmental clone library construction. Environmental Microbiology 9(5): 1329–1334. https://doi.org/10.1111/j.1462-2920.2007.01253.x

Tedersoo L, Bahram M, Puusepp R, Nilsson RH, James TY (2017) Novel soil-inhabiting clades fill gaps in the fungal tree of life. Microbiome 5(1): 42. https://doi.org/10.1186/s40168-017-0259-5

Tedersoo L, Sánchez-Ramírez S, Kõljalg U, Bahram M, Döring M, Schigel D, May T, Ryberg M, Abarenkov K (2018) High-level classification of the Fungi and a tool for evolutionary ecological analyses. Fungal Diversity 90(1): 135–159. https://doi.org/10.1007/s13225-018-0401-0

Tedersoo L, Mikryukov V, Anslan S, Bahram M, Khalid AN, Corrales A, Agan A, Vasco-Palacios AM, Saitta A, Antonelli A, Rinaldi AC, Verbeken A, Sulistyo BP, Tamgnoue B, Furneaux B, Ritter CD, Nyamukondiwa C, Sharp C, Marín C, Dai DQ, Gohar D, Sharmah D, Biersma EM, Cameron EK, De Crop E, Otsing E, Davydov EA, Albornoz FE, Brearley FQ, Buegger F, Gates G, Zahn G, Bonito G, Hiiesalu I, Hiiesalu I, Zettur I, Barrio IC, Pärn J, Heilmann-Clausen J, Ankuda J, Kupagme JY, Sarapuu J, Maciá-Vicente JG, Fovo JD, Geml J, Alatalo JM, Alvarez-Manjarrez J, Monkai J, Põldmaa K, Runnel K, Adamson K, Bråthen KA, Pritsch K, Tchan KI, Armolaitis K, Hyde KD, Newsham KK, Panksep K, Adebola LA, Lamit LJ, Saba M, da Silva Cáceres ME, Tuomi M, Gryzenhout M, Bauters M, Bálint M, Wijayawardene N, Hagh-Doust N, Yorou NS, Kurina O, Mortimer PE, Meidl P, Nilsson RH, Puusepp R, Casique-Valdés R, Drenkhan R, Garibay-Orijel R, Godoy R, Alfarraj S, Rahimlou S, Põlme S, Dudov SV, Mundra S, Ahmed T, Netherway T, Henkel TW, Roslin T, Fedosov VE, Onipchenko VG, Yasanthika WAE, Lim YW, Piepenbring M, Klavina D, Kõljalg U, Abarenkov K (2021) The Global Soil Mycobiome consortium dataset for boosting fungal diversity research. Fungal Diversity 111(1): 573–588. https://doi.org/10.1007/s13225-021-00493-7

Tedersoo L, Hosseyni Moghaddam MS, Mikryukov V, Hakimzadeh A, Bahram M, Nilsson RH, Yatsiuk I, Geisen S, Schwelm A, Piwosz K, Prous M, Chmolowska D, Rueckert S, Skaloud P, Laas P, Thines M, Jung J-H, Alkahtani S, Anslan S (2024) EUKARYOME: The rRNA gene reference database for identification of all eukaryotes. Database : The Journal of Biological Databases and Curation 2024: baae043. https://doi.org/10.1093/database/baae043

Tedersoo L, Geisen S, Chang Y, Nilsson RH (2025) (in press) Towards DNA-based taxonomy of prokaryotes and microeukaryotes. Trends in Genetics. https://doi.org/10.1016/j.tig.2025.07.009

Turland NJ, Wiersema JH, Barrie FR, Gandhi KN, Gravendyck J, Greuter W, Hawksworth DL (2025) International Code of Nomenclature for algae, fungi, and plants (Madrid Code). University of Chicago Press, Chicago.

Vetrovsky T, Morais D, Kohout P, Lepinay C, Algora C, Awokunle Hollá S, Baldrian P (2020) GlobalFungi, a global database of fungal occurrences from high-throughput-sequencing metabarcoding studies. Scientific Data 7(1): 228. https://doi.org/10.1038/s41597-020-0567-7

Voigt K, James TY, Kirk PM, Santiago AL, Waldman B, Griffith GW, Fu M, Radek R, Strassert JF, Wurzbacher C, Jerônimo GH, Simmons DR, Seto K, Gentekaki E, Hurdeal VG, Hyde KD, Nguyen TTT, Lee HB (2021) Early-diverging fungal phyla: Taxonomy, species concept, ecology, distribution, anthropogenic impact, and novel phylogenetic proposals. Fungal Diversity 109(1): 59–98. https://doi.org/10.1007/s13225-021-00480-y

Waldrop MP, Zak DR, Blackwood CB, Curtis CD, Tilman D (2006) Resource availability controls fungal diversity across a plant diversity gradient. Ecology Letters 9(10): 1127–1135. https://doi.org/10.1111/j.1461-0248.2006.00965.x

Supplementary materials

Supplementary material 1

Maximum Likelihood SSU-5.8S-LSU phylogram

Leho Tedersoo, Mahdieh S. Hosseyni Moghadam, Kristel Panksep, Victoria Prins, Sten Anslan, Vladimir Mikryukov, Mohammad Bahram, Kessy Abarenkov, Urmas Kõljalg, Keyvan Esmaeilzadeh-Salestani, Julia Pawłowska, Christian Wurzbacher, Yi Ding, Saad Hussin Alkahtani, R. Henrik Nilsson

Data type: pdf

Explanation note: Maximum Likelihood SSU-5.8S-LSU phylogram showing phylogenetic placement of previously unrecognized fungal lineages among fungi, with ultra-rapid bootstrap values indicated. Low support values < 95/<99% and support values within genera are not indicated. Species of Holozoa and Nucleariae were used as an outgroup.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (1.41 MB)

Supplementary material 2

Updated taxonomy of fungi, including newly described taxa and provisional higher-ranking taxa based on phylogenetic analyses

Data type: xlsx

Download file (439.90 kb)

Supplementary material 3

DNA sequences and their metadata used for phylogenetic analyses, taxon descriptions and delimitation

Data type: xlsx

Download file (5.42 MB)

﻿Abstract

Key words:

﻿Introduction

﻿Materials and methods

﻿Results and discussion

﻿Novel fungal lineages

﻿Overview of novel taxa

﻿Descriptions of new species and higher-ranking taxa

Fungi R.T. Moore Botanica Marina 23(6): 371 (1980)

Type phylum.

Description.

Notes.

Aphelidiomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T.W. May, M. Ryberg & Abarenkov, Fungal Diversity 90: 147 (2018)

Type class.

Description.

Notes.

Aphelidiomycota Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T.W. May, M. Ryberg & Abarenkov, Fungal Diversity 90: 147 (2018)

Type class.

Description.

Notes.

Pantelleriomycetes Tedersoo, class. nov.

Type order.

Diagnosis.

Notes.

Pantelleriales Tedersoo, ord. nov.

Type family.

Diagnosis.

Notes.

Pantelleriaceae Tedersoo, fam. nov.

Type genus.

Diagnosis.

Notes.

Pantelleria Tedersoo, gen. nov.

Type species.

Diagnosis.

Notes.

Pantelleria saittana Tedersoo, sp. nov.

Diagnosis.

Type.

Description.

Etymology.

Notes.

Chytridiomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T.W. May, M. Ryberg & Abarenkov, Fungal Diversity 90: 148 (2018)

Type class.

Description.

Notes.

Chytridiomycota Doweld, Prosyllabus Tracheophytorum, Tentamen systematis plantarum vascularium (Tracheophyta): LXXVII (2001)

Type class.

Description.

Notes.

Spizellomycetes Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T.W. May, M. Ryberg & Abarenkov, Fungal Diversity 90: 149 (2018)

Type order.

Description.

Notes.

Paraspizellomycetales Tedersoo, ord. nov.

Type family.

Diagnosis.

Notes.

Paraspizellomycetaceae Tedersoo, fam. nov.

Type genus.

Diagnosis.

Notes.

Paraspizellomyces Tedersoo, gen. nov.

Type species.

Diagnosis.

Notes.

Paraspizellomyces parrentiae Tedersoo, sp. nov.

Diagnosis.

Type.

Description.

Etymology.

Notes.

Aquieurochytriomycetes Tedersoo & Esmaeilzadeh-Salestani, class. nov.

Type order.

Diagnosis.

Notes.

Aquieurochytriales Tedersoo & Esmaeilzadeh-Salestani, ord. nov.

Type family.

Diagnosis.

Notes.

Abstract

Introduction

Materials and methods

Results and discussion

Novel fungal lineages

Overview of novel taxa

Descriptions of new species and higher-ranking taxa