Research Article
Print
Research Article
Papiliomyces sinensis (Clavicipitaceae) and Paraisaria pseudoarcta (Ophiocordycipitaceae), two new species parasitizing Lepidopteran insects from southwestern China
expand article infoHui Chen‡, Shabana Bibi§, Ling Tao‡, Xiangchun Shen‡, Jun Zhao‡|, Yueming Sun|, Qirui Li‡, Dexiang Tang‡, Yao Wang‡
‡ Guizhou Medical University, Guizhou, China
§ Shifa Tameer-e-Millat University, Islamabad, Pakistan
| Guizhou Tongde Pharmaceutical Co., Ltd., Guizhou, China

Corresponding author: Jun Zhao ( 602166987@qq.com )

Corresponding author: Yao Wang ( wangyao1@aliyun.com )

Academic editor: Nalin Wijayawardene
© 2025 Hui Chen, Shabana Bibi, Ling Tao, Xiangchun Shen, Jun Zhao, Yueming Sun, Qirui Li, Dexiang Tang, Yao Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Chen H, Bibi S, Tao L, Shen X, Zhao J, Sun Y, Li Q, Tang D, Wang Y (2025) Papiliomyces sinensis (Clavicipitaceae) and Paraisaria pseudoarcta (Ophiocordycipitaceae), two new species parasitizing Lepidopteran insects from southwestern China. MycoKeys 117: 353-374. https://doi.org/10.3897/mycokeys.117.150376
Open Access

Abstract

Cordyceps sensu lato species are highly important for medicinal purposes and functional food nutrients. Two new species belonging to Cordyceps sensu lato are introduced, i.e., Papiliomyces sinensis and Paraisaria pseudoarcta. To comprehensively describe the significance of these two species, morphological data were supplemented with phylogenetic analyses based on six loci (nrSSU, ITS, nrLSU, tef-1α, rpb1, and rpb2). Phylogenetically, Pap. sinensis is most closely related to Pap. albostromaticus and Pap. shibinensis, yet it can be distinguished from them by its larger stromata (51.3–85.7 × 3.1–3.5 vs. 37.0–58.0 × 2.5–3.0) and longer phialides (10.1–26.9 × 0.9–3.3 vs. 9.8–24.3 × 1.5–3.1). Paraisaria pseudoarcta is phylogenetically sister to Par. arcta. The longer stromata (43–51 vs. 16) and larger secondary ascospores (5.6–8.3 × 1.7–3.1 vs. 2.6–4.2 × 0.5–1.3) in Par. pseudoarcta are characteristics that distinguish the two species. A thorough morphological description and phylogenetic analysis of Pap. sinensis and Par. pseudoarcta were provided. In addition, taxonomic misconceptions of Par. gracilis (Ophiocordycipitaceae) were corrected.

Key words:

Cordyceps, Entomopathogenic fungi, new species, phylogenetics, taxonomy

Introduction

The latest classification of Cordyceps sensu lato (s. l.) places it in the family Clavici­pitaceae s. l., which is characterized by filiform ascospores that often disarticulate into secondary ascospores, thickened ascus apices, and cylindrical asci (Mains 1958; Kobayasi 1982; Rossman et al. 1999; Hywel-Jones 2002; Sung et al. 2007a). Given its wide host range and abundance of species, this genus represents the most diverse group within the Clavicipitaceae s. l. Four cordycipitoid families are now recognized in the order Hypocreales: Clavicipitaceae, Cordycipitaceae, Ophiocordycipitaceae, and Polycephalomycetaceae. Together, these four families contain more than 1,300 cordycipitoid species and at least 42 genera (Chaverri et al. 2005; Luangsa-ard et al. 2005, 2017; Sung et al. 2007a; Zare and Gams 2007; Johnson et al. 2009; Kepler et al. 2012a, 2012b, 2014; Quandt et al. 2014; Spatafora et al. 2015; Tsang et al. 2016; Mongkolsamrit et al. 2019; Xiao et al. 2023).

Similarly, revisions have occurred in the classification of other genera within Hypocreales. One significant genus of entomopathogenic fungi frequently found in various terrestrial habitats is Metarhizium (Kepler et al. 2014; Brunner-Mendoza et al. 2019). Initially, Metarhizium species were classified based on morphological traits, leading to the identification of species such as M. anisopliae, M. flavoviride, and M. album (Tulloch 1976; Driver et al. 2000). However, accurate identification has often been hindered by morphological convergence, particularly in distinguishing cryptic species. The advent of molecular techniques has transformed fungal taxonomy by providing robust tools for species delimitation (Johannes et al. 2011; Rehner et al. 2011; Huzefa et al. 2017). Multilocus phylogenetic studies, including those by Sung et al. (2007a, b), Kepler et al. (2012a, 2014), and Mongkolsamrit et al. (2020), have significantly improved the resolution in differentiating closely related species. Mongkolsamrit et al. (2020) revised Metarhizium, accepting 66 species, including 21 within the M. anisopliae complex and 13 within the M. flavoviride complex. This revision also led to the establishment of six new genera—Keithomyces, Marquandomyces, Papiliomyces, Purpureomyces, Sungia, and Yosiokobayasia—highlighting the dynamic and evolving nature of fungal taxonomy. Among these newly erected genera, Papiliomyces was established by Mongkolsamrit et al. (2020) in the family Clavicipitaceae (Hypocreales, Sordariomycetes) based on phylogenetic analyses, initially accommodating two species: Papiliomyces liangshanensis (collected from Nepal) and Papiliomyces shibinensis (collected from China). The genus was defined by morphological and multilocus phylogenetic data, distinguishing it from Metarhizium. However, subsequent studies questioned the taxonomic placement of the type species, P. liangshanensis, which was later transferred to Ophiocordyceps based on phylogenetic evidence (Wang et al. 2021). This revision underscores the critical role of molecular systematics in fungal taxonomy and highlights the ongoing refinement of Papiliomyces classification. The genus name is derived from the Latin word papilio, meaning “butterfly” or “moth” (Mongkolsamrit et al. 2020). The primary teleomorphic characteristics of Papiliomyces include solitary to multiple stromata, perithecia ranging from superficial to completely immersed, cylindrical asci, and ascospores that either remain entire with septation or fragment into cylindrical part-spores (Kepler et al. 2012a, b; Mongkolsamrit et al. 2020; Wang et al. 2021). These unique morphological features set Papiliomyces apart from other genera in the Clavicipitaceae.

Petch (1931) established the genus Ophiocordyceps, with O. blattae as the type species, in contrast to Papiliomyces. The ascospores of Ophiocordyceps remain intact and become septate after discharge (i.e., non-disarticulating ascospores), and the asci possess faint apical caps. Kobayasi (1941) later classified Ophiocordyceps as a subgenus of Cordyceps. Subsequently, Sung et al. (2007b) separated Ophiocordyceps from Cordyceps based on molecular phylogenetic analyses and provided a comprehensive re-description of the genus. Ophiocordyceps exhibits a wide range of morphological characteristics, including stromata that may be fibrous, hard, pliant, or wiry, with colors ranging from dark to light. The perithecia may be immersed and arranged in either an ordinal or oblique pattern. Additionally, Ophiocordyceps displays two distinct ascospore morphologies: entire ascospores and those that fragment into part-spores either within the ascus or after ejection, as reported by Ban et al. (2015), Sanjuan et al. (2015), Araújo et al. (2018), Khonsanit et al. (2018), and Luangsa-ard et al. (2018). Based on multigene phylogenies presented in the referenced literature (Quandt et al. 2014; Sanjuan et al. 2015; Araújo et al. 2018), Ophiocordyceps is characterized by a remarkable diversity of asexual morphs, including but not limited to Hirsutella, Hymenostilbe, Paraisaria, Sorosporella, Stilbella, and Syngliocladium.

The asexually typified genus Paraisaria was proposed by Samson and Brady (1983), with Par. dubia (syn. Isaria dubia Delacr.) as the type species. Paraisaria dubia is a well-established species occurring on the larvae of Hepialus (Lepidoptera) and is also associated with Ophiocordyceps gracilis (syn. Cordyceps gracilis (Grev.) Durieu & Mont.). Another notable species, Par. gracilioides, corresponds to O. gracilioides (syn. Cordyceps gracilioides Kobayasi), which is recognized as its sexual morph. Paraisaria is characterized by white, loose synnemata composed of verticillately branched, sympodially proliferating polyphialides with swollen bases and narrowly cylindrical to fusiform conidia formed in slimy heads. The sexual morphs are distinguished by unique morphological features, including a globose fertile structure at the terminal end of the stroma, immersed perithecia, and the presence of part-spores within the ascus and after ascospore discharge (Samson and Brady 1983).

However, it is important to note that the hosts of Cordyceps s. l. primarily belong to several arthropod orders, with Coleoptera and Lepidoptera being the two most prominent (Shrestha et al. 2016). Of the approximately 200 Cordyceps species parasitizing these orders, 92 species have been documented with identified host species. Among Coleopteran hosts, Scarabaeidae and Elateridae are the primary families. Similarly, among Lepidopteran hosts, Hepialidae is the largest host family.

For the past two years, our efforts have been exerted in the investigation of cordycipitoid fungi, especially in southwestern China. In this study, two unknown species of Cordyceps s. l. attacking Lepidopteran larvae were collected from Guizhou and Yunnan provinces, southwestern China. These two species were different from all other Cordyceps s. l. species in morphology and combined multi-gene phylogeny analyses. Hence, they are recognized as new species.

Materials and methods

Specimen collection and fungus isolation

Most of the specimens used in this investigation were gathered from Yunnan Province, China, while a few specimens were gathered from Guizhou Province’s Yuntai Mountain Scenic Area. During field investigations, specimens were photographed, and relevant data were recorded. After being kept at low temperatures (-4 °C) in plastic containers, the samples were brought to the lab for identification. The specimens were thereafter kept in the Guizhou Medical University Herbarium (GMB). Samples were first soaked for five minutes in a 30% hydrogen peroxide solution before being washed twice with sterile distilled water. Sterile paper was used to blot away any surface dampness (Sun et al. 2022). The tissue was moved to potato glucose agar (PDA) plates after the treated samples were aseptically sliced to remove the epidermis. For storage, purified fungal cultures were either moved to PDA slants at 4 °C or kept in an incubator at 25 °C (Wang et al. 2020). Living cultures were deposited at the Guizhou Medical University Culture Collection (GMBC).

Morphological characteristic observations

A Nikon SMZ745T stereomicroscope (Tokyo, Japan) was used to study the specimen’s macroscopic features, including its size, color, shape, length, stroma, and fertile head. A Nikon ECLIPSE Ni compound microscope (Nikon, Japan) was used to take pictures of the samples using a Canon EOS 700D digital camera. Measurements were made using the Tarosoft (R) Image Frame Work (v.0.9.7). The colony was grown on PDA plates in an incubator set at 25 °C for 14 days. After that, the colony was measured and photographed using the equipment and tools mentioned before.

DNA extraction, PCR amplification, and sequencing

The samples were put in a sterile centrifuge tube and processed until they were completely pulverized using sterile fine rods. The genomic DNA purification kit (Qiagen GmbH, Hilden, Germany) was used to isolate genomic DNA in accordance with the manufacturer’s instructions. At -20 °C, the pure DNA was kept. 1 µL of DNA extract, 1 µL of each forward and reverse primer (10 µM each), 9.5 µL of ddH2O, and 12.5 µL of 2 × Taq PCR Master Mix (2 × Taq Master Mix with dye, TIANGEN, China) made up the 25 µL PCR reaction mixture. The primer combination NS1 and NS4 was used to amplify the nuclear ribosomal small subunit (nrSSU) (White et al. 1990). The primer combination ITS4 and ITS5 was used to amplify the nuclear ribosomal internal transcribed spacer region (ITS) (White et al. 1990). The primer pair 28F and 28R was used to amplify the nuclear ribosomal large subunit (nrLSU) (Stephen and Samuels 1994). The primer combination TEF-F and TEF-R was used to amplify the translation elongation factor 1α (tef-1α) (Bischoff et al. 2006; Sung et al. 2007a). The primer pairs CRPB1-5’F and CRPB1-5’R, as well as fRPB2-5F and fRPB2-7cR, were used to amplify the largest and second-largest subunits of RNA polymerase II (rpb1 and rpb2) (Liu et al. 1999; Castlebury et al. 2004; Bischoff et al. 2006) (Table 1). The PCR assays of the six genes were conducted as described by Wang et al. (2015). An automatic sequence analyzer (BGI Co., Ltd., Shenzhen, China) was used to sequence the PCR products after they had been separated by electrophoresis in 1.0% agarose gels and purified using the Gel Band Purification Kit (Bio Teke Co., Ltd., Beijing, China).

Table 1.
Download as
CSV
XLSX

The primer information of each gene fragment used for DNA amplification in this study.

Gene Primer name Primer sequence (5'-3') Reference
nrSSU NS1 GTAGTCATATGCTTGTCTC White et al. (1990)
NS4 CTTCCGTCAATTCCTTTAAG
nrLSU 28F ACCCGCTGAACTTAAGC Stephen and Samuels (1994)
28R ATCCTGAGGGAAACTTCG
tef-1α TEF-F GCTCCYGGHCAYCGTGAYTTYAT Bischoff et al. (2006); Sung et al. (2007)
TEF-R ATGACACCRACRGCRACRGTYTG
rpb1 RPB1-5’F CAYCCWGGYTTYATCAAGAA Castlebury et al. (2004); Bischoff et al. (2006)
RPB1-5’R CCNGCDATNTCRTTRTCCATRTA
rpb2 fFPB2-5F GAYGAYMGWGATCAYTTYGG Liu et al. (1999)
fRPB2-7cR CCCATRGCTTGYTTRCCCAT
ITS ITS4 TCCTCCGCTTATTGATATGC White et al. (1990)
ITS5 GGAAGTAAAAGTCGTAACAAGG

Phylogenetic analyses

Sequences of the six loci (nrSSU, ITS, nrLSU, tef-1α, rpb1, and rpb2) were retrieved from GenBank. Table 2 contains the taxonomy details and GenBank accession numbers for these sequences. MAFFT v.7 (http://mafft.cbrc.jp/alignment/server/) and MEGA 7.0.26 were used to align the sequences (Tamura et al. 2013). Where required, the aligned sequences were subsequently manually adjusted. MEGA 7.0.26 was used to concatenate the aligned sequences of nrSSU, ITS, nrLSU, tef-1α, rpb1, and rpb2 into a single dataset. Maximum likelihood (ML) and Bayesian inference (BI) were used for phylogenetic studies. GTR + FO + G was selected as the optimal model for ML analysis, and 1000 rapid bootstrap replicates were performed on the dataset. ML phylogenetic analyses were conducted in RAxML 7.0.3 (Stamatakis et al. 2008). Additional ML analyses were performed using IQ-TREE v. 2.1.3 with ultrafast bootstrapping for the estimation of branch support (Minh et al. 2020). jModelTest v.2.1.4 was used to determine the best-fit model for BI analysis (Darriba et al. 2012). The analysis used the following models: GTR + I + G for partitions of nrSSU, ITS, nrLSU, and tef-1α and GTR + I for partitions of rpb1 and rpb2. Bayesian analysis was conducted using MrBayes v.3.2.7a for five million generations (Ronquist et al. 2012). Samsoniella asiatica YFCC 869 and Samsoniella hepiali YFCC 868 were designated as the outgroup taxa for the analysis. The phylogenetic tree was viewed and edited using FigTree V.1.4.2. Furthermore, ML analyses (IQ-TREE) were performed separately for each locus: nrSSU, ITS, nrLSU, tef-1α, rpb1, and rpb2.

Table 2.
Download as
CSV
XLSX

Relevant species information and GenBank accession numbers for phylogenetic research in this study.

Species Voucher / information Host / Substrate GenBank Accession Number Reference
ITS nrSSU nrLSU tef-1α rpb1 rpb2
Conoideocrella huteorostata NHJ 12516 Lepidoptera JN049860 EF468994 EF468849 EF468800 EF468905 EF468946 Sung et al. (2007a)
Conoideocrella tenuis NHJ 6293 Lepidopteran pupa JN049862 EU369112 EU369044 EU369029 EU369068 EU369087 Sung et al. (2007a)
Drechmeria balanoides CBS 250.82T Nematoda NA AF339588 AF339539 DQ522342 DQ522388 DQ522442 Sung et al. (2001); Spatafora et al. (2007)
Drechmeria campanulata IMI 356051T Panagrolaimus NA AF339592 AF339543 NA NA NA Sung et al. (2001)
Drechmeria panacis CBS 142798T Panax notoginseng NA MF588890 MF588897 MF614144 NA NA Yu et al. (2018)
Drechmeria zeospora CBS 335.80T Panagrolaimus NA AF339589 AF339540 EF469062 EF469091 EF469109 Sung et al. (2001); Sung et al. (2007a)
Harposporium harposporiferum ARSEF 5472T Arthropod NA AF339569 AF339519 DQ118747 DQ127238 NA Sung et al. (2001); Chaverri et al. (2005)
Harposporium anguillulae ARSEF 5407 Soil NA NA AY636080 NA NA NA Chaverri et al. (2005)
Keithomyces acicularis JCM 33284T Soil LC435734 LC435738 LC435741 LC462188 NA NA Iwasaki et al. (2019)
Keithomyces acicularis JCM 33285 Soil LC463198 LC435739 LC435742 LC462189 NA NA Iwasaki et al. (2019)
Keithomyces carneus CBS 399.59 Soil MT078887 NA MH869445 NA NA NA Sung et al. (2007b)
Keithomyces carneus CBS 239.32T Sand dune AY624171 EF468988 EF468843 EF468789 EF468894 EF468938 Sung et al. (2007b)
Keithomyces neogunnii GZUHSB13050302T Lepidoptera larva KU729716 KU729722 NA KU729727 KU729732 NA Wen et al. (2017)
Marquandomyces marquandii CBS 182.27T Soil AY624193 EF468990 EF468845 EF468793 EF468899 EF468942 Sung et al. (2007b)
Marquandomyces marquandii CBS 128893 Hygrocybe virginea MH865143 NA MH876582 NA NA NA Sung et al. (2007b)
Marquandomyces sp. CBS 127132 Soil MT078882 MT078872 MT078857 MT078849 MT078865 MT078922 Sung et al. (2007b)
Marquandomyces sp. CBS 129413 Soil MT561567 MT078874 MT078859 MT078851 MT078867 NA Sung et al. (2007b)
Metacordyceps liangshanensis EFCC 1452 Lepidoptera pupa NA EF468962 EF468815 EF468756 NA NA Sung et al. (2007b)
Metacordyceps liangshanensis EFCC 1523 Lepidoptera pupa NA EF468961 EF468814 EF468755 NA EF468918 Sung et al. (2007b)
Metapochonia bulbillosa CBS 145.70T Picea abies AJ292410 AF339591 AF339542 EF468796 EF468902 EF468943 Sung et al. (2007b); Sung et al. (2001)
Metapochonia bulbillosa JCM 18596 Picea abies NA AB758252 NA AB758460 AB758663 AB758690 Sung et al. (2007b)
Metapochonia goniodes CBS 891.72T Nematoda AJ292409 AF339599 MH872319 DQ522354 DQ522401 DQ522458 Spatafora et al. (2007)
Metapochonia suchlasporia CBS 251.83T Nematode egg MH861580 NA MH873311 KJ398790 KJ398601 KJ398697 Kepler et al. (2014); Vu et al. (2019)
Metapochonia suchlasporia CBS 248.83T Nematode egg MH861579 NA MH873310 KJ398789 KJ398600 KJ398696 Kepler et al. (2014); Vu et al. (2019)
Metapochonia rubescens CBS 464.88T Nematode egg MH862138 AF339615 MH873830 EF468797 EF468903 EF468944 Sung et al. (2007)
Metarhizium album ARSEF 2082 Hemiptera AY375446 DQ522560 DQ518775 DQ522352 DQ522398 DQ522452 Kepler et al. (2012a)
Metarhizium cf. album ARSEF 2179 Hemiptera NA NA NA KJ398807 KJ398618 KJ398716 Kepler et al. (2012a)
Metarhizium anisopliae CBS 130.71T Avena sativa MT078884 MT078868 MT078853 MT078845 MT078861 MT078918 Gisbert (1993)
Metarhizium brunneum ARSEF 2107T Coleoptera KC178691 NA MH868397 EU248855 EU248907 EU248935 Bischoff et al. (2009)
Metarhizium chaiyaphumense BCC 19020 Hemiptera: Cicadidae HQ165694 HQ165654 HQ165716 HQ165675 HQ165737 HQ165635 Luangsa-ard et al. (2017)
Metarhizium chaiyaphumense BCC 78198T Hemiptera: Cicadidae NA KX369596 KX369593 KX369592 KX369594 KX369595 Luangsa-ard et al. (2017)
Metarhizium flavoviride ARSEF 2025 Coleoptera AF138269 NA NA KJ398804 KJ398614 KJ398712 Kepler et al. (2014)
Metarhizium flavoviride CBS 218.56T Coleoptera MH857590 NA MH869139 KJ398787 KJ398598 KJ398694 Kepler et al. (2014); Vu et al. (2019)
Metarhizium gaoligongense CCTCCM2016588T Soil KY087808 KY087812 KY087816 KY087820 KY087824 KY087826 Chen et al. (2018)
Metarhizium guizhouense ARSEF 6238 Lepidoptera NA NA NA EU248857 EU248909 EU248937 Bischoff et al. (2009)
Metarhizium guizhouense CBS 258.90 Lepidoptera HQ331448 NA NA EU248862 EU248914 EU248942 Bischoff et al. (2009)
Metarhizium globosum ARSEF 2596T Lepidoptera HQ331459 NA NA EU248846 EU248898 EU248926 Bischoff et al. (2009)
Ophiocordyceps kimflemingiae SC 30 Hymenoptera NA KX713629 KX713622 KX713699 KX713727 NA Araújo et al. (2018)
Ophiocordyceps konnoana EFCC 7315 Coleoptera NA EF468959 NA EF468753 EF468861 EF468916 Sung et al. (2007a)
Ophiocordyceps longissima TNS F18448 Hemiptera NA KJ878925 KJ878892 KJ878971 KJ879005 NA Quandt et al. (2014)
Ophiocordyceps monticola BPI 634610 Orthoptera OQ709246 NA NA NA NA NA Tehan et al. (2023)
Ophiocordyceps nigrella EFCC 9247 Coleoptera JN049853 EF468963 EF468818 EF468758 EF468866 EF468920 Sung et al. (2007a)
Ophiocordyceps pulvinata TNSF 30044 Hymenoptera NA GU904208 NA GU904209 GU904210 NA Kepler et al. (2011)
Ophiocordyceps ravenelii OSC 151914 Coleoptera NA KJ878932 NA KJ878978 KJ879012 KJ878950 Quandt et al. (2014)
Ophiocordyceps sinensis EFCC 7287 Lepidoptera JN049854 EF468971 EF468827 EF468767 EF468874 EF468924 Quandt et al. (2014)
Ophiocordyceps stylophora OSC 111000 Coleoptera JN049828 DQ522552 DQ518766 DQ522337 DQ522382 DQ522433 Quandt et al. (2014)
Ophiocordyceps variabilis OSC 111003 Diptera NA EF468985 EF468839 EF468779 EF468885 EF468933 Sung et al. (2007a)
Ophiocordyceps variabilis ARSEF 5365 Diptera NA DQ522555 DQ518769 DQ522340 DQ522386 DQ522437 Spatafora et al. (2007)
Papiliomyces albastromata YHH 23070027 Hepialidae OR770519 OR770494 OR770504 PP479838 PP203269 PP479841 Chen et al. (2024)
Papiliomyces albastromata YHH 2307003 Hepialidae OR770518 OR770493 OR770503 PP479837 PP203268 PP479840 Chen et al. (2024)
Papiliomyces albastromata YFCC 23079297 Hepialidae OR775109 OR775107 OR775108 PP479839 PP203270 PP479842 Chen et al. (2024)
Papiliomyces longiclavatus YC 20061403T Lepidoptera larva MZ702080 MZ702112 MZ702101 MZ955880 MZ955876 MZ955872 Zhang et al. (2023)
Papiliomyces longiclavatus YC 20061407 Lepidoptera larva MZ702082 MZ702114 MZ702103 MZ955882 NA NA Zhang et al. (2023)
Papiliomyces shibinensis GZUHSB13050311T Lepidoptera KR153585 KR153588 NA KR153589 KR153590 NA Wen et al. (2015)
Papiliomyces sinensis GMB 3053 Napialus larva PQ636502 PQ636499 PQ636505 PQ660654 PQ660657 PQ660660 This study
Papiliomyces sinensis GMBC 3053T Napialus larva PQ636503 PQ636500 PQ636506 PQ660655 PQ660658 PQ660661 This study
Papiliomyces sinensis GMBC 3054 Napialus larva PQ636504 PQ636501 PQ636507 PQ660656 PQ660659 PQ660662 This study
Papiliomyces puniceum BUM 838T Lepidoptera OM955149 OM951244 OM951249 NA OM988194 OM988189 Chen et al. (2023)
Papiliomyces puniceum BUM 1214 Lepidoptera OM955150 OM951245 OM951250 OM988198 OM988195 OM988190 Chen et al. (2023)
Paraisaria alba HKAS 102484T Orthoptera MN947219 MN943843 MN943839 MN929085 MN929078 MN929082 Wei et al. (2021)
Paraisaria amazonica HUA 186143 Orthoptera NA KJ917562 KJ917571 KM411989 KP212902 KM411982 Sanjuan et al. (2015)
Paraisaria amazonica HUA 186113 Orthoptera NA KJ917566 KJ917572 NA KP212903 KM411980 Sanjuan et al. (2015)
Paraisaria arcta HKAS 102553T Lepidoptera MN947221 MN943845 MN943841 MN929087 MN929080 NA Wei et al. (2021)
Paraisaria arcta HKAS 102552 Lepidoptera MN947220 MN943844 MN943840 MN929086 MN929079 MN929083 Wei et al. (2021)
Paraisaria blattarioides HUA 186093 Blattodea NA KJ917559 KJ917570 KM411992 KP212910 NA Sanjuan et al. (2015)
Paraisaria blattarioides HUA 186108T Blattodea NA KJ917558 KJ917569 NA KP212912 KM411984 Sanjuan et al. (2015)
Paraisaria cascadensis OSC-M-052010 Orthoptera OQ709237 OQ800918 OQ708931 OR199814 OR199828 OR199838 Tehan et al. (2023)
Paraisaria cascadensis OSC-M-052017 Orthoptera OQ709240 OQ800921 OQ708934 OR199817 OR199831 NA Tehan et al. (2023)
Paraisaria coenomyia NBRC 106964 Diptera AB968397 AB968385 AB968413 AB968571 NA AB968533 Ban et al. (2015)
Paraisaria coenomyia NBRC 108993T Diptera AB968396 AB968384 AB968412 AB968570 NA AB968532 Ban et al. (2015)
Paraisaria gracilioides HUA 186095 Coleoptera NA NA NA KM411994 KP212914 NA Sanjuan et al. (2015)
Paraisaria gracilioides HUA 186092 Coleoptera NA NA KJ130992 NA KP212915 NA Sanjuan et al. (2015)
Paraisaria gracilis EFCC 3101 Lepidoptera NA EF468955 EF468810 EF468750 EF468858 EF468913 Sung et al. (2007a)
Paraisaria gracilis EFCC 8572 Lepidoptera JN049851 EF468956 EF468811 EF468751 EF468859 EF468912 Sung et al. (2007a)
Paraisaria gracilis OSC 151906 Lepidoptera NA KJ878923 KJ878890 KJ878969 NA NA Quandt et al. (2014)
Paraisaria gracilis GMBC 3066 Lepidoptera pupa PQ787761 PQ785776 PQ785779 PQ789222 PQ789225 PQ789228 This study
Paraisaria heteropoda EFCC 10125 Hemiptera JN049852 EF468957 EF468812 EF468752 EF468860 EF468914 Sung et al. (2007a)
Paraisaria heteropoda NBRC 100643 Hemiptera NA JN941719 JN941422 AB968595 JN992453 AB968556 Ban et al. (2015)
Paraisaria insignis OSC 164134 Coleoptera OQ709231 OQ800911 OQ708924 OR199807 OR199822 NA Tehan et al. (2023)
Paraisaria insignis OSC 164135 Coleoptera OQ709232 OQ800912 OQ708925 OR199808 OR199823 NA Tehan et al. (2023)
Paraisaria orthopterorum BBC 88305 Orthoptera MH754742 NA MK332583 MK214080 MK214084 NA Mongkolsamrit et al. (2019)
Paraisaria orthopterorum TBRC 9710T Orthoptera MH754743 NA MK332582 MK214081 MK214085 NA Mongkolsamrit et al. (2019)
Paraisaria phuwiangensis TBRC 9709T Coleoptera MK192015 NA MK192057 MK214082 MK214086 NA Mongkolsamrit et al. (2019)
Paraisaria pseudoarcta GMBC 3064T Lepidoptera pupa PQ787759 PQ785774 PQ785777 PQ789220 PQ789223 PQ789226 This study
Paraisaria pseudoarcta GMBC 3065 Lepidoptera pupa PQ787760 PQ785775 PQ785778 PQ789221 PQ789224 PQ789227 This study
Paraisaria pseudoheteropoda OSC-M-052007 Hemiptera OQ709235 OQ800916 OQ708929 OR199812 OR199826 OR199837 Tehan et al. (2023)
Paraisaria pseudoheteropoda OSC-M-052022 Hemiptera OQ709245 OQ800925 OQ708939 OR199821 OR199835 OR199841 Tehan et al. (2023)
Paraisaria rosea HKAS 102546T Coleoptera MN947222 MN943846 MN943842 MN929088 MN929081 MN929084 Wei et al. (2021)
Paraisaria tettigonia GZUHCS14062709T Orthoptera KT345954 KT345955 NA KT375440 KT375441 NA Wang et al. (2016)
Pochonia boninensis JCM 18597 Soil AB709858 AB758255 AB709831 AB758463 AB758666 AB758693 Nonaka et al. (2013)
Pochonia globispora CBS 203.86T Soil DQ516079 NA MH873631 NA NA NA Zare and Gams (2007)
Pochonia chlamydosporia CBS 504.66T Soil AJ292398 AF339593 AF339544 EF469069 EF469098 EF469120 Sung et al. (2007a); Sung et al. (2001)
Pochonia chlamydosporia CBS 101244 Mollusca JN049821 DQ522544 DQ518758 DQ522327 DQ522372 DQ522424 Spatafora et al. (2007)
Purpureocillium atypicolum CBS 744.73 Atypus karschi NA EF468987 EF468841 EF468786 EF468892 NA Sung et al. (2007a)
Purpureocillium atypicolum OSC 151901 Atypus karschi NA KJ878914 KJ878880 KJ878961 KJ878994 NA Quandt et al. (2014)
Purpureocillium lilacinum CBS 284.36T Hemiptera NA AY526475 FR775484 EF468792 EF468898 EF468941 Johnson et al. (2009)
Purpureocillium lilacinum NHJ 3497 Hemiptera NA EU369096 EU369033 EU369014 EU369053 EU369074 Johnson et al. (2009)
Purpureomyces khaoyaiensis BCC 14290 Lepidoptera larva JN049869 KX983469 KX983463 KX983458 NA KX983466 Hywel-Jones (1994)
Purpureomyces khaoyaiensis BCC 44287 Lepidoptera larva NA KX983470 KX983464 KX983459 NA KX983467 Hywel-Jones (1994)
Purpureomyces pyriformis BCC 85074T Lepidoptera larva MN781929 NA MN781873 MN781730 MN781775 MN781821 Mongkolsamrit et al. (2020)
Purpureomyces pyriformis BCC 85348 Lepidoptera larva MN781927 NA MN781871 MN781728 MN781773 MN781820 Mongkolsamrit et al. (2020)
Samsoniella asiatica YFCC 869T Lepidoptera pupa OQ476473 OQ476497 OQ476505 OQ506153 OQ506195 OQ506187 Wang et al. (2023)
Samsoniella hepiali YFCC 868 Hepialidae pupa OQ476484 OQ476502 OQ476510 OQ506158 OQ506200 OQ506192 Wang et al. (2023)
Sungia yongmunensis EFCC 2131T Lepidoptera JN049856 EF468977 EF468833 EF468770 EF468876 KJ398690 Sung et al. (2007a)
Sungia yongmunensis EFCC 2135 Lepidoptera NA EF468979 EF468834 EF468769 EF468877 NA Sung et al. (2007a)
Tolypocladium capitatum NBRC 100997 Fungi NA JN941740 JN941401 AB968597 JN992474 AB968558 Schoch et al. (2012); Ban et al. (2015)
Tolypocladium capitatum NBRC 106325 Fungi NA JN941739 JN941402 AB968598 JN992473 AB968559 Schoch et al. (2012); Ban et al. (2015)
Tolypocladium cylindrosporum ARSEF 2920T Soil NA NA MH871712 MG228390 MG228384 MG228387 Montalva et al. (2019)
Tolypocladium cylindrosporum YFCC 1805001 Soil NA MK984565 MK984577 MK984569 MK984584 MK984573 Weiser et al. (1991)
Tolypocladium pseudoalbum YFCC 876 Soil NA OP207718 OP207738 OP223152 OP223130 OP223140 Dong et al. (2022)
Tolypocladium pseudoalbum YFCC 875T Soil NA OP207717 OP207737 OP223151 OP223129 OP223139 Dong et al. (2022)
Yosiokobayasia kusanagiensis TNS F18494 Lepidoptera JN049873 JF415954 JF415972 JF416014 JN049890 NA Kepler et al. (2012a)
Yosiokobayasia kusanagiensis BUM 1307 Lepidoptera OM955151 OM951246 OM951251 OM988199 NA OM988191 Sung et al. (2007b)

Boldface: data generated in this study; T: ex-type culture. Culture collection acronyms: ARSEF: Agricultural Research Service Collection of Entomopathogenic Fungal Cultures; BCC: BIOTEC Culture Collection Laboratory; BPI: U.S. National Fungus Collections; CBS: the culture collection of the Westerdijk Fungal Biodiversity Institute; CCTCCM: China Center for Type Culture Collection and Microorganism; EFCC: Epping Forest Conservation Center; GMB: Guizhou Medical University Herbarium; GZUHSB: Guizhou University of Humanities, Science and Technology, Specimen Bank; HKAS: Herbarium of Cryptogamic Kunming Institute of Botany Academia Sinica; IMI: CABI Bioscience UK Center; JCM: Japan Collection of Microorganisms; NBRC: National Institute of Technology and Evaluation; NHJ: National Herbarium of Japan; OSC: Culture Collection of Oregon State University; TNSF: National Museum of Nature and Science; YFCC: Yunnan Fungal Culture Collection of Yunnan University; YHH: Yunnan Herbal Herbarium of Yunnan University.

Results

Phylogenetic analyses

The combined six-locus dataset contained 6,284 base pairs (bp) of sequences after alignment, including 1,631 bp for nrSSU, 787 bp for ITS, 959 bp for nrLSU, 992 bp for tef-1α, 759 bp for rpb1, and 1,156 bp for rpb2. Phylogenetic analyses based on the combined six-locus sequences from 113 fungal taxa confirmed the presence and positions of Pap. sinensis and Par. pseudoarcta within Clavicipitaceae and Ophiocordycipitaceae, respectively. Seventeen well-supported clades were recognized, which accommodate species of the genera Conoideocrella, Drechmeria, Harposporium, Keithomyces, Marquandomyces, Metapochonia, Metarhizium, Ophiocordyceps, Papiliomyces, Paraisaria, Pochonia, Purpureocillium, Purpureomyces, Samsoniella, Sungia, Tolypocladium, and Yosiokobayasia (Fig. 1). The phylogenetic analyses also resolved most Papiliomyces and Paraisaria lineages in separate terminal branches. It was proposed that one specimen and two strains (GMB 3053, GMBC 3053, and GMBC 3054), which formed a distinct lineage and had a close relationship with Pap. albostromaticus, might be a new species in the genus Papiliomyces (Clavicipitaceae), named Pap. sinensis (Fig. 1). Our analyses also revealed that the newly discovered species, Par. pseudoarcta (GMBC 3064 and GMBC 3065), were phylogenetically clustered with Par. arcta but clearly distinguished from the latter by forming a strongly supported clade in the genus Paraisaria (Ophiocordycipitaceae).

Figure 1. 

Phylogenetic tree based on combined partial nrSSU + ITS + nrLSU + tef-1α + rpb1 + rpb2 sequences showing the relationship of two new species of Lepidoptera from China with other species. Numbers at the branches indicate support values (IQ-TREE-BS/RAxML-BS/BI-PP) above 70%/70%/0.7. Ex-type materials are marked with “T.” Materials in bold type are those analyzed in this study.

Despite differing topologies between individual loci (nrSSU, ITS, nrLSU, tef-1α, rpb1, and rpb2), the newly proposed species were consistently resolved as distinct clades from other known species. Some novel species consistently recovered sister relationships with particular known species across all loci. For example, the newly discovered species Par. pseudoarcta had a close genetic relationship with Par. arcta. These two species were distinguished as separate taxa with strong support from nrSSU, ITS, nrLSU, tef-1α, rpb1, and rpb2 datasets (Suppl. material 1: figs S1–S6). Meanwhile, the new species Pap. sinensis was resolved as sister to Pap. albostromaticus, with significant bootstrap support from ITS, nrLSU, rpb1, and rpb2 phylogenetic analyses (Suppl. material 1: figs S2, S3, S5, S6).

Taxonomy

Papiliomyces sinensis H. Chen & Y. Wang, sp. nov.

MycoBank No: 857553
Fig. 2

Etymology.

Named after China (Guizhou and Yunnan province), where the species is distributed.

Type.

China • Guizhou Province, Shibing County, Yuntai Mountain Scenic Area (27°7'N, 108°7'E, alt. 1066 m), on a Napialus sp. buried in forest soil, May 2024, collected by Yao Wang (holotype: GMB 3053; ex-type GMBC 3053).

Description.

Sexual morph: Stroma solitary, fleshy, clavate, gray to earthy yellow, arising from the head of host, 51.3–85.7 × 3.1–3.5 (X̄ = 68.5 × 3.2, n = 5) mm. Perithecia, asci, and ascospores not observed. Asexual morph: Paecilomyces-like. Colonies on PDA slow-growing, up to 18 mm diam. in 14 days at 25 °C, white to gray, cottony with raised mycelial density at the center, generating several concentric rings at the edge, reverse yellowish to brown. Hyphae hyaline, septate, branched, smooth-walled, 0.9–2.2 µm wide. Conidiophores smooth-walled, cylindrical, mononematous, erect, aseptate, 18.1–41.3 × 0.8–2.0 (X̄ = 26.8 × 1.3, n = 30) µm. Phialides verticillate, in whorls of two to five, usually solitary on hyphae, basal portion cylindrical to narrowly lageniform, tapering gradually toward the apex, 10.1–26.9 × 0.9–3.3 µm (X̄ = 20.8 × 2.4, n = 30). Conidia in long chains, echinulate (visible under high magnification), globose, ellipsoidal, or ovoid, one-celled, 2.5–4.2 × 2.1–4.1 (X̄ = 3.5 × 2.8, n = 50) µm.

Figure 2. 

Papiliomyces sinensis A, B fungus on the host of Napialus sp. C, D culture character on PDA medium E–K conidiophores, phialides, and conidia L conidia M, N chlamydospores. Scale bars: 20 mm (A, B); 15 mm (C, D); 10 µm (E–N).

Host.

Larva of Napialus sp. (Lepidoptera, Hepialidae).

Habitat.

In the soil of evergreen broadleaf forests and evergreen defoliated broadleaf mixed forests.

Distribution.

Guizhou and Yunnan Provinces, China.

Other material examined.

China • Yunnan Province, Shuifu County, Tongluoba National Forest Park (28°26'N, 104°8'E, alt. 1462 m), on larvae of Napialus sp. buried in forest soil, May 2024, collected by Yao Wang (GMB 3054, GMB 3076–GMB 3079; living cultures: GMBC 3054, GMBC 3076–GMBC 3079).

Notes.

Papiliomyces sinensis phylogenetically clusters with Pap. albostromaticus, Pap. shibinensis, and Pap. puniceum but is distinguished from these three by forming a separate clade in this group (Fig. 1; 100%/100%/1). This species is morphologically closest to Pap. albostromaticus, having fleshy clavate stromata with gray color and Paecilomyces-like asexual conidiogenous structure. However, it is easily distinguished by its larger stromata (51.3–85.7 × 3.1–3.5 mm vs. 37.0–58.0 × 2.5–3.0 mm), longer phialides [10.1–26.9 (X̄ = 20.8) µm vs. 9.8–24.3 (X̄ = 16.2) µm] from Pap. albostromaticus, and spinulose conidia (Chen et al. 2024).

Paraisaria pseudoarcta Y. Wang & H. Chen, sp. nov.

MycoBank No: 857554
Fig. 3

Etymology.

Referring to macromorphological resemblance of Par. arcta, but Par. pseudoarcta is phylogenetically distinct.

Type.

China • Yunnan Province, Lancang Lagu Autonomous County (22°32'N, 99°54'E, alt. 1176 m), on a Lepidopteran larva buried in forest soil, Jun 2024, collected by Yao Wang (holotype: GMB 3064; ex-type GMBC 3064).

Description.

Sexual morph: Stroma capitate, solitary, arising from the head of host, 43–51 mm long. Fertile head globose to subglobose, white to light brown, constricted at the center, with sticky and crystal-like substance on the surface, 4.6–4.8 × 4.8–4.9 mm. Stipe fleshy, white to light brown, slightly flexuous, 46.1–38.4 × 3.8–3.5 mm. Perithecia completely immersed, ampulliform to ellipsoidal, 776–979 × 252–339 (X̄= 876 × 289, n = 30) μm. Asci hyaline, narrow cylindrical, tapering toward the base, 8-spored, with thickened cap, 306–379 × 3.5–6.2 (X̄= 344 × 4.7, n = 30) μm. Apical cap 7.8–8.0 × 3.3–4.6 (X̄= 7.9 × 4.0, n = 20) μm. Ascospores hyaline, narrow filiform, equal to the asci in length, when mature, breaking into 64 cylindrical secondary ascospores. Secondary ascospores hyaline, smooth, one-celled, cylindrical, straight, 5.6–8.3 × 1.7–3.1 (X̄= 7.3 × 2.3, n = 30) μm. Asexual morph: Undetermined.

Figure 3. 

Paraisaria pseudoarcta A–C stromata emerging from host mouth D fertile part of stroma E cross section of fertile part showing arrangement of perithecia F, G perithecia H–K asci L ascospore M ascus cap N secondary ascospores. Scale bars: 10 mm (A–C); 1 mm (D, E); 100 μm (F, G); 30 μm (H–N).

Host.

Larva of Lepidoptera.

Habitat.

In the soil of evergreen broadleaf forests.

Distribution.

At present, it is known only in Lancang Lahu Autonomous County, Yunnan Province, China.

Other material examined.

China • Yunnan Province, Lancang Lagu Autonomous County (22°32'N, 99°54'E, alt. 1180 m), on Lepidopteran larvae buried in forest soil, Jun 2024, collected by Yao Wang (GMB 3065, GMB 3075; living culture: GMBC 3065).

Notes.

Morphologically, Par. pseudoarcta resembles the phylogenetic sister species Par. arcta. They were found to be parasitic on lepidopteran larvae, and they are easily recognized by having white and constricted fertile heads. However, our morphological analysis showed that Par. pseudoarcta and Par. arcta differed significantly in the size of their stromata and secondary ascospores. Paraisaria pseudoarcta usually has long stromata (43–51 mm) and large secondary ascospores (5.6–8.3 × 1.7–3.1 μm), while Par. arcta has short stromata (16 mm) and small secondary ascospores (2.6–4.2 × 0.5–1.3 μm) (Table 3). In addition, molecular phylogenetic analyses indicated that they are distinct species (Fig. 1; 100%/100%/1).

Table 3.
Download as
CSV
XLSX

Morphological comparison between new species and related species.

Species Stromata (mm) Fertile head (mm) Perithecia (µm) Asci (μm) Part-spores (μm) Phialides (μm) Conidia (μm) References
Papiliomyces albastromata Clavate, mostly solitary, rarely multiple or branched, white, 37.0–58.0 × 2.5–3.0 Cylindrical, black to grayish white, 6.5–7.4 × 1.5–2.8 Completely immersed, long ovoid or teardrop, 236.9–365.6 × 76.8–122.7 Cylindrical, 8-spored 9.8–24.3 × 1.5–3.1 Ellipse or oval, smooth, 3.2–4.5 × 2.7–4.1 Chen et al. (2024)
Papiliomyces longiclavatus Clavate, solitary, greyish to light yellow, 40–60 × 3–5 Cylindrical, grey white to grey black, 15–21 × 4–6 Immersed, flask-shaped, 320–580 × 110–230 Narrowly cylindrical, 8-spored, 140–230 × 5–7 Cylindrical, 2–9 × 1–2 Two types of phialides, α-phialides, 13–24 × 1–2; β-phialides, 28–45 × 1–2 Two types of conidia, smooth, α-conidia, subglobose, 3–5 × 1–3; β-conidia, fusiform, 6–10 × 1–3 Zhang et al. (2023)
Papiliomyces puniceum Clavate, solitary, red, 21.5 × 3.9 Not observed Not observed Not observed Not observed A little swollen base, slender top, 7.8–16.5 × 1.1–1.8 Echinulate, spherical, 3.0–5.9 Chen et al. (2023)
Papiliomyces shibinensis Clavate, solitary, white to faint yellow, 42 × 2–3 Cylindrical or obtuse, faint yellow, 18–22 × 2–3 Completely immersed, elongated or ampulliform, 400–475 × 135–195 Cylindrical, 8-spored, 130–200 × 5.1–8.3 Not breaking into secondary ascospores Wen et al. (2015)
Papiliomyces sinensis Clavate, solitary, gray to earthy yellow, 51.3–85.7 × 3.1–3.5 Not observed Not observed Not observed Not observed 10.1–26.9 × 0.9–3.3 Echinulate, globose, ellipsoidal or ovoid, 2.5–4.2 × 2.1–4.1 This study
Paraisaria arcta Solitary, 16 long Subglobose with constriction at center, white, 2 × 3 Completely immersed, ampulliform to ellipsoidal, 230–530 × 70–180 Narrowly cylindrical, 8-spored, 100–180 × 2–4 Cylindrical, 2.6–4.2 × 0.5–1.3 Wei et al. (2021)
Paraisaria pseudoarcta Solitary, 43–51 long Globose to subglobose with constriction at center, white to light brown, 4.6–4.8 × 4.8–4.9 Completely immersed, ampulliform to ellipsoidal, 776–979 × 252–339 Narrowly cylindrical, 8-spored, 306–379 × 3.5–6.2 Cylindrical, 5.6–8.3 × 1.7–3.1 Not observed Not observed This study

Discussion

Two new species, Papiliomyces sinensis (Ophiocordycipitaceae) and Paraisaria pseudoarcta (Clavicipitaceae), were discovered through our taxonomic investigation. Morphological observations revealed sufficient phenotypic differences to justify their classification as distinct taxa.

Within the genus Papiliomyces, Pap. sinensis was newly described and shown to form a well-supported clade closely related to Pap. albostromaticus, Pap. longiclavatus, Pap. puniceum, and Pap. shibinensis, based on a six-locus phylogeny. Although morphologically similar to these congeners, Pap. sinensis can be distinguished by its gray to earthy-yellow stromata (Chen et al. 2023; Zhang et al. 2023; Chen et al. 2024).

Notably, Pap. sinensis, like several related species, was collected from larvae of Hepialidae (Chen et al. 2024). The habitats of Hepialidae larvae—such as alpine meadows, shrublands, and forest soils—provide favorable ecological conditions for the growth of entomopathogenic fungi. By utilizing the resources and spatial niches offered by the larvae, these fungi have adapted to thrive within the Hepialidae larval environment, facilitating their reproduction and dispersal. At the same time, they exhibit distinct ecological niches and growth patterns. Although Metarhizium lymantriidae has not been reported to parasitize Hepialidae larvae specifically, Metarhizium lymantriidae belongs to the same entomopathogenic fungal group and is known to infect a wide range of insect larvae, suggesting a possible host association with Hepialidae as well.

We also expanded the species diversity of the genus Paraisaria by describing a new species, Par. pseudoarcta. The sexual morph of this species resembles that of Par. arcta, featuring an erect or somewhat flexuous, cylindrical, hyaline, fleshy stipe terminating in a subglobose to globose fertile head with perithecia fully immersed in the tissue. The cylindrical asci possess a thickened apical crown, and the hyaline, multiseptate ascospores typically disarticulate into numerous cylindrical, truncated part-spores upon maturity. Nonetheless, Par. pseudoarcta can be distinguished by features such as the color of the fertile head, the number of stromata, and its host association. Members of this genus typically infect various insect developmental stages, including adults of Dictyoptera, Hymenoptera (ants), and Orthoptera; nymphs of Hemiptera and Orthoptera; and larvae of Coleoptera, Diptera, and Lepidoptera (Evans et al. 2010; Sanjuan et al. 2015; Mongkolsamrit et al. 2019). Although variations in color—ranging from white, pale pink, and pale rufous to chestnut, cinnamon buff, and dark brown—morphological variation in fertile head shape remains minimal. Eight asexual morphs have been described in this genus; however, the asexual stage of Par. pseudoarcta was not obtained in this study. Phylogenetic analyses placed Par. pseudoarcta in close relation to Par. arcta, further supporting its status as a distinct species. The new species differs from Par. arcta by having longer stromata and larger secondary ascospores in its sexual morph. Therefore, we recognize Par. pseudoarcta as a novel species.

This study also resolves a long-standing taxonomic issue concerning the misclassification of Par. gracilis. The nomenclatural status of Par. gracilis has long been problematic due to taxonomic synonymy. Greville (1823) initially placed the species in the family Xylariaceae as Xylaria gracilis, and it was later formally described as Cordyceps gracilis by Durieu anf Montagne (1848), establishing the taxonomic foundation for Par. gracilis (Huang et al. 2019). Using molecular phylogenetic data, Sung et al. (2007a) reclassified two strains (EFCC 3101 and EFCC 8572) from C. gracilis to Ophiocordyceps gracilis. However, their O. gracilis diverged notably from the type species in host specificity, being isolated from coleopteran larvae rather than the lepidopteran hosts typical of Par. gracilis. Later, Mongkolsamrit et al. (2019) reassigned O. gracilis to Paraisaria within the Ophiocordycipitaceae. Quandt et al. (2014) included an additional strain, OSC 151906, in their phylogenetic reconstruction, which formed a separate clade from EFCC 3101 and EFCC 8572, suggesting the presence of an undescribed species—though no morphological comparison among these strains was made.

In our study, we collected specimens of Par. gracilis from the Altay region of Xinjiang and conducted detailed analyses. Morphological observations showed no significant differences from the teleomorphic and anamorphic characteristics previously reported by Samson and Brady (1983) and Gorbunova et al. (2011). Phylogenetic analysis placed our strain (GMBC 3066) in a distinct clade with OSC 151906, while EFCC 3101 and EFCC 8572 grouped with Par. phuwiangensis (Fig. 1). Despite topological inconsistencies in the single-locus trees (nrSSU, ITS, nrLSU, tef-1α, rpb1, and rpb2; Suppl. material 1: figs S1–S6), all datasets strongly supported species-level differentiation. Based on these results, we conclude that OSC 151906 and GMBC 3066 represent authentic Par. gracilis, while EFCC 3101 and EFCC 8572 warrant re-examination and comprehensive morphological redescription. Future research should also address unresolved nomenclatural and taxonomic ambiguities within this lineage.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This study was jointly supported by the National Natural Science Foundation of China under grants [32460004] and [32200013], the High Level Innovation Talents (No. GCC[2023]048), and the Guizhou Provincial Scientific and Technologic Innovation Base (No. [2023]003).

Author contributions

All authors have contributed equally.

Author ORCIDs

Xiangchun Shen https://orcid.org/0000-0002-4333-9106

Yao Wang https://orcid.org/0000-0002-1262-6700

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Araújo JPM, Evans HC, Kepler R, Hughes DP (2018) Zombie-ant fungi across continents: 15 new species and new combinations within Ophiocordyceps.I. Myrmecophilous hirsutelloid species. Studies in Mycology 90(1): 119–160. https://doi.org/10.1016/j.simyco.2017.12.002
  • Ban S, Sakane T, Nakagiri A (2015) Three new species of Ophiocordyceps and overview of anamorph types in the genus and the family Ophiocordyceptaceae. Mycological Progress 14(1): 1017. https://doi.org/10.1007/s11557-014-1017-8
  • Bischoff JF, Rehner SA, Humber RA (2009) A multilocus phylogeny of the Metarhizium anisopliae lineage. Mycologia 101(4): 512–530. https://doi.org/10.3852/07-202
  • Brunner-Mendoza C, Reyes-Montes MR, Moonjely S, Bidochka MJ, Toriello C (2019) A review on the genus Metarhizium as an entomopathogenic microbial biocontrol agent with emphasis on its use and utility in Mexico. Biocontrol Science and Technology 29(1): 83–102. https://doi.org/10.1080/09583157.2018.1531111
  • Castlebury LA, Rossman AY, Sung GH, Hyten AS, Spatafora JW (2004) Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycological Research 108(8): 864–872. https://doi.org/10.1017/S0953756204000607
  • Chen ZH, Zhang YG, Yang XN, Chen K, Liu Q, Xu L (2018) A new fungus Metarhizium gaoligongense from China. International Journal of Agriculture and Biology 20(10): 2271–2276.
  • Chen ZH, Dai YD, Chen K, Zhang YF, Xu L, Wang YB (2023) Papiliomyces puniceum and Metarhizium lymantriidae: Two new species from the Gaoligong Mountains in southwestern China. Phytotaxa 594(1): 53–63. https://doi.org/10.11646/phytotaxa.594.1.3
  • Chen Y, Sun T, Tang DX, Liu ZH, Ma ZM, Yu H (2024) Morphology and phylogeny reveal a new species of Papiliomyces (Clavicipiteae, Hypocreales) from Yunnan, China. Phytotaxa 644(2): 135–144. https://doi.org/10.11646/phytotaxa.644.2.5
  • Darriba D, Taboada GL, Doallo, Posada D (2012) jModelTest 2: Moremodels, new heuristics and parallel computing. Nature Methods 9(8): 772–772. https://doi.org/10.1038/nmeth.2109
  • Dong QY, Wang Y, Wang ZQ, Tang DX, Zhao ZY, Wu HJ, Yu H (2022) Morphology and phylogeny reveal five novel species in the genus Cordyceps (Cordycipitaceae, Hypocreales) from Yunnan, China. Frontiers in Microbiology 13(13): 846909. https://doi.org/10.3389/fmicb.2022.846909
  • Driver F, Milner RJ, Trueman JWH (2000) A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNA sequence data. Mycological Research 104(2): 134–150. https://doi.org/10.1017/S0953756299001756
  • Durieu JJ, Montagne C (1848) Sur la Cordyceps gracilis et autres espèces de ce genre. Annales des Sciences Naturelles, Series 3, 10(1): 1–50.
  • Evans HC, Groden E, Bischoff JF (2010) New fungal pathogens of the red ant, Myrmica rubra, from the UK and implications for ant invasions in the USA. Fungal Biology 114(5–6): 451–466. https://doi.org/10.1016/j.funbio.2010.03.007
  • Gisbert Z (1993) The entornopathogenic fungus Metarhizium anisopliae and its potential as a biocontrol agent. Pesticide Science 37(4): 375–379. https://doi.org/10.1002/ps.2780370410
  • Gorbunova IA, Kryukov VY, Zibzeev EG (2011) First records of the entomopathogenic fungus Ophiocordyceps gracilis (Ascomycota, Hypocreales) from Siberia. Euroasian Entomological Journal 10(1): 17–18 + 22 + I.
  • Greville KR (1823) Scottish cryptogamic flora. 2: 82–83.
  • Huzefa AR, Andrew NM, Cedric JP, Nicholas H (2017) Fungal identification using molecular tools: A primer for the natural products research community. Journal of Natural Products 80(3): 756–770. https://doi.org/10.1021/acs.jnatprod.6b01085
  • Iwasaki H, Tokiwa T, Shiina M, Asami Y, Shiomi K, Ōmura S, Nonaka K (2019) Metarhizium aciculare sp. nov. for euvesperins A and B producing metarhizium strains. Mycoscience 60(6): 313–318. https://doi.org/10.1016/j.myc.2019.06.005
  • Johannes ZG, Marizeth G, Pedro WC (2011) Impact of DNA data on fungal and yeast taxonomy. Microbiology Australia 32(2): 100–104. https://doi.org/10.1071/MA11100
  • Johnson D, Sung GH, Hywel-Jones NL, Luangsa-Ard JJ, Bischoff JF, Kepler RM, Spatafora JW (2009) Systematics and evolution of the genus Torrubiella (Hypocreales, Ascomycota). Mycological Research 113(3): 279–289. https://doi.org/10.1016/j.mycres.2008.09.008
  • Kepler RM, Kaitsu Y, Tanaka E, Shimano S, Spatafora JW (2011) Ophiocordyceps pulvinate sp. nov., a pathogen of ants with a reduced stroma. Mycoscience 52: 39–47. https://doi.org/10.1007/s10267-010-0072-5
  • Kepler RM, Sung GH, Ban S, Nakagiri A, Chen MJ, Huang B, Li Z, Spatafora JW (2012a) New teleomorph combinations in the entomopathogenic genus Metacordyceps. Mycologia 104(1): 182–197. https://doi.org/10.3852/11-070
  • Kepler RM, Sung GH, Harada Y, Tanaka K, Tanaka E, Hosoya T, Bischoff JF, Spatafora JW (2012b) Host jumping onto close relatives and across kingdoms by Tyrannicordyceps (Clavicipitaceae) gen. nov. and Ustilaginoidea (Clavicipitaceae). American Journal of Botany 99(3): 552–561. https://doi.org/10.3732/ajb.1100124
  • Kepler RM, Humber RA, Bischoff JF, Rehner SA (2014) Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics. Mycologia 106(4): 811–829. https://doi.org/10.3852/13-319
  • Khonsanit A, Luangsa-ard JJ, Thanakitpipattana D, Kobmoo N, Piasai O (2018) Cryptic species within Ophiocordyceps myrmecophila complex on formicine ants from Thailand. Mycological Progress 18(1–2): 147–161. https://doi.org/10.1007/s11557-018-1412-7
  • Kobayasi Y (1941) The genus Cordyceps and its allies. Scientific Reports 84: 53–260.
  • Kobayasi Y (1982) Keys to the taxa of the genera Cordyceps and Tor rubiella. Nippon Kingakkai Kaiho 23: 329–364.
  • Luangsa-ard JJ, Hywel-Jones NL, Manoch L, Samson RA (2005) On the relationships of Paecilomyces sect. Isarioidea species. Mycological Research 109(5): 581–589. https://doi.org/10.1017/S0953756205002741
  • Luangsa-ard JJ, Mongkolsamrit S, Thanakitpipattana D, Khonsanit A, Tasanathai K, Noisripoom W, Humber RA (2017) Clavicipitaceous entomopathogens: New species in Metarhizium and a new genus Nigelia. Mycological Progress 16(4): 369–391. https://doi.org/10.1007/s11557-017-1277-1
  • Luangsa-ard JJ, Tasanathai K, Thanakitpipattana D, Khonsanit A, Stadler M (2018) Novel and interesting Ophiocordyceps spp. (Ophiocordycipitaceae, Hypocreales) with superficial perithecia from Thailand. Studies in Mycology 89: 125–142. https://doi.org/10.1016/j.simyco.2018.02.001
  • Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Von Haeseler A, Lanfear R (2020) IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37(5): 1530–1534. https://doi.org/10.1093/molbev/msaa015
  • Mongkolsamrit S, Noisripoom W, Arnamnart N, Lamlertthon S, Himaman W, Jangsantear P, Samson RA, Luangsa-ard JJ (2019) Resurrection of Paraisaria in the Ophiocordycipitaceae with three new species from Thailand. Mycological Progress 18(9): 1213–1230. https://doi.org/10.1007/s11557-019-01518-x
  • Mongkolsamrit S, Khonsanit A, Thanakitpipattana D, Tasanathai K, Luangsa-Ard J (2020) Revisiting Metarhizium and the description of new species from Thailand. Studies in Mycology 95: 171–251. https://doi.org/10.1016/j.simyco.2020.04.001
  • Montalva C, Silva JJ, Rocha LFN, Luz C, Humber RA (2019) Characterization of Tolypocladium cylindrosporum (Hypocreales, Ophiocordycipitaceae) isolates from Brazil and their efficacy against Aedes aegypti (Diptera, Culicidae). Journal of Applied Microbiology 126(1): 266–276. https://doi.org/10.1111/jam.14093
  • Nonaka K, Ōmura S, Masuma R, Kaifuchi S, Masuma R (2013) Three new Pochonia taxa (Clavicipitaceae) from soils in Japan. Mycologia 105(5): 1202–1218. https://doi.org/10.3852/12-132
  • Quandt CA, Kepler RM, Gams W, Araújo JP, Ban S, Evans HC, Hughes D, Humber R, Hywel-Jones N, Li Z, Luangsa-Ard JJ, Rehner SA, Sanjuan T, Sato H, Shrestha B, Sung GH, Yao YJ, Zare R, Spatafora JW (2014) Phylogenetic-based nomenclatural proposals for Ophiocordycipitaceae (Hypocreales) with new combinations in Tolypocladium. IMA Fungus 5(1): 121–134. https://doi.org/10.5598/imafungus.2014.05.01.12
  • Rehner SA, Minnis AM, Sung GH, Luangsa-ard JJ, Devotto L, Humber RA (2011) Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia 103(5): 1055–1073. https://doi.org/10.3852/10-302
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Rossman AY, Samuels GJ, Rogerson CT, Lowen R (1999) Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes). Studies in Mycology 42(42): 1–248.
  • Sanjuan TI, Franco-Molano AE, Kepler RM, Spatafora JW, Tabima J, Vasco-Palacios AM (2015) Five new species of entomopathogenic fungi from the Amazon and evolution of Neotropical Ophiocordyceps. Fungal Biology 119(10): 901–916. https://doi.org/10.1016/j.funbio.2015.06.010
  • Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W, Crous PW, Boekhout T, Damm U, de Hoog GS, Eberhardt U, Groenewald JZ, Groenewald M, Hagen F, Houbraken J, Quaedvlieg W, Stielow B, Vu TD, Walther G (2012) Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the United States of America 109(16): 6241–6246. https://doi.org/10.1073/pnas.1117018109
  • Shrestha B, Tanaka E, Hyun MW, Han JG, Kim CS, Jo JW, Han SK, Oh J, Sung GH (2016) Coleopteran and Lepidopteran Hosts of the Entomopathogenic Genus Cordyceps sensu lato. Journal of Mycology 14: 7648219. https://doi.org/10.1155/2016/7648219
  • Spatafora JW, Sung GH, Sung JM, Hywel-Jones NL, White Jr JF (2007) Phylogenetic evidence for an animal pathogen origin of ergot and the grass endophytes. Molecular Ecology 16(8): 1701–1711. https://doi.org/10.1111/j.1365-294X.2007.03225.x
  • Spatafora JW, Quandt CA, Kepler RM, Sung GH, Shrestha B, Hywel Jones NL, Luangsa-ard JJ (2015) New 1F1N species combinations in Ophiocordycipitaceae (Hypocreales). IMA Fungus 6(2): 357–362. https://doi.org/10.5598/imafungus.2015.06.02.07
  • Sun T, Zou WQ, Dong QY, Huang O, Tang DX, Yu H (2022) Morphology, phylogeny, mitogenomics and metagenomics reveal a new entomopathogenic fungus Ophiocordyceps nujiangensis (Hypocreales, Ophiocordycipitaceae) from Southwestern China. MycoKeys 94: 91–108. https://doi.org/10.3897/mycokeys.94.89425
  • Sung GH, Spatafora JW, Zare R, Gams W (2001) A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72(3–4): 311–328. https://doi.org/10.1127/nova.hedwigia/72/2001/311
  • Sung GH, Hywel-Jones NL, Sung JM, Luangsa-ard JJ, Shrestha B, Spatafora JW (2007a) Phylogenetic classification of cordyceps and the clavicipitaceous fungi. Studies in Mycology 57(1): 5–59. https://doi.org/10.3114/sim.2007.57.01
  • Sung GH, Sung JM, Hywel-Jones NL, Spatafora JW (2007b) A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Molecular Phylogenetics and Evolution 44(3): 1204–1223. https://doi.org/10.1016/j.ympev.2007.03.011
  • Tamura K, Stecher G, Peterson D, Filipski A, Nei M, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Tehan RM, Dooley CB, Barge EG, McPhail KL, Spatafora JW (2023) New species and new combinations in the genus Paraisaria (Hypocreales, Ophiocordycipitaceae) from the U.S.A, supported by polyphasic analysis. MycoKeys 100: 69–94. https://doi.org/10.3897/mycokeys.100.110959
  • Tsang CC, Chan JFW, Pong WM, Chen JHK, Ngan AHY, Cheung M, Lai CKC, Tsang DNC, Lau SKP, Woo PCY (2016) Cutaneous hyalohyphomycosis due to Parengyodontium album gen. et comb. Journal of Medical Mycology 54(7): 699–713. https://doi.org/10.1093/mmy/myw025
  • Vu D, Groenewald M, de Vries M, Gehrmann T, Stielow B, Eberhardt U, Al-Hatmi A, Groenewald JZ, Cardinali G, Houbraken J, Boekhout T, Crous PW, Robert V, Verkley GJM (2019) Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation. Studies in Mycology 92(1): 135–154. https://doi.org/10.1016/j.simyco.2018.05.001
  • Wang YB, Yu H, Dai YD, Chen ZH, Zeng WB, Yuan F, Liang ZQ (2015) Polycephalomyces yunnanensis (Hypocreales), a new species of Polycephalomyces parasitizing ophiocordyceps nutans and stink bugs (hemipteran adults). Phytotaxa 208(1): 34–44. https://doi.org/10.11646/phytotaxa.208.1.3
  • Wang M, Carver JJ, Phelan VV, Sanchez LM, Garg N, Peng Y, Nguyen DD, Watrous J, Kapono CA, Luzzatto-Knaan T, Porto C, Bouslimani A, Melnik AV, Meehan MJ, Liu WT, Crüsemann M, Boudreau PD, Esquenazi E, Sandoval-Calderón M, Kersten RD, Pace LA, Quinn RA, Duncan KR, Hsu C-C, Floros DJ, Gavilan RG, Kleigrewe K, Northen T, Dutton RJ, Parrot D, Carlson EE, Aigle B, Michelsen CF, Jelsbak L, Sohlenkamp C, Pevzner P, Edlund A, McLean J, Piel J, Murphy BT, Gerwick L, Liaw CC, Yang YL, Humpf HU, Maansson M, Keyzers RA, Sims AC, Johnson AR, Sidebottom AM, Sedio BE, Klitgaard A, Larson CB, Boya PCA, Torres-Mendoza D, Gonzalez DJ, Silva DB, Marques LM, Demarque DP, Pociute E, O’Neill EC, Briand E, Helfrich EJN, Granatosky EA, Glukhov E, Ryffel F, Houson H, Mohimani H, Kharbush JJ, Zeng Y, Vorholt JA, Kurita KL, Charusanti P, McPhail KL, Nielsen KF, Vuong L, Elfeki M, Traxler MF, Engene N, Koyama N, Vining OB, Baric R, Silva RR, Mascuch SJ, Tomasi S, Jenkins S, Macherla V, Hoffman T, Agarwal V, Williams PG, Dai J, Neupane R, Gurr J, Rodríguez AMC, Lamsa A, Zhang C, Dorrestein K, Duggan BM, Almaliti J, Allard PM, Phapale P, Nothias LF, Alexandrov T, Litaudon M, Wolfender JL, Kyle JE, Metz TO, Peryea T, Nguyen DT, VanLeer D, Shinn P, Jadhav A, Müller R, Waters KM, Shi W, Liu X, Zhang L, Knight R, Jensen PR, Palsson BO, Pogliano K, Linington RG, Gutiérrez M, Lopes NP, Gerwick WH, Moore BS, Dorrestein PC, Bandeira N (2016) Sharing and community curation of mass spectrometry data with Global Natural Products Social Molecular Networking. Nature Biotechnology 34(8): 828–837. https://doi.org/10.1038/nbt.3597
  • Wang YB, Wang Y, Fan Q, Duan DE, Zhang GD, Dai RQ, Dai YD, Zeng WB, Chen ZH, Li DD, Tang DX, Xu ZH, Sun T, Nguyen TT, Tran NL, Dao VM, Zhang CM, Huang LD, Liu YJ, Zhang XM, Yang DR, Sanjuan T, Liu XZ, Yang ZL, Yu H (2020) Multigene phylogeny of the family Cordycipitaceae (Hypocreales): New taxa and the new systematic position of the Chinese cordycipitoid fungus Paecilomyces hepiali. Fungal Diversity 103(1): 1–46. https://doi.org/10.1007/s13225-020-00457-3
  • Wang Y, Dai YD, Yang ZL, Guo R, Yu H (2021) Morphological and molecular phylogenetic data of the Chinese medicinal fungus Cordyceps liangshanensis reveal its new systematic position in the family Ophiocordycipitaceae. Mycobiology 49(4): 297–307. https://doi.org/10.1080/12298093.2021.1923388
  • Wang Y, Wang ZQ, Thanarut C, Dao VM, Wang YB, Yu H (2023) Phylogeny and species delimitations in the economically, medically, and ecologically important genus Samsoniella (Cordycipitaceae, Hypocreales). MycoKeys 99: 227–250. https://doi.org/10.3897/mycokeys.99.106474
  • Wei DP, Wanasinghe DN, Xu JC, To-Anun C, Mortimer PE, Hyde KD, Elgorban AM, Madawala S, Suwannarach N, Karunarathna SC, Tibpromma S, Lumyong S (2021) Three novel entomopathogenic fungi from China and Thailand. Frontiers in Microbiology 11: 608991. https://doi.org/10.3389/fmicb.2020.608991
  • Weiser J, Matha V, Jegorov A (1991) Tolypocladium terricola sp. N., a new mosquito-killing species of the genus Tolypocladium Gams (Hyphomycetes). Folia Parasitologica 38(4): 363–369.
  • Wen TC, Zha LS, Xiao YP, Wang Q, Kang JC, Hyde KD (2015) Metacordyceps shibinense sp. nov. from larvae of Lepidoptera in Guizhou Province, southwest China. Phytotaxa 226(1): 51–62. https://doi.org/10.11646/phytotaxa.226.1.5
  • Wen TC, Xiao YP, Han YF, Huang SK, Zha LS, Hyde KD, Kang JC (2017) Multigene phylogeny and morphology reveal that the Chinese medicinal mushroom ‘Cordyceps gunnii’ is Metacordyceps neogunnii sp. nov. Phytotaxa 302(1): 27–39. https://doi.org/10.11646/phytotaxa.302.1.2
  • Xiao YP, Wang YB, Hyde KD, Eleni G, Sun JZ, Yang Y, Meng J, Yu H, Wen TC (2023) Polycephalomycetaceae, a new family of clavicipitoid fungi segregates from Ophiocordycipitaceae. Fungal Diversity 120(1): 1–76. https://doi.org/10.1007/s13225-023-00517-4
  • Yu Y, Hou SY, Sun ZL, Zhang MY, Zhang TY, Zhang YX (2018) Drechmeria panacis sp. nov., an endophyte isolated from Panax notoginseng. International Journal of Systematic and Evolutionary Microbiology 68(10): 3255–3259. https://doi.org/10.1099/ijsem.0.002971
  • Zhang Y, Wen T, Xiao Y, Yang Y, Peng X (2023) A new species of Papiliomyces (Clavicipiteae, Hypocreales) from China. Biodiversity Data Journal 11: e86868. https://doi.org/10.3897/BDJ.11.e8686

Supplementary material

Supplementary material 1 

Additional information

Hui Chen, Shabana Bibi, Ling Tao, Xiangchun Shen, Jun Zhao, Yueming Sun, Qirui Li, Dexiang Tang, Yao Wang

Data type: docx

Explanation note: fig. S1. Phylogenetic tree based on Maximum Likelihood (IQ-TREE) analysis from the nr SSU sequences. Statistical support values (≥70%) are shown at the nodes for ML boostrap support. Isolates in bold type are those analyzed in this stud. fig. S2. Phylogenetic tree based on Maximum Likelihood (IQ-TREE) analysis from the ITS sequences. Statistical support values (≥70%) are shown at the nodes for ML boostrap support. Isolates in bold type are those analyzed in this stud. fig. S3. Phylogenetic tree of based on Maximum Likelihood (IQ-TREE) analysis from the nr LSU sequences. Statistical support values (≥70%) are shown at the nodes for ML boostrap support. Isolates in bold type are those analyzed in this study. fig. S4. Phylogenetic tree based on Maximum Likelihood (IQ-TREE) analysis from the TEF sequences. Statistical support values (≥70%) are shown at the nodes for ML boostrap support. Isolates in bold type are those analyzed in this stud. fig. S5. Phylogenetic tree based on Maximum Likelihood (IQ-TREE) analysis from the RPB1 sequences. Statistical support values (≥70%) are shown at the nodes for ML boostrap support. Isolates in bold type are those analyzed in this study. fig. S6. Phylogenetic tree based on Maximum Likelihood (IQ-TREE) analysis from the RPB2 sequences. Statistical support values (≥70%) are shown at the nodes for ML boostrap support. Isolates in bold type are those analyzed in this study.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (2.06 MB)
login to comment