Research Article
Print
Research Article
Morphological and phylogenetic analyses reveal new species and records of Fusarium (Nectriaceae, Hypocreales) from China
expand article infoCongcong Ai‡, Qiyun Liu‡, Yaling Wang‡, Zhaoxue Zhang‡, Duhua Li‡, Yun Geng§, Xiuguo Zhang‡, Jiwen Xia‡|
‡ Shandong Agricultural University, Taian, China
§ Institute of Crop Germplasm Resources, Shandong Academy of Agricultural Sciences, Jinan, China
| Linyi University, Linyi, China

Corresponding author: Qiyun Liu ( liuqiyun0416@163.com )

Corresponding author: Jiwen Xia ( xiajiwen1@126.com )

Academic editor: Xin-Cun Wang
© 2025 Congcong Ai, Qiyun Liu, Yaling Wang, Zhaoxue Zhang, Duhua Li, Yun Geng, Xiuguo Zhang, Jiwen Xia.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Ai C, Liu Q, Wang Y, Zhang Z, Li D, Geng Y, Zhang X, Xia J (2025) Morphological and phylogenetic analyses reveal new species and records of Fusarium (Nectriaceae, Hypocreales) from China. MycoKeys 116: 53-71. https://doi.org/10.3897/mycokeys.116.150363
Open Access

Abstract

Species of Fusarium are important phytopathogens, saprobes, and endophytes around the world. Some species can affect plant health and cause yield loss of economic plants. Fusarium species are widely distributed in China, and many species were found from different plant hosts. The Fusarium incarnatum-equiseti species complex (FIESC) is one of the most significant species complexes within the genus. Based on morphological and three-gene (cal, rpb2, and tef1) phylogenetic analyses, two new species are in the Incarnatum clade, and two new host records are identified and described, viz. Fusarium fici sp. nov., Fusarium xylosmatis sp. nov., Fusarium fecundum, and Fusarium weifangense.

Key words:

Fusarium incarnatum-equiseti species complex, multigene phylogeny, new taxa

Introduction

Johann Heinrich Friedrich Link first proposed the genus Fusarium (Nectriaceae, Hypocreales) in 1809 and typified it with Fusarium roseum (= F. sambucinum), with falcate or banana-shaped macroconidia and oval, subglobose, or kidney-shaped microconidia (Link 1809; Gams et al. 1997; Leslie and Summerell 2006; Liu et al. 2023; Zhang et al. 2023a). Fusarium is one of the most renowned and extensively spread genera in the Kingdom Fungi because of its morphological and phylogenetic diversity (Leslie and Summerell 2006; Sandoval-Denis et al. 2018; Crous et al. 2021). Fusarium species are known as plant pathogens, endophytes, and saprophytes (Leslie et al. 1990; Bacon and Yates 2006; Maryani et al. 2019; He et al. 2024). More than 1800 epithets of Fusarium have been listed in Index Fungorum (https://www.indexfungorum.org), but many species of Fusarium were identified solely based on morphological studies. Excessive overlap of conidial characteristics makes it difficult to morphologically distinguish Fusarium species. Currently, Fusarium taxonomy is dominated by morphological and molecular phylogenetic studies (Crous et al. 2021; He et al. 2024).

At present, Fusarium contains 23 monophyletic species complexes and several single-species lineages (Xia et al. 2019; O’Donnell et al. 2020; Geiser et al. 2021; He et al. 2024). The FIESC includes over 30 recognized phylogenetic species (O’Donnell et al. 2009; Villani et al. 2016; Maryani et al. 2019; Santos et al. 2019; Wang et al. 2019; Xia et al. 2019). Based on the haplotype nomenclature system, O’Donnell et al. (2009) implemented an informal classification system for FIESC and introduced the Equiseti and Incarnatum clades. The Fusarium camptoceras species complex (FCAMSC) was proposed for three lineages that are sister clades to the FIESC by phylogenetic studies by Xia et al. (2019). However, Han et al. (2023) included the FCAMSC in FIESC as the Camptoceras clade because the FCAMSC and FIESC clearly represent a distinct evolutionary lineage that is strongly supported by the phylogenomic tree. Thus, FIESC comprises three clades, viz. Camptoceras, Equiseti, and Incarnatum clades.

In this study, samples were collected from Hainan, Sichuan, and Yunnan Provinces of China. Two new species and two new host records were identified and classified by multi-locus analysis of calmodulin (cal), RNA polymerase II second largest subunit (rpb2), and translations elongation factor 1-alpha (tef1) datasets. They were described and discussed based on their morphological characteristics along with their molecular sequence data.

Materials and methods

Strain isolation and preservation

Plant specimens with necrotic spots were collected from three provinces (Hainan, Sichuan, and Yunnan) of China in 2023. Pure colonies were obtained by tissue isolation techniques (Zhang et al. 2024). Fragments (25 mm2) were cut from the edges of diseased tissues, immersed in a 75% ethanol solution for 1 min, then rinsed in sterile water for 30 s and 10% sodium hypochlorite solution for 1 min. Fragments were rinsed three times with sterile water for 30 s, then using sterilized filter paper to absorb dry, placed on PDA for incubation at 25 °C for 3 days. The strains were preserved in 10% sterilized glycerol and stored them at 4 °C for future detailed studies. Specimens were deposited in the Herbarium of the Department of Plant Pathology, Shandong Agricultural University, Taian, China (HSAUP), and the Herbarium Mycologicum Academiae Sinicae, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China (HMAS). The living ex-type cultures were deposited in the Shandong Agricultural University Culture Collection (SAUCC) and the China General Microbiological Culture Collection Center (CGMCC).

DNA extraction, amplification, and sequencing

Total genomic DNA was extracted from fresh fungal mycelia grown on potato dextrose agar (PDA) after 7 days using the genomic DNA purification kit (OGPLF-400, GeneOnBio Corporation, Changchun, China) according to the product manual. The calmodulin (cal), RNA polymerase second largest subunit (rpb2), and translation elongation factor 1-alpha (tef1) gene loci were amplified using the primer pairs listed in Table 1 (Xia et al. 2019; Han et al. 2023). The reaction was performed in a 25 μL reaction volume, consisting of 12.5 μL of 2 × Hieff Canace® Plus PCR Master Mix (Cat. No. 10154ES03, Yeasen Biotechnology, Shanghai, China), 1 μL each of forward and reverse primer (TsingKe, Qingdao, China), and 1 μL of template genomic DNA, and at last replenished the total volume to 25 µL with double distilled water. PCR products were separated and purified using 1% agarose gel and Safe Red (RM02852 and RM19009 ABclonal, Wuhan, China) and UV light to visualize the fragments. Gel was extracted using a gel extraction kit (Cat. No. AE0101-C, Shandong Sparkjade Biotechnology Co., Ltd., Jinan, China) (Wang et al. 2023). The purified PCR products were sequenced by Youkang Company Limited (Zhejiang, China). All sequences generated in this study were deposited in GenBank under the accession numbers provided in Suppl. material 1.

Table 1.
Download as
CSV
XLSX

Molecular markers and their PCR primers and programs used in this study.

Loci PCR Primers Sequence (5′→3′) PCR Cycles References
cal CL1 GARTWCAAGGAGGCCTTCTC (94 °C: 30 s, 55 °C: 30 s, 72 °C: 15 s) × 35 cycles O’Donnell et al. (2020)
CL2A TTTTTGCATCATGAGTTGGAC
rpb2 5f2 GGGGWGAYCAGAAGAAGGC (94 °C: 45 s, 57 °C: 45 s, 72 °C: 15 s) × 35 cycles Liu et al. (1999)
7cr CCCATRGCTTGYTTRCCCAT
tef1 EF-1 ATGGGTAAGGARGACAAGAC (94 °C: 45 s, 55 °C: 45 s, 72 °C: 15 s) × 35 cycles O’Donnell et al. (1998)
EF-2 GGARGTACCAGTSATCATG

Phylogenetic analyses

The reference sequences were downloaded from NCBI’s GenBank. All sequences were initially aligned with the MAFFT v. 7 (http://mafft.cbrc.jp/alignment/server/) online service and MEGA 7.0. The concatenated aligned cal, rpb2, and tef1 sequences were used for maximum likelihood (ML) and Bayesian inference (BI), which were run on RaxML-HPC2 with XSEDE v. 8.2.12 and MrBayes v. 3.2.7a with 64 threads on Linux (Zhang et al. 2024). For ML analyses, 100 rapid bootstrap replicates and the GTR+FO+I+G4m model as default parameters were used. For BI analyses, a fast bootstrap algorithm with an automatic stop option was performed (Zhang et al. 2023b). The SYM+G model for cal, the SYM+I+G model for rpb2, and the GTR+I+G model for tef1 were selected and incorporated into the analyses. The Markov chain Monte Carlo (MCMC) analysis of the sequence data was performed over 5,000,000 generations, yielding 34,652 trees. Following the discard of 8,663 trees during the burn-in phase, the remaining trees were used to calculate posterior probabilities in the consensus trees.

Morphological characterization

All isolates were inoculated on potato dextrose agar (PDA) medium and oatmeal agar (OA) medium. Colony morphology, pigmentation, and growth rates were recorded. The above and reverse of the PDA and OA flat plates were captured with the Alpha 6400L digital camera (Canon Powershot G7X, Canon, Tokyo, Japan) on the 7th day. Used Carnation leaf agar (CLA; Fisher et al. 1982) medium to describe morphological features, such as shape, size, and septum number of the conidia (Wang et al. 2019). Used a stereomicroscope (Olympus SZ61, Olympus Corporation, Tokyo, Japan) and a microscope (Olympus BX53, Olympus Corporation, Tokyo, Japan) with Differential Interference Contrast (DIC) to observe the microscopic morphology. Stereomicroscope and microscope were equipped with BioHD-A20c color digital cameras (FluoCa Scientific, Shanghai, China) to capture the microscopic fungal structures. Microstructures were randomly measured using Digimizer software v5.6.0 (https://www.digimizer.com, accessed on 18 November 2024) and calculated the mean size (av.). The “n” represents the number of measurements.

Results

Phylogenetic analyses

The combined dataset comprised 133 ingroup strains with Fusarium concolor (NRRL 13459) as the outgroup. The final alignment comprised 1,654 concatenated characters, spanning from positions 1 to 535 (cal), 536 to 1,192 (rpb2), and 1,193 to 1,654 (tef1). The ML was carried out to be -9,907.383240. MrModelTest recommended using Dirichlet base frequencies for the cal, rpb2, and tef1 data partitions. The alignment showed a total of 563 unique site patterns (cal: 156, rpb2: 168, tef1: 239). Based on the three-gene (cal, rpb2, and tef1) phylogeny, the 134 strains were classified into 57 species. The topology of the ML tree confirmed the topology obtained from BI, with only the ML tree presented (Fig. 1). Furthermore, single gene trees were evaluated, respectively, for FIESC (Suppl. material 2).

Figure 1. 

Phylogeny inferred based on the combined cal-rpb2-tef1 sequence dataset of the Fusarium incarnatum-equiseti species complex (FIESC), with Fusarium concolor (NRRL 13459) as the outgroup. The RAxML Bootstrap support values (MLBS ≥ 70%) and Bayesian posterior probabilities (BIPP ≥ 0.90) were shown at the nodes. Ex-type, ex-epitype, and ex-neotype strains were indicated by T, ET, and NT, respectively. Strains isolated in this study were indicated in red.

Taxonomy

Fusarium fecundum S.L. Han, M.M. Wang & L. Cai, Studies in Mycology 104: 87–148. 2023.

Fig. 2

Description.

On CLA, conidiophores arising from aerial mycelia, 13–71 μm long, unbranched or irregularly branched, bearing terminal or lateral phialides, often reduced to single phialides; Periclinal thickening inconspicuous; Aerial conidia hyaline, smooth, rarely ovoid to falcate, on the apical half, the dorsal side is more curved than the ventral side, and the apical cell is either blunt or hooked, basal cell barely to distinctly notched. 1-septate conidia: (16–)22–21(–27) × 4–6 μm (av. 20 × 5 μm, n = 9); 2-septate conidia: (18–)21–28(–33) × 5–7 μm (av. 26 × 6 μm, n = 9); 3-septate conidia: (32–)33–36(–41) × 5–8 μm (av. 35 × 7 μm, n = 16); 4-septate conidia: (32–)37–43(–43) × 6–9 μm (av. 39 × 7 μm, n = 18); 5-septate conidia: (41–)43–48(–53) × 7–9 μm (av. 46 × 8 μm, n = 12).

Figure 2. 

Fusarium fecundum (SAUCC 2414-4) a colony on PDA after 7 days at 25 °C (left: above, right: reverse) b colony on OA after 7 days at 25 °C (left: above, right: reverse) c, d conidiophore on aerial mycelium with monophialides e aerial conidia. Scale bars: 10 μm (c–e).

Culture characteristics.

Colonies on PDA incubated at 25 °C in the dark, reaching 84–90 mm diameter in 7 d; aerial mycelia dense, white, radiate, colony margin erose; reverse surface greyish yellow in the center, odor absent. On OA in the dark, occupying an entire 90 mm diameter in 7 d; surface white and aerial mycelia scant, crateriform, reverse white, odor absent.

Materials examined.

China • Yunan Province, Nanuo Mountain, on leaves of Setaria palmifolia, 3 March 2023, Q.Y. Liu (HSAUP41424, HSAUP51424), living cultures CGMCC 3.27792 = SAUCC 2414-4, CGMCC 3.27793 = SAUCC 2414-5.

Notes.

Phylogenetic analysis showed that isolates (SAUCC 2414-4 and SAUCC 2414-5) were closely related to Fusarium fecundum (LC15875, ex-type strain) (Fig. 1). There are no nucleotide position differences between Fusarium fecundum (SAUCC 2414-4) and Fusarium fecundum (LC15875, ex-type strain). Morphologically, Fusarium fecundum (SAUCC 2414-4) and Fusarium fecundum (LC15875, ex-type strain) are the lack of sporodochia. The aerial conidia of Fusarium fecundum (SAUCC 2414-4) are smaller than those of Fusarium fecundum (LC15875, ex-type strain). Fusarium fecundum was previously isolated from wheat and rice, and it has now been reported for the first time on Setaria palmifolia (Han et al. 2023).

Fusarium fici Q.Y. Liu, X.G. Zhang & J.W. Xia, sp. nov.

MycoBank No: MycoBank No: 856644
Fig. 3

Etymology.

Referring to the genus name of the host plant Ficus fistulosa.

Typus.

China • Hainan Province, Baoting Li and Miao Autonomous County, on leaves of Ficus fistulosa, 10 April 2023, Q.Y. Liu (HMAS 353395, holotype), ex-holotype culture CGMCC 3.27796 = SAUCC 3249C-3.

Description.

Conidiophores arising from aerial mycelium, 17–21 μm long, unbranched, reduced to single phialidic pegs, subulate to subcylindrical; aerial conidia hyaline, smooth, and thin-walled, rarely ellipsoidal to falcate, straight to curved dorsiventrally, a blunt apical cell and barely notched basal cell, 1–3(–5)-septate; 1-septate conidia: (12–)12–16(–28) × 3–5 μm (av. 17 × 3 μm, n = 18); 2-septate conidia: (16–)17–21 (–26) × 3–5 μm (av. 19 × 4 μm, n = 17); 3-septate conidia: (20–)22–28 (–36) × 3–6 μm (av. 26 × 4 μm, n = 31); 4-septate conidia: (28–)31–34 (–39) × 4–5 μm (av. 33 × 5 μm, n = 14); 5-septate conidia: (23–)32–33 (–36) × 4–5 μm (av. 31 × 4 μm, n = 5). Sporodochia salmon to saffron, formed abundantly on surface of carnation leaves. Sporodochial conidiophores densely and bearing apical whorls of 1 phialide; sporodochial phialides subulate to subcylindrical, 9–11 × 3–4 μm, smooth, thin-walled, with inconspicuous periclinal thickening; sporodochial conidia falcate, straight to curved dorsiventrally, tapering towards both ends, with slightly papillate, a conical to slightly papillate apical cell, a notched to foot-like basal cell, (0–)1–3(–5)-septate, hyaline, smooth, and thin-walled; 0-septate conidia: (10–)15–20(–21) × 2–4 μm (av. 16 × 3 μm, n = 9); 1-septate conidia: (13–)15–22(–25) × 2–5 μm (av. 18 × 4 μm, n = 23); 2-septate conidia: (13–)16–18(–23) × 2–5 μm (av. 18 × 3 μm, n = 23); 3-septate conidia: (19–)20–25(–29) × 3–5 μm (av. 24 × 4 μm, n = 37); 4-septate conidia: (28–)31–34(–36) × 4–5 μm (av. 33 × 4 μm, n = 12); 5-septate conidia: (34–)34–36(–38) × 3–5 μm (av. 35 × 4 μm, n = 5). Chlamydospores not observed.

Figure 3. 

Fusarium fici (CGMCC 3.27796) a colony on PDA after 7 days at 25 °C (left: above, right: reverse) b colony on OA after 7 days at 25 °C (left: above, right: reverse) c sporodochia on carnation leaves d lateral phialidic peg on aerial mycelium e monophialide f, g sporodochial conidiophores h, i monophialides on aerial mycelium j sporodochial conidia k aerial conidia. Scale bars: 10 μm (d–k).

Culture characteristics.

Colonies on PDA incubated at 25 °C in the dark, reaching 76–80 mm diameter in 7 d, flat, convex, with abundant aerial mycelium, colony margin lightly erose; surface white, odor absent; reverse yellowish white, odor absent. On OA in the dark, reaching 85–90 mm diameter in 7 d; aerial mycelium scant in the center forming a vacant circle, reverse white, odor absent.

Additional material studied.

China • Hainan Province, Baoting Li and Miao Autonomous County, on leaves of Ficus fistulosa, 10 April 2023, Q.Y. Liu (HSAUP44932), living culture CGMCC 3.27797 = SAUCC 3249C-4.

Notes.

Phylogenetic analyses of three combined sequences (cal, rpb2, and tef1) showed that F. fici constitutes a distinct clade, closely related to F. aberrans. Between F. fici (CGMCC 3.27796) and F. aberrans (CBS 131385), there were 11/535 differences in cal, 13/657 in rpb2, and 34/462 in tef1. The mycelium on OA of F. fici (CGMCC 3.27796) is sparser than that of F. aberrans (CBS 131385). Morphologically, F. fici (CGMCC 3.27796) and F. aberrans (CBS 131385) have different sporodochial conidial septa (0–5-septate in F. fici vs. 1–3-septate in F. aberrans) and sporodochial phialides (1 phialide in F. fici vs. 2–3 phialides in F. aberrans). The aerial conidiophores of F. aberrans (16–110 μm) are longer than F. fici (17–21 μm) (Xia et al. 2019).

Fusarium weifangense S.L. Han, M.M. Wang & L. Cai, Studies in Mycology 104: 87–148. 2023.

Fig. 4

Synonym.

Fusarium caulendophyticum H. Zhang & Y.L. Jiang, Mycosphere 14(1): 2092–2207. 2023.

Description.

Conidiophores arising from aerial mycelium, 14–18 μm long, unbranched or irregularly branched, often reduced to single phialides; aerial phialides monophialidic, subulate to subcylindrical, smooth- and thin-walled, with inconspicuous or absent periclinal thickening, 9.2–12.2 × 4.0–4.4 μm; aerial conidia hyaline, rarely ellipsoidal to falcate, slightly curved with almost parallel sides, tapering towards both ends, with a blunt to conical and slightly curved apical cell, blunt to barely notched basal cell, smooth and thin-walled, (1–)3–5-septate; 1-septate conidia: (14–)15–19(–20) × 3–4 μm (av. 17 × 3 μm, n = 8); 2-septate conidia: (19–)19–21(–24) × 3–5 μm (av. 21 × 4 μm, n = 14); 3-septate conidia: (22–)26–31(–34) × 3–6 μm (av. 28 × 4 μm, n = 22); 4-septate conidia: (30–)35–36(–45) × 3–6 μm (av. 36 × 5 μm, n = 17); 5-septate conidia: (31–)34–37(–46) × 4–6 μm (av. 38 × 5 μm, n = 15). Sporodochia salmon to orange, formed abundantly on surface of carnation leaves. Sporodochial conidiophores densely, bearing apical whorls of one phialide; sporodochial phialides monophialidic, subulate to subcylindrical, 16–24 × 2–3 μm, smooth. Sporodochial conidia falcate, slightly curved, tapering towards both ends, with a slightly elongated conical or whip-like curved apical cell, a foot-like to notched basal cell, (0–)4–5-septate, hyaline, thin, and smooth-walled; 0-septate conidia: 26–28 × 3–4 μm; 1-septate conidia: (17–)26–36(–37) × 3–6 μm (av. 28 × 4 μm, n = 10); 2-septate conidia: (20–)21–37 × 3–5 μm (av. 25 × 4 μm, n = 7); 3-septate conidia: 21–33(–38) × 3–5 μm (av. 32 × 5 μm, n = 12); 4-septate conidia: (31–)32–35(–44) × 3–6 μm (av. 36 × 4 μm, n = 22); 5-septate conidia: (34–)40–45(–48) × 3–6 μm (av. 42 × 4 μm, n = 16). Chlamydospores not observed.

Figure 4. 

Fusarium weifangense (SAUCC 5208C-2) a colony on PDA after 7 days at 25 °C (left: above, right: reverse) b colony on OA after 7 days at 25 °C (left: above, right: reverse) c sporodochia on carnation leaves d polyphialide e monophialide f sporodochial conidiophores g sporodochial conidia h aerial conidia. Scale bars: 10 μm (d–h).

Culture characteristics.

Colonies on PDA incubated at 25 °C in the dark, reaching 86–90 mm diameter in 7 d; surface white, flat, felty to velvety, aerial mycelia dense, colony margin entire; reverse white, odor absent. Colonies on OA incubated at 25 °C in the dark, reaching 85–89 mm diameter in 7 d; surface white and aerial mycelia scant, radiate, reverse white, radiate, odor absent.

Materials examined.

China • Sichuan Province, Baoting Li and Miao Autonomous County, on leaves of Prunus salicina, 2 July 2023, Q.Y. Liu (HSAUP20852, HSAUP30852), living cultures SAUCC 5208C-2 = CGMCC 3.27939, SAUCC 5208C-3.

Notes.

Fusarium weifangense (LC18333, ex-type strain) was proposed by Han et al. (2023). Fusarium caulendophyticum (CGMCC 3.25474, ex-type strain) was proposed by Zhang et al. (2023a). Fusarium weifangense (LC18333, ex-type strain) was the first to be discovered. Fusarium weifangense (LC18333 and LC18243) are clustered with Fusarium caulendophyticum (CGMCC 3.25474 and GUCC 191050.2) clade in the combined phylogenetic tree (Fig. 1, Suppl. material 4). Fusarium weifangense (LC18333, ex-type strain) and Fusarium caulendophyticum (CGMCC 3.25474, ex-type strain) were similar in cal (0/535), rpb2 (1/657), and tef1 (2/462) sequences. We therefore considered the Fusarium caulendophyticum synonym of Fusarium weifangense. In this study, our strains (SAUCC 5208C-2 and SAUCC 5208C-3) are clustered with the Fusarium weifangense (LC18333 and LC18243) clade in the combined phylogenetic tree (Fig. 1). SAUCC 5208C-2 and SAUCC 5208C-3 were similar to the latter in cal (with 100% sequence identity), rpb2 (99.85%), and tef1 (98.70%) sequences. Fusarium weifangense was previously isolated from wheat, Capsicum sp., Triticum sp., Medicago sativa, Lactuca sativa, Chenopodium quinoa, and Rosaceae roxburghii, and it has now been reported for the first time on Prunus salicina (Wang et al. 2019; Xia et al. 2019; Yin et al. 2021; Han et al. 2023; Zhang et al. 2023a) (Suppl. material 3).

Fusarium xylosmatis Q.Y. Liu, X.G. Zhang & J.W. Xia, sp. nov.

MycoBank No: MycoBank No: 856642
Fig. 5

Etymology.

Referring to the genus name of the host plant Xylosma congesta.

Typus.

China • Yunan Province, Nanuo Mountain, on leaves of Xylosma congesta, 3 March 2023, Q.Y. Liu (HMAS 353394, holotype), ex-holotype culture CGMCC 3.27794 = SAUCC 2416-1.

Description.

Conidiophores arising from aerial mycelium, 25–35 μm long, unbranched or irregularly branched, often reduced to single phialides, subulate to subcylindrical, smooth, 12–15 × 4–5 μm, periclinal thickening inconspicuous; aerial conidia ellipsoidal to falcate, slightly curved, tapering towards both ends, with a blunt to conical and slightly curved apical cell and papillate basal cell, (0–)3–5-septate; 0-septate conidia: 16–20 × 3–4 μm (av. 21 × 4 μm, n = 5); 1-septate conidia: (12–)15–19(–29) × 3–4 μm (av. 18 × 4 μm, n = 33); 2-septate conidia: (16–)16–23(–29) × 3–5 μm (av. 21 × 4 μm, n = 18); 3-septate conidia: (20–)30–36(–41) × 4–5 μm (av. 31 × 5 μm, n = 45); 4-septate conidia: (31–)30–36(–34) × 4–6 μm (av. 34 × 5 μm, n = 26); 5-septate conidia: (30–)37–41(–43) × 4–6 μm (av. 38 × 5 μm, n = 26). Sporodochia pale orange, formed abundantly on surface of carnation leaves. Sporodochial conidiophores densely and irregularly branched, 15–19 × 2–3 μm, bearing apical whorls of 1–2 phialides; sporodochial phialides monophialidic, subulate to subcylindrical, 10–12 × 2–3 μm, smooth, and thin-walled; sporodochial conidia falcate, curved dorsiventrally, straight to slightly curved, tapering towards both ends, with slightly papillate, curved apical cell and a notched to foot-like basal cell, (0–)3–4(–5)-septate, hyaline, smooth, and thin-walled; 0-septate conidia: 28–30 × 3–4 μm (av. 29 × 4 μm, n = 5); 1-septate conidia: (16–)21–32(–36) × 3–5 μm (av. 27 × 4 μm, n = 11); 2-septate conidia: 22–23 × 3–4 μm (av. 23 × 4 μm, n = 4); 3-septate conidia: (22–)25–33(–41) × 3–6 μm (av. 32 × 4 μm, n = 38); 4-septate conidia: (33–)35–38(–43) × 4–6 μm (av. 37 × 5 μm, n = 26); 5-septate conidia: (36–)38–40(–44) × 4–6 μm (av. 40 × 5 μm, n = 16). Chlamydospores abundant, globose, subglobose to ellipsoid, terminal or intercalary, solitary, in pairs, or forming long chains, 8–12 μm diameter.

Figure 5. 

Fusarium xylosmatis (CGMCC 3.27794) a colony on PDA after 7 days at 25 °C (left: above, right: reverse) b colony on OA after 7 days at 25 °C (left: above, right: reverse) c sporodochia on carnation leaves d chlamydospores e polyphialide f monophialide g, h sporodochial conidiophores i sporodochial conidia j aerial conidia. Scale bars: 10 μm (d–j).

Culture characteristics.

Colonies on PDA incubated at 25 °C in the dark, reaching 71–79 mm diameter in 7 d; aerial mycelia dense, flat, white, colony margin entire; reverse yellowish white, radiate, aerial mycelia dense, odor absent. Colonies on OA grown in the dark, reaching 69–77 mm diameter after 7 d at 25 °C, flat, aerial mycelia scant, colony margin entire, white; reverse white, odor absent.

Additional material studied.

China • Yunan Province, Nanuo Mountain, on leaves of Xylosma congesta, 3 March 2023, Q.Y. Liu (HSAUP21624), living culture CGMCC 3.27795 = SAUCC 2416-2.

Notes.

Phylogenetically, F. xylosmatis (CGMCC 3.27794) is closely related to the species F. weifangense (LC18333); there were 7/535 differences in cal, 9/657 in rpb2, and 8/462 in tef1. Morphologically, F. xylosmatis (CGMCC 3.27794) is distinguished from F. weifangense (LC18333) by the number of sporodochial conidial septa (0–5-septate in F. xylosmatis (CGMCC 3.27794) vs. 3–7-septate in F. weifangense (LC18333)) (Han et al. 2023; Zhang et al. 2023a).

Discussion

The genus and species concepts in Fusarium have endured significant changes (Leslie and Summerell 2006; Crous et al. 2021; He et al. 2024). Traditionally, the identification of Fusarium is mainly based on morphological characteristics (Wollenweber and Reinking 1935; Snyder and Hansen 1940; Toussoun and Nelson 1968; Gerlach and Nirenberg 1982; Leslie and Summerell 2006). However, identification is difficult due to the high morphological variation that complicates morphological identification among the closely related species (Leslie and Summerell 2006; Crous et al. 2021). Therefore, it is important to identify Fusarium species through molecular analysis (Wang et al. 2019; Xia et al. 2019; Crous et al. 2021; Wang et al. 2022; He et al. 2024). The internal transcribed spacer (ITS), the large subunit (LSU), ATP citrate lyase (acl1), calmodulin (cal), RNA polymerase II largest subunit (rpb1), RNA polymerase second largest subunit (rpb2), translation elongation factor 1-alpha (tef1), and beta-tubulin (tub2) are used in current studies (Lombard et al. 2015; Sandoval-Denis et al. 2018; Xia et al. 2019; Crous et al. 2021; Suwannarach et al. 2023; He et al. 2024). However, the identification of Fusarium at the species level could not be resolved using the ribosomal DNA gene (ITS and LSU) alone (Balajee et al. 2009; O’Donnell et al. 2015; Suwannarach et al. 2023). Thus, the protein-coding genes (acl1, cal, rpb1, rpb2, tef1, and tub2) are added (Xia et al. 2019; Crous et al. 2021; Suwannarach et al. 2023; He et al. 2024). Different complexes of Fusarium require different gene combinations to identify.

In this study, we collected parasitic or saprotrophic fungi from terrestrial habitats in Hainan, Sichuan, and Yunnan Provinces of China on four plant specimens: Setaria palmifolia, Ficus fistulosa, Prunus salicina, and Xylosma congesta. Morphologically, these species exhibit a range of variations in spore size, shape, and ornamentation, as well as colony characteristics such as growth rate, pigmentation, and texture. We also conducted phylogenetic analyses using cal, rpb2, and tef1 sequences and can be recognized as two new phylogenetic species (Fusarium. fici sp. nov. and Fusarium xylosmatis sp. nov.), along with two known species (Fusarium fecundum and Fusarium weifangense). The discovery of two new species underscores the rich fungal diversity in Hainan, Sichuan, and Yunnan Provinces and emphasizes the need for further exploration of understudied habitats. Fusarium fecundum was first reported from Setaria palmifolia; Fusarium weifangense was first reported from Prunus salicina. It can contribute to our knowledge of host specificity and ecological adaptation in fungal pathogens. These findings have significant implications for fungal taxonomy, ecology, and potential applications in plant pathology and biocontrol.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This research was funded by the National Natural Science Foundation of China (nos. 32370001, 32270024, 31900014, U2002203), the Key Technological Innovation Program of Shandong Province, China (no. 2022CXGC020710), the Jinan City’s ‘New University 20 Policies’ Initiative for Innovative Research Teams Project (no. 202228028), and the Innovative Agricultural Application Technology Project of Jinan City (no. CX202210).

Author contributions

Sampling, molecular biology analysis: Qiyun Liu and Congcong Ai; fungal isolation: Yaling Wang; description and phylogenetic analysis: Zhaoxue Zhang; microscopy: Duhua Li and Yun Geng; writing—original draft preparation: Qiyun Liu; writing—review and editing: Jiwen Xia and Xiuguo Zhang. All authors read and approved the final manuscript.

Author ORCIDs

Qiyun Liu https://orcid.org/0009-0009-9545-7962

Zhaoxue Zhang https://orcid.org/0000-0002-4824-9716

Duhua Li https://orcid.org/0009-0006-5200-2034

Xiuguo Zhang https://orcid.org/0000-0001-9733-8494

Jiwen Xia https://orcid.org/0000-0002-7436-7249

Data availability

The sequences were deposited in the GenBank database.

References

  • Bacon CW, Yates IE (2006) Endophytic root colonization by Fusarium species: histology, plant interactions, and toxicity. Microbial Root Endophytes, 133–152. https://doi.org/10.1007/3-540-33526-9_8
  • Balajee SA, Borman AM, Brandt ME, Cano J, Cuenca-Estrella M, Dannaoui E, Guarro J, Haase G, Kibbler CC, Meyer W, O’Donnell K, Petti CA, Rodriguez-Tudela JL, Sutton D, Velegraki A, Wickes BL (2009) Sequence-based identification of Aspergillus, Fusarium, and Mucorales species in the clinical mycology laboratory: Where are we and where should we go from here? Journal of Clinical Microbiology 47: 877–884. https://doi.org/10.1128/JCM.01685-08
  • Crous PW, Lombard L, Sandoval-Denis M, Seifert KA, Schroers HJ, Chaverri P, Gené J, Guarro J, Hirooka Y, Bensch K, Kema GHJ, Lamprecht SC, Cai L, Rossman AY, Stadler M, Summerbell RC, Taylor JW, Ploch S, Visagie CM, Yilmaz N, Frisvad JC, Abdel-Azeem AM, Abdollahzadeh J, Abdolrasouli A, Akulov A, Alberts JF, Araújo JPM, Ariyawansa HA, Bakhshi M, Bendiksby M, Ben Hadj Amor A, Bezerra JDP, Boekhout T, Câmara MPS, Carbia M, Cardinali G, Castañeda-Ruiz RF, Celis A, Chaturvedi V, Collemare J, Croll D, Damm U, Decock CA, de Vries RP, Ezekiel CN, Fan XL, Fernández NB, Gaya E, González CD, Gramaje D, Groenewald JZ, Grube M, Guevara-Suarez M, Gupta VK, Guarnaccia V, Haddaji A, Hagen F, Haelewaters D, Hansen K, Hashimoto A, Hernández-Restrepo M, Houbraken J, Hubka V, Hyde KD, Iturriaga T, Jeewon R, Johnston PR, Jurjević Ž, Karalti I, Korsten L, Kuramae EE, Kušan I, Labuda R, Lawrence DP, Lee HB, Lechat C, Li HY, Litovka YA, Maharachchikumbura SSN, Marin-Felix Y, Matio Kemkuignou B, Matočec N, McTaggart AR, Mlčoch P, Mugnai L, Nakashima C, Nilsson RH, Noumeur SR, Pavlov IN, Peralta MP, Phillips AJL, Pitt JI, Polizzi G, Quaedvlieg W, Rajeshkumar KC, Restrepo S, Rhaiem A, Robert J, Robert V, Rodrigues AM, Salgado-Salazar C, Samson RA, Santos ACS, Shivas RG, Souza-Motta CM, Sun GY, Swart WJ, Szoke S, Tan YP, Taylor JE, Taylor PWJ, Tiago PV, Váczy KZ, van de Wiele N, van der Merwe NA, Verkley GJM, Vieira WAS, Vizzini A, Weir BS, Wijayawardene NN, Xia JW, Yáñez-Morales MJ, Yurkov A, Zamora JC, Zare R, Zhang CL, Thines M (2021) Fusarium: More than a node or a foot-shaped basal cell. Studies in Mycology 98(4): e100116. https://doi.org/10.1016/j.simyco.2021.100116
  • Fisher NL, Burguess LW, Toussoun TA, Nelson PE (1982) Carnation leaves as a substrate and for preserving cultures of Fusarium species. Phytopathology 72: 151–153. https://doi.org/10.1094/Phyto-72-151
  • Gams W, Nirenberg HI, Seifert KA, Brayford D, Thrane U (1997) Proposal to conserve the name Fusarium sambucinum (Hyphomycetes). Taxon 46(1): 111–113. https://doi.org/10.2307/1224298
  • Geiser DM, Al-Hatmi AMS, Aoki T, Arie T, Balmas V, Barnes I, Bergstrom GC, Bhattacharyya MK, Blomquist CL, Bowden RL, Brankovics B, Brown DW, Burgess LW, Bushley K, Busman M, Cano-Lira JF, Carrillo JD, Chang HX, Chen CY, Chen W, Chilvers M, Chulze S, Coleman JJ, Cuomo CA, de Beer ZW, de Hoog GS, Del Castillo-Munera J, Del Ponte EM, Dieguez-Uribeondo J, Di Pietro A, Edel-Hermann V, Elmer WH, Epstein L, Eskalen A, Esposto MC, Everts KL, Fernandez-Pavia SP, da Silva GF, Foroud NA, Fourie G, Frandsen RJN, Freeman S, Freitag M, Frenkel O, Fuller KK, Gagkaeva T, Gardiner DM, Glenn AE, Gold SE, Gordon TR, Gregory NF, Gryzenhout M, Guarro J, Gugino BK, Gutierrez S, Hammond-Kosack KE, Harris LJ, Homa M, Hong CF, Hornok L, Huang JW, Ilkit M, Jacobs A, Jacobs K, Jiang C, Jimenez-Gasco MDM, Kang S, Kasson MT, Kazan K, Kennell JC, Kim HS, Kistler HC, Kuldau GA, Kulik T, Kurzai O, Laraba I, Laurence MH, Lee T, Lee YW, Lee YH, Leslie JF, Liew ECY, Lofton LW, Logrieco AF, Lopez-Berges MS, Luque AG, Lysoe E, Ma LJ, Marra RE, Martin FN, May SR, McCormick SP, McGee C, Meis JF, Migheli Q, Mohamed Nor NMI, Monod M, Moretti A, Mostert D, Mule G, Munaut F, Munkvold GP, Nicholson P, Nucci M, O’Donnell K, Pasquali M, Pfenning LH, Prigitano A, Proctor RH, Ranque S, Rehner SA, Rep M, Rodriguez-Alvarado G, Rose LJ, Roth MG, Ruiz-Roldan C, Saleh AA, Salleh B, Sang H, Scandiani MM, Scauflaire J, Schmale DG 3rd, Short DPG, Sisic A, Smith JA, Smyth CW, Son H, Spahr E, Stajich JE, Steenkamp E, Steinberg C, Subramaniam R, Suga H, Summerell BA, Susca A, Swett CL, Toomajian C, Torres-Cruz TJ, Tortorano AM, Urban M, Vaillancourt LJ, Vallad GE, van der Lee TAJ, Vanderpool D, van Diepeningen AD, Vaughan MM, Venter E, Vermeulen M, Verweij PE, Viljoen A, Waalwijk C, Wallace EC, Walther G, Wang J, Ward TJ, Wickes BL, Wiederhold NP, Wingfield MJ, Wood AKM, Xu JR, Yang XB, Yli-Mattila T, Yun SH, Zakaria L, Zhang H, Zhang N, Zhang SX, Zhang X (2021) Phylogenomic analysis of a 55.1kb 19-gene dataset resolves a monophyletic Fusarium that includes the Fusarium solani species complex. Phytopathology 111: 1064–1079. https://doi.org/10.1094/PHYTO-08-20-0330-LE
  • Gerlach W, Nirenberg HI (1982) The genus Fusarium – a pictorial atlas. Mitteilungen der Biologischen Bundesanstalt für Land-und Forstwirtschaft Berlin-Dahlem 209: 1–406.
  • Han SL, Wang MM, Ma ZY, Raza M, Zhao P, Liang JM, Gao M, Li YJ, Wang JW, Hu DM, Cai L (2023) Fusarium diversity associated with diseased cereals in China, with an updated phylogenomic assessment of the genus. Studies in Mycology 104: 87–148. https://doi.org/10.3114/sim.2022.104.02
  • He J, Li DW, Cui WL, Zhu LH, Huang L (2024) Morphological and phylogenetic analyses reveal three new species of Fusarium (Hypocreales, Nectriaceae) associated with leaf blight on Cunninghamia lanceolata in China. MycoKeys 101: 45–80. https://doi.org/10.3897/mycokeys.101.113128
  • Leslie JF, Pearson CAS, Nelson PE, Toussoun TA (1990) Fusarium spp. from corn, sorghum, and soybean fields in the central and eastern United States. Phytopathology 80(4): 343–350. https://doi.org/10.1094/Phyto-80-343
  • Link JHF (1809) Observationes in ordines plantarum naturales. Dissertatio Ima. Gesellschaft Naturforschender Freunde zu Berlin. Magazin 3(1): 3–42.
  • Liu XF, Tibpromma S, Hughes AC, Chethana KWT, Wijayawardene NN, Dai DQ, Du TY, Elgorban AM, Stephenson SL, Suwannarach N, Xu JC, Lu L, Xu RF, Maharachchikumbura SSN, Zhao CL, Bhat DJ, Sun YM, Karunarathna SC, Mortimer PE (2023) Culturable mycota on bats in central and southern Yunnan Province, China. Mycosphere 14: 497–662. https://doi.org/10.5943/mycosphere/14/1/7
  • Maryani N, Sandoval-Denis M, Lombard L, Crous PW, Kema GHJ (2019) New endemic Fusarium species hitch-hiking with pathogenic Fusarium strains causing Panama disease in small-holder banana plots in Indonesia. Persoonia 43: 48–69. https://doi.org/10.3767/persoonia.2019.43.02
  • O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC (1998) Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the United States of America 95: 2044–2049. https://doi.org/10.1073/pnas.95.5.2044
  • O’Donnell K, Sutton DA, Rinaldi MG, Gueidan C, Crous PW, Geiser DM (2009) Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum species complexes within the United States. Journal of Clinical Microbiology 47: 3851–3861. https://doi.org/10.1128/JCM.01616-09
  • O’Donnell K, Ward TJ, Robert VARG, Crous PW, Geiser DM, Kang S (2015) DNA sequence-based identification of Fusarium: Current status and future directions. Phytoparasitica 43: 583–595. https://doi.org/10.1007/s12600-015-0484-z
  • O’Donnell K, Al-Hatmi AMS, Aoki T, Brankovics B, Cano-Lira JF, Coleman JJ, de Hoog GS, Di Pietro A, Frandsen RJN, Geiser DM, Gibas CFC, Guarro J, Kim HS, Kistler HC, Laraba I, Leslie JF, López-Berges MS, Lysøe E, Meis JF, Monod M, Proctor RH, Rep M, Ruiz-Roldán C, Šišić A, Stajich JE, Steenkamp ET, Summerell BA, van der Lee TAJ, van Diepeningen AD, Verweij PE, Waalwijk C, Ward TJ, Wickes BL, Wiederhold NP, Wingfield MJ, Zhang N, Zhang SX (2020) No to Neocosmospora: Phylogenomic and practical reasons for continued inclusion of the Fusarium solani species complex in the genus Fusarium. MSphere 5(5): e00810–e00820. https://doi.org/10.1128/mSphere.00810-20
  • Sandoval-Denis M, Guarnaccia V, Polizzi G, Crous PW (2018) Symptomatic Citrus trees reveal a new pathogenic lineage in Fusarium and two new Neocosmospora species. Persoonia 40: 1–25. https://doi.org/10.3767/persoonia.2018.40.01
  • Santos A, Trindade JVC, Lima CS, Barbosa RDN, da Costa AF, Tiago PV, de Oliveira NT (2019) Morphology, phylogeny, and sexual stage of Fusarium caatingaense and Fusarium pernambucanum, new species of the Fusarium incarnatum-equiseti species complex associated with insects in Brazil. Mycologia 111: 244–259. https://doi.org/10.1080/00275514.2019.1573047
  • Suwannarach N, Khuna S, Kumla J, Thitla T, Hongsanan S, Nuangmek W, Lumyong S (2023) Fusarium endophyticum sp. nov. (Nectriaceae, Hypocreales), a new endophytic fungus from northern Thailand. Phytotaxa 606: 43–53. https://doi.org/10.11646/phytotaxa.606.1.4
  • Toussoun TA, Nelson PE (1968) Fusarium: A pictorial guide to the identification of Fusarium especies according to the taxonomic system of snyder and hansen. The PaSta. Univ. Press. , University Park, London, 51 pp.
  • Villani A, Moretti A, De Saeger S, Han Z, Di Mavungu JD, Soares CMG, Proctor RH, Venancio A, Lima N, Stea G, Paciolla C, Logrieco AF, Susca A (2016) A polyphasic approach for characterization of a collection of cereal isolates of the Fusarium incarnatum-equiseti species complex. International Journal of Food Microbiology 234: 24–35. https://doi.org/10.1016/j.ijfoodmicro.2016.06.023
  • Wang MM, Crous PW, Sandoval-Denis M, Han SL, Liu F, Liang JM, Duan WJ, Cai L (2022) Fusarium and allied genera from China: Species diversity and distribution. Persoonia 48: 1–53. https://doi.org/10.3767/persoonia.2022.48.01
  • Wang S, Liu XM, Xiong CL, Gao SS, Xu WM, Zhao LL, Song CY, Liu XY, James TY, Li Z, Zhang XG (2023) ASF1 regulates asexual and sexual reproduction in Stemphylium eturmiunum by DJ-1 stimulation of the PI3K/AKT signaling pathway. Fungal Diversity 123(1): 159–176. https://doi.org/10.1007/s13225-023-00528-1
  • Wollenweber HW, Reinking OA (1935) Die Fusarien: Ihre Beschreibung, Schadwirkung und Bekämpfung.
  • Yin H, Zhou JB, Chen YL, Ren L, Qin N, Xing YL, Zhao XJ (2021) Morphology, phylogeny, and pathogenicity of Trichothecium, Alternaria, and Fusarium species associated with panicle rot on Chenopodium quinoa in Shanxi Province, China. Plant Pathology 71: 344–360. https://doi.org/10.1111/ppa.13462
  • Zhang J, Zhang Z, Li D, Xia J, Li Z (2023b) Three new species of Microdochium (Microdochiaceae, Xylariales) on Bambusaceae sp. and saprophytic leaves from Hainan and Yunnan, China. Journal of Fungi 9: 1176. https://doi.org/10.3390/jof9121176
  • Zhang ZX, Shang YX, Zhang MY, Zhang JJ, Geng Y, Xia JW, Zhang XG (2024) Phylogenomics, taxonomy and morphological characters of the Microdochiaceae (Xylariales, Sordariomycetes). MycoKeys 106: 303–325. https://doi.org/10.3897/mycokeys.106.127355

Supplementary materials

Supplementary material 1 

GenBank accession numbers of the taxa used in phylogenetic reconstruction

Congcong Ai, Qiyun Liu, Yaling Wang, Zhaoxue Zhang, Duhua Li, Yun Geng, Xiuguo Zhang, Jiwen Xia

Data type: docx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (47.08 kb)
Supplementary material 2 

Phylogeny of the Fusarium incarnatum-equiseti species complex (FIESC) inferred based on the cal (a), rpb2 (b), and tef1 (c) loci, respectively

Congcong Ai, Qiyun Liu, Yaling Wang, Zhaoxue Zhang, Duhua Li, Yun Geng, Xiuguo Zhang, Jiwen Xia

Data type: docx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (1.03 MB)
Supplementary material 3 

GenBank accession numbers of the taxa used in phylogenetic reconstruction (Suppl. material 4)

Congcong Ai, Qiyun Liu, Yaling Wang, Zhaoxue Zhang, Duhua Li, Yun Geng, Xiuguo Zhang, Jiwen Xia

Data type: docx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (28.88 kb)
Supplementary material 4 

Phylogeny inferred based on the combined cal-rpb2-tef1 sequence dataset with Fusarium concolor (NRRL 13459) as the outgroup

Congcong Ai, Qiyun Liu, Yaling Wang, Zhaoxue Zhang, Duhua Li, Yun Geng, Xiuguo Zhang, Jiwen Xia

Data type: docx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (107.58 kb)
login to comment