Research Article
Print
Research Article
Three new species of Fusarium (Nectriaceae, Hypocreales) isolated from Eastern Cape dairy pastures in South Africa
expand article infoClaudette Dewing‡, Cobus M. Visagie‡, Emma T. Steenkamp‡, Brenda D. Wingfield‡, Neriman Yilmaz‡
‡ University of Pretoria, Pretoria, South Africa

Corresponding author: Neriman Yilmaz ( neriman.yilmaz@fabi.up.ac.za )

Academic editor: Rajesh Jeewon
© 2025 Claudette Dewing, Cobus M. Visagie, Emma T. Steenkamp, Brenda D. Wingfield, Neriman Yilmaz.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Dewing C, Visagie CM, Steenkamp ET, Wingfield BD, Yilmaz N (2025) Three new species of Fusarium (Nectriaceae, Hypocreales) isolated from Eastern Cape dairy pastures in South Africa. MycoKeys 115: 241-271. https://doi.org/10.3897/mycokeys.115.148914
Open Access

Abstract

A survey of the fungal diversity associated with mixed pastures from Eastern Cape dairy farms in South Africa led to the isolation of 155 Fusarium strains that belong to the Fusarium incarnatum-equiseti species complex (FIESC). Using single and multigene phylogenies based on partial sequences of the translation elongation factor 1-alpha (TEF), calmodulin (CaM), and the partial RNA polymerase second largest subunit (RPB2) genes, we identified 11 species. They included F. brevicaudatum, F. clavus, F. coffeatum, F. croceum, F. goeppertmayerae, and F. heslopiae, with five species that were found to be new. Based on morphological and phylogenetic data, three new species are formally described here as F. cumulatum, F. mariecurieae, and F. pascuum. We also provided a description for F. goeppertmayerae, as the authors who identified and named this species did not include one. We have chosen to not describe the remaining species, as our cultures lack proper morphological structure development. This study shows that mixed pastures harbour a diverse range of Fusarium species and highlights the need for further studies into their potential to impact animal health.

Key words:

Fusarium camptoceras, GCPSR, molecular phylogenetics, morphology, mycotoxins

Introduction

Well-maintained pastures are important for promoting the well-being of cattle, as they directly impact the animals’ nutrition, overall health and productivity (Marais 2001; Neal et al. 2007; Botha et al. 2008a, 2008b; Doxey 2014; van der Colf et al. 2015). Several grass species from Poaceae are used for grazing worldwide (Charlton and Stewart 1999; Lowe 2009; Truter et al. 2015). In South Africa the preferred species are Cenchrus clandestinus (formerly known as Pennisetum clandestinum; kikuyu), Lolium multiflorum (annual ryegrass) and L. perenne (perennial ryegrass) (Truter et al. 2015). Despite the obvious nutritional value of pastures, they can also pose health risks to grazing animals under certain circumstances, e.g., kikuyu poisoning in cattle (Bryson and Newsholme 1978; Newsholme et al. 1983; Wong et al. 1987; Bourke 2007; Ryley et al. 2007; Botha et al. 2014) or when the growth of mycotoxigenic fungi leads to mycotoxin build-up in pastures (Golinski et al. 2003; Driehuis et al. 2008; Skládanka et al. 2011; Penagos-Tabares et al. 2021).

Among the various factors that could affect the health of grazing cattle, Fusarium species and their mycotoxins pose a significant risk. The genus Fusarium comprises a diverse group of filamentous fungi that play significant roles in various ecological and agricultural contexts because of the range of lifestyles they exhibit, including saprotrophic and endophytic modes, often associated with various grass hosts (Leslie et al. 2004; Bentley et al. 2007; Summerell et al. 2010; Nor Azliza et al. 2014; Laurence et al. 2016). Some Fusarium species are also well-known pathogens to animals, humans and plants, and are important producers of mycotoxins (Desjardins 2006; Leslie and Summerell 2006; O’Donnell et al. 2013; Gallo et al. 2022). Fusarium mycotoxins that are particularly important from a toxicological standpoint include deoxynivalenol (Reed and Moore 2009; Skládanka et al. 2011; Burkin and Kononenko 2015; Penagos-Tabares et al. 2021), fumonisins (Reed and Moore 2009; Gott et al. 2017) and zearalenone (di Menna et al. 1987; Reed et al. 2004; Reed and Moore 2009; Skládanka et al. 2011; Burkin and Kononenko 2015; Nichea et al. 2015; Penagos-Tabares et al. 2021). These toxins can cause severe health issues in animals, including abnormal foetal development, disruptions in cell division and membrane function, reduced feed intake leading to body weight loss, fertility problems, immunosuppression, inhibition of protein synthesis, impaired mitochondrial function and, in severe cases, death (Trenholm et al. 1985; Weaver et al. 1986; Smith et al. 1990; Edrington et al. 1995; Moretti et al. 2013; Eskola et al. 2018; Aranega and Oliveira 2022). Furthermore, certain Fusarium species and their associated mycotoxins have been suggested as potential contributors to kikuyu poisoning cases in South Africa and Australia (Ryley et al. 2007; Botha et al. 2014). However, this connection remains hypothetical and unconfirmed due to limited availability of supporting data.

In 2020, cattle in the Eastern Cape province of South Africa showed symptoms of facial eczema, a type of hepatogenous photosensitivity caused by the mycotoxin sporidesmin A, produced by the fungus Pseudopithomyces chartarum (= Pithomyces chartarum) (Brook 1963; di Menna et al. 1970; Marasas and Schumann 1972; Kellerman et al. 1980; Kellerman and Coetzer 1985; Davis et al. 2021). A fungal survey was subsequently conducted at 14 dairy farms to first determine whether P. chartarum was present in affected pastures and second to identify other culturable fungi that may also be present (Dewing et al. 2025). The survey revealed Fusarium as the most commonly isolated genus, particularly species within the Fusarium incarnatum-equiseti species complex (FIESC). However, some strains in the complex could not be satisfactorily identified to species level. Here we report on the FIESC species present in Eastern Cape dairy pastures and describe three new species using macro- and micro-morphological characterisation with the support of multigene phylogenetic approaches. We also supply F. goeppertmayerae with the necessary macro- and micro-morphological characterisation information, as this was not supplied by Tan and Shivas (2023), who identified and named this species.

Materials and methods

Sampling and isolations

A total of 95 mixed pasture grass samples (primarily a mixture of kikuyu and ryegrass) were collected from 14 dairy farms in the Eastern Cape province of South Africa in May 2020, with a specific focus on identifying Fusarium species (Table 1). These pastures were potentially associated with a facial eczema outbreak in cattle. Plant material was cut into small pieces (±4 mm) and plated onto potato dextrose agar (PDA; Becton, Dickinson and Company (BD), Franklin Lakes, USA) and water agar (WA). Both were supplemented with chloramphenicol (100 ppm). The plates were incubated for 7–10 d at 25 °C and checked regularly for fungal growth. Colonies were transferred to pure cultures onto ¼PDA supplemented with chloramphenicol (100 ppm). Single spore cultures were prepared for all Fusarium strains following Leslie and Summerell (2006). Strains were accessioned and preserved in cryovials containing 10% glycerol and stored at -80 °C in the Applied Mycology working culture collection (CN) housed at the Forestry and Agricultural Biotechnology Institute (FABI) at the University of Pretoria, South Africa. Additionally, representative strains were deposited in the culture collections of FABI (Collection Mike Wingfield (CMW) and Collection Mike Wingfield at Innovation Africa (CMW-IA)) and the Westerdijk Fungal Biodiversity Institute (CBS) in Utrecht, the Netherlands (Table 1).

Table 1.
Download as
CSV
XLSX

Fusarium strains from the Fusarium incarnatum-equiseti species complex (FIESC) isolated from mixed dairy pastures from the Eastern Cape, South Africa.

Species Strain TEF CaM RPB1 RPB2
Camptoceras-clade (FIESC; Han et al. (2023) = orginally the FCAMSC)
F. pascuum sp. nov. CMW-IA 003320 = CMW 61364 = CN056A8 OR670986 OR669177 PP187127 PP235233
F. pascuum sp. nov. CMW 58649 = CN070E7 PP187098 — PP187129 PQ467747
F. pascuum sp. nov. CMW 58650 = CN070F7 OR670991 OR669181 PP187132 PP158160
F. pascuum sp. nov. CMW-IA 002133 = CMW 60931 = CN070I3 PP187102 PP187122 — PQ467748
F. pascuum sp. nov. CMW 58651 = CN070I4 OR671007 OR669194 PP187144 PQ467749
F. pascuum sp. nov. CMW 58652 = CN071B8 OR671025 OR669210 PP187152 PP158176
F. pascuum sp. nov. CBS 151772 = CMW 58653 = CN159G4 = CN071C4 OR671027 OR669212 PP187155 PP158178
F. pascuum sp. nov. CMW 58654 = CN071D3 OR671033 OR669216 PP187158 PQ467750
F. pascuum sp. nov. CMW 58655 = CN071E9 OR671039 OR669221 PP187161 PP158183
F. pascuum sp. nov. CMW 58656 = CN071F9 OR671044 OR669225 PP187166 PP235238
F. pascuum sp. nov. CMW 58657 = CN071G8 OR671051 OR669229 PP187168 PQ467751
F. pascuum sp. nov. CMW 58658 = CN071I3 OR671057 OR669233 PP187173 PQ467752
F. pascuum sp. nov. CMW 58659 = CN071I5 OR671058 OR669234 PP187175 PP158189
F. pascuum sp. nov. CMW 58660 = CN071I9 OR671061 OR669237 PP187179 PQ467753
F. pascuum sp. nov. CMW 58661 = CN072A1 OR671062 OR669238 PP187180 PP158191
F. pascuum sp. nov. CMW 58662 = CN104D6 OR671090 OR669265 PP187190 PP158199
F. pascuum sp. nov. CMW 58663 = CN104D7 OR671091 OR669266 PP187191 PQ467754
Equiseti-clade (FIESC)
F. brevicaudatum CMW-IA 003335 = CMW 61379 = CN071C6 OR671028 — — —
F. brevicaudatum CMW-IA 003765 = CMW 61537 = CN110E5 OR671114 — — —
F. clavus CMW-IA 001930 = CMW 60748 = CN041D2 OR670983 — — —
F. clavus CMW-IA 003330 = CMW 61374 = CN070H4 OR671001 OR669189 — —
F. clavus CN070H7 PP187101 PP187121 — —
F. clavus CN070I8 OR671010 OR669197 — PP158167
F. clavus CN071A3 OR671013 OR669200 — —
F. clavus CN071A4 OR671014 OR669201 — —
F. clavus CN071B3 OR671020 OR669205 — —
F. clavus CN071B4 OR671021 OR669206 — PP158174
F. clavus CN071D1 OR671031 OR669215 — —
F. clavus CN071D2 OR671032 — — —
F. clavus CN071D8 OR671034 OR669217 — —
F. clavus CN071E1 OR671035 OR669218 — —
F. clavus CN071E2 OR671036 — — PP158180
F. clavus CN071G5 OR671049 OR669227 — PP158187
F. clavus CN071G6 OR671050 OR669228 — —
F. clavus CN071H6 OR671054 - — —
F. clavus CN072A6 OR671066 OR669241 — PP158193
F. clavus CN072A9 OR671069 OR669244 — PP158195
F. clavus CN072E4 OR671076 OR669251 — PP158196
F. croceum CMW-IA 001923 = CMW 60732 = CN040I7 OR670982 — — —
F. croceum CMW-IA 001934 = CMW 60752 = CN041D9 OR670984 — — —
F. croceum CN048C3 OR670985 — — —
F. croceum CN070F6 OR670990 — — —
F. croceum CMW-IA 003326 = CMW 61370 = CN070F8 OR670992 — — —
F. croceum CN070F9 PP187099 — — PQ467755
F. croceum CN070G4 OR670995 OR669184 PP187135 PP158162
F. croceum CN070G6 OR670997 — PP187137 PQ467756
F. croceum CN070G7 OR670998 OR669186 PP187138 PQ467757
F. croceum CN070H1 OR671000 OR669188 — —
F. croceum CN070H5 OR671002 OR669190 — —
F. croceum CN070I1 OR671005 OR669193 PP187143 PQ467758
F. croceum CN070I2 OR671006 — — —
F. croceum CN070I5 OR671008 OR669195 PP187145 PP158165
F. croceum CN070I9 OR671011 OR669198 PP187147 PP158168
F. croceum CN071B1 OR671018 OR669203 PP187148 PP158173
F. croceum CN071C7 OR671029 OR669213 PP187156 PQ467759
F. croceum CN071F1 OR671040 OR669222 PP187162 PP158184
F. croceum CN071G1 OR671045 — — —
F. croceum CN071G2 OR671046 — — —
F. croceum CN071G3 OR671047 — PP187167 —
F. croceum CN071H3 PP187104 — PP187170 PQ467760
F. croceum CN071H7 OR671055 OR669231 PP187171 PP158188
F. croceum CN071I4 PP187105 PP187124 PP187174 PP235239
F. croceum CN072A5 OR671065 OR669240 — —
F. croceum CN072A8 OR671068 OR669243 PP187182 PP158194
F. croceum CN072B1 OR671070 OR669245 PP187183 PQ467761
F. croceum CN072B4 OR671072 OR669247 — —
F. croceum CN072B8 OR671074 OR669249 — PP235242
F. croceum CN103E5 OR671077 OR669252 — —
F. croceum CN103E6 OR671078 OR669253 — —
F. croceum CN104B9 OR671079 OR669254 — —
F. croceum CN104C1 OR671080 OR669255 — —
F. croceum CN104C3 OR671082 OR669257 — —
F. croceum CN104C4 OR671083 OR669258 — —
F. croceum CN104C5 OR671084 OR669259 — —
F. croceum CN104C7 OR671085 OR669260 — —
F. croceum CN104C9 OR671086 OR669261 — —
F. croceum CN104D5 OR671089 OR669264 — —
F. croceum CN104D8 OR671092 OR669267 — —
F. croceum CN104E4 OR671094 — — —
F. croceum CN104E8 OR671095 — — —
F. croceum CN106E9 OR671096 — — —
F. croceum CN110D4 OR671107 — — —
F. croceum CN110D6 OR671109 — — —
F. croceum CN110D8 OR671110 — — —
F. croceum CN110E1 OR671112 — — —
F. croceum CN115A2 PP187108 — — —
F. croceum CN115A3 PP187109 — — —
F. croceum CN115A4 PP187110 — — —
F. croceum CN115B2 PP187111 — — —
F. croceum CN115B6 PP187112 — — —
F. croceum CN115C8 PP187114 — — —
F. croceum CN115D9 PP187117 — — —
F. croceum CN119E7 PP187119 — — —
F. cumulatum sp. nov. CMW 58686 = CN071B9 OR671026 OR669211 PP187153 PP158177
F. cumulatum sp. nov. CMW 58687 = CN071E5 OR671038 OR669220 PP187160 PP158182
F. cumulatum sp. nov. CMW-IA 002138 = CMW 60936 = CN071G4 OR671048 OR669226 — PP158186
F. cumulatum sp. nov. CBS 151773 = CMW 58688 = CN104D3 OR671087 OR669262 PP187188 PP158197
F. heslopiae CN071C8 OR671030 OR669214 PP187157 PP158179
Incarnatum-clade (FIESC)
F. coffeatum CMW-IA 003332 = CMW 61376 = CN071A2 OR671012 OR669199 — PP158169
F. coffeatum CN071A5 OR671015 OR669202 — PP158170
F. coffeatum CN071A6 OR671016 — — PP158171
F. coffeatum CN071A7 OR671017 — — PP158172
F. coffeatum CMW-IA 003334 = CMW 61378 = CN071B5 OR671022 OR669207 — PP158175
F. coffeatum CMW-IA 003341 = CMW 61385 = CN072A4 OR671064 — — —
F. coffeatum CN072A7 OR671067 OR669242 — —
F. goeppertmayerae CBS 151775 = CMW 58689 = CN040I5 OR670981 OR669176 PP187126 PP158159
F. goeppertmayerae CMW 58690 = CN070F3 OR670988 OR669179 PP187130 PP235234
F. goeppertmayerae CMW 58691 = CN070G8 OR670999 OR669187 PP187139 PP158163
F. goeppertmayerae CMW 58692 = CN070G9 PP187100 PP187120 PP187140 PP235236
F. goeppertmayerae CMW-IA 002132 = CMW 60930 = CN070H9 OR671004 OR669192 PP187142 PP158164
F. goeppertmayerae CMW-IA 003340 = CMW 61384 = CN071H2 OR671053 — — —
F. goeppertmayerae CMW 58693 = CN071H8 OR671056 OR669232 PP187172 PQ467762
F. goeppertmayerae CMW 58694 = CN071I6 OR671059 OR669235 PP187176 PP158190
F. goeppertmayerae CMW 58695 = CN071I7 PP187106 PP187125 PP187177 PQ467763
F. goeppertmayerae CMW 58696 = CN071I8 OR671060 OR669236 PP187178 PP235240
F. goeppertmayerae CMW 58697 = CN104D4 OR671088 OR669263 PP187189 PP158198
F. goeppertmayerae CMW 58698 = CN106F2 OR671098 OR669270 PP187194 PP158201
F. goeppertmayerae CMW 58699 = CN106F3 OR671099 OR669271 PP187195 PP235244
F. goeppertmayerae CMW 58700 = CN106F4 OR671100 OR669272 PP187196 PP158202
F. mariecurieae sp. nov. CMW 58664 = CN070E5 OR670987 OR669178 PP187128 PQ467764
F. mariecurieae sp. nov. CMW-IA 002131 = CMW 60929 = CN070F5 OR670989 OR669180 PP187131 —
F. mariecurieae sp. nov. CMW 58665 = CN070G2 OR670994 OR669183 PP187134 PP158161
F. mariecurieae sp. nov. CMW-IA 003328 = CMW 61372 = CN070G5 OR670996 OR669185 PP187136 PP235235
F. mariecurieae sp. nov. CMW 58666 = CN070H6 OR671003 OR669191 PP187141 PQ467765
F. mariecurieae sp. nov. CBS 151774 = CMW 58667 = CN070I7 OR671009 OR669196 PP187146 PP158166
F. mariecurieae sp. nov. CMW 58668 = CN071B2 OR671019 OR669204 PP187149 PQ467746
F. mariecurieae sp. nov. CMW 58669 = CN071C1 PP187103 PP187123 PP187154 PQ467766
F. mariecurieae sp. nov. CMW 58670 = CN071E4 OR671037 OR669219 PP187159 PP158181
F. mariecurieae sp. nov. CMW-IA 002136 = CMW 60934 = CN071F2 OR671041 — PP187163 PP235237
F. mariecurieae sp. nov. CMW-IA 002137 = CMW 60935 = CN071F3 OR671042 OR669223 PP187164 PQ467767
F. mariecurieae sp. nov. CMW 58671 = CN071F4 OR671043 OR669224 PP187165 PP158185
F. mariecurieae sp. nov. CMW 58672 = CN071H1 OR671052 OR669230 PP187169 PQ467768
F. mariecurieae sp. nov. CBS 152079 = CMW 58673 = CN072A3 OR671063 OR669239 PP187181 PP158192
F. mariecurieae sp. nov. CMW 58674 = CN072B2 OR671071 OR669246 PP187184 PP235241
F. mariecurieae sp. nov. CMW 58675 = CN072B6 OR671073 OR669248 PP187185 PQ467769
F. mariecurieae sp. nov. CMW 58676 = CN072E2 OR671075 OR669250 PP187186 PQ467770
F. mariecurieae sp. nov. CMW 58677 = CN104C2 OR671081 OR669256 PP187187 PP235243
F. mariecurieae sp. nov. CMW 58678 = CN104E1 OR671093 OR669268 PP187192 PQ467771
F. mariecurieae sp. nov. CMW 58679 = CN106F1 OR671097 OR669269 PP187193 PP158200
F. mariecurieae sp. nov. CMW 58680 = CN106F8 PP187107 — — —
F. mariecurieae sp. nov. CMW-IA 003763 = CMW 61535 = CN106F9 OR671101 OR669273 PP187197 PP235245
F. mariecurieae sp. nov. CMW 58681 = CN106G1 OR671102 OR669274 PP187198 PP158203
F. mariecurieae sp. nov. CMW 58682 = CN106G2 OR671103 — PP187199 PQ467772
F. mariecurieae sp. nov. CMW 58683 = CN106G3 OR671104 — PP187200 —
F. mariecurieae sp. nov. CMW 58684 = CN106G4 OR671105 — — —
F. mariecurieae sp. nov. CN106G5 OR671106 OR669275 PP187201 PP235246
F. mariecurieae sp. nov. CMW-IA 003764 = CMW 61536 = CN110D9 OR671111 OR669277 PP187202 PP235247
F. mariecurieae sp. nov. CMW 58685 = CN110E2 OR671113 OR669278 PP187203 PP158204
F. mariecurieae sp. nov. CN115C6 PP187113 — — —
F. mariecurieae sp. nov. CN115C9 PP187115 — — —
F. mariecurieae sp. nov. CN115D4 PP187116 — — —
F. mariecurieae sp. nov. CN115E8 PP187118 — — —
Fusarium FIESC 27 CMW-IA 003327 = CMW 61371 = CN070G1 OR670993 OR669182 PP187133 PQ276899
Fusarium sp. nov. 1 CMW-IA 002134 = CMW 60932 = CN071B6 OR671023 OR669208 PP187150 PQ467773
Fusarium sp. nov. 1 CMW-IA 002135 = CMW 60933 = CN071B7 OR671024 OR669209 PP187151 PQ467774

DNA extraction, PCR, and sequencing

Genomic DNA was extracted from 7-d-old fungal cultures grown on ¼PDA and incubated at 25 °C, using the PrepMan Ultra Sample Preparation Reagent (Thermo Fisher Scientific, Waltham, USA) following the manufacturer’s instructions. PCR amplification of the translation elongation factor 1-alpha (TEF), calmodulin (CaM), RNA polymerase largest subunit (RPB1) and RNA polymerase second largest subunit (RPB2) loci was conducted using primer pairs and thermal cycle conditions as described in Table 2. The PCR reactions were set up in 25 μL volumes using 17.3 µL Milli-Q water (Millipore Corporation, Burlington, USA), 2.5 µL 10 × FastStart Taq PCR reaction buffer containing 20 mM MgCl2 (Sigma-Aldrich, Roche Diagnostics, Manheim, Germany), 2.5 µL of 100 mM of each deoxynucleotide (New England Biolabs, Inc., Ipswich, USA), 0.5 µL forward primer (10 µM), 0.5 µL reverse primer (10 µM), 0.5 µL 25 mM MgCl2 (Sigma-Aldrich, Roche Diagnostics), 0.2 µL of 5 U/µL FastStart Taq DNA Polymerase (Sigma-Aldrich, Roche Diagnostics, Manheim, Germany), and 1 µL template DNA. PCR products were prepared for sequencing using 2 µL ExoSAP-IT PCR clean-up reagent (1 U/µL FastAP Thermosensitive Alkaline Phosphatase, 20 U/µL Exonuclease I (Thermo Fisher Scientific, Waltham, USA)) and 5 µL PCR product. Sequencing was done bi-directionally using the BigDye terminator sequencing kit v. 3.1 (Applied Biosystems, Foster City, USA) with the same primers used for PCR amplification. Reactions were analysed on an ABI PRISM 3100 DNA sequencer (Applied Biosystems, Foster City, USA). Contigs were assembled and edited in Geneious Prime v. 2019.2.1 (BioMatters Ltd., Auckland, New Zealand). All sequences generated in this study were deposited in GenBank, with accession numbers provided in Table 1.

Table 2.
Download as
CSV
XLSX

Primer pairs and PCR conditions used in this study.

Locus PCR amplification procedure Primer Primer sequence (5’-3’)* Reference
TEF 95 °C 5 min; 35 cycles of 95 °C 45 s, 52 °C 45 s, 72 °C 90 s; 72 °C 8 min; 10 °C soak EF1 ATGGGTAAGGARGACAAGAC O’Donnell et al. (1998)
EF2 GGARGTACCAGTSATCATG O’Donnell et al. (1998)
CaM 94 °C 90 s; 35 cycles of 94 °C 45 s, 50 °C 45 s, 72 °C 1 min; 72 °C 10 min; 10 °C soak CL1 GARTWCAAGGAGGCCTTCTC O’Donnell et al. (2000)
CL2A TTTTTGCATCATGAGTTGGAC O’Donnell et al. (2000)
RPB1 94 °C 90 s; 5 cycles of 94 °C 45 s, 54 °C 45 s, 72 °C 2 min; 5 cycles of 94 °C 45 s, 53 °C 45 s, 72 °C 2 min; 35 cycles of 94 °C 45 s, 52 °C 45s, 72 °C 2 min; 72 °C 10 min; 10 °C soak Fa CAYAARGARTCYATGATGGGWC Hofstetter et al. (2007)
R8 CAATGAGACCTTCTCGACCAGC O’Donnell et al. (2010)
94 °C 90 s; 5 cycles of 94 °C 45 s, 56 °C 45 s, 72 °C 2 min; 5 cycles of 94 °C 45 s, 55 °C 45 s, 72 °C 2 min; 35 cycles of 94 °C 45 s, 54 °C 45s, 72 °C 2 min; 72 °C 10 min; 10 °C soak F8 TTCTTCCACGCCATGGCTGGTCG O’Donnell et al. (2010)
G2R GTCATYTGDGTDGCDGGYTCDCC O’Donnell et al. (2010)
RPB2 95 °C 5 min; 40 cycles of 94 °C 30 s, 51 °C 90 s, 68 °C 2 min; 68 °C 5 min; 10 °C soak 5F2 GGGGWGAYCAGAAGAAGGC Reeb et al. (2004)
7Cr CCCATRGCTTGYTTRCCCAT Liu et al. (1999)
95 °C 5 min; 40 cycles of 94 °C 30 s, 51 °C 90 s, 68 °C 2 min; 68 °C 5 min; 10 °C soak 7Cf ATGGGYAARCAAGCYATGGG Liu et al. (1999)
11ar GCRTGGATCTTRTCRTCSACC Liu et al. (1999)

* R = A or G; S = C or G; W = A or T; Y = C or T.

Phylogenetic analyses

Initial identifications of all Fusarium strains relied on BLAST search comparisons against the Fusarium-MLST database (https://fusarium.mycobank.org). These results were then used to produce a reference dataset for the FIESC using previously deposited sequences obtained from the NCBI nucleotide database, largely based on O’Donnell et al. (2009) and Xia et al. (2019) (Suppl. material 5). Several phylogenetic trees were computed. The first included selected reference and newly generated sequences, using TEF, CaM and RPB2. Multi- and single-gene trees were calculated from these datasets, with final identifications being based on these trees. We also computed a phylogeny using a more comprehensive dataset based on TEF. This phylogeny included all strains obtained from our study, as well as those strains from Avila et al. (2019), Botha et al. (2014), Crous et al. (2021), Lombard et al. (2022), O’Donnell et al. (2009), O’Donnell et al. (2012), Tan and Shivas (2023), Tan and Shivas (2024) and Xia et al. (2019) that contained highly similar identities to ours. The datasets were aligned using MAFFT v. 7.427 (Katoh and Standley 2013) with the G-INS-I option selected in Geneious Prime. For the concatenated dataset, each gene region was treated as a separate partition. Maximum Likelihood (ML) trees were calculated in IQ-TREE v. 2.1.2 (Nguyen et al. 2015) with the General Time Reversible nucleotide substitution model with gamma distribution with invariant sites (GTR+G+I) applied to each partition. Support of nodes was calculated with a standard nonparametric bootstrap analysis with 1,000 replicates (Felsenstein 1985). The resulting trees were visualised using Figtree v. 1.4.4 and edited in Affinity Designer v. 1.7.3 (Serif (Europe) Ltd, Nottingham, UK).

Morphological characterisation

Fusarium strains were characterised based on macro- and micromorphological features (Leslie and Summerell 2006; Aoki et al. 2013; Sandoval-Denis et al. 2018; Yilmaz et al. 2021). After a 7 d incubation on synthetic nutrient-poor agar (SNA) (Nirenberg 1976) at 25 °C, agar plugs were removed from the colony edges with a 5 mm diameter cork borer and transferred to PDA, oatmeal agar (OA) and SNA for colony morphology and pigmentation assessment. The plates containing the agar plugs were incubated under different light conditions for 7 d, which included 24 h darkness, 24 h near-ultraviolet (nUV) light and a 12/12 h dark/nUV light cycle. Colony colour and codes used in descriptions followed the Methuen Handbook of Colour (Kornerup and Wanscher 1978). Colony growth rates were evaluated on PDA incubated for 7 d at 10–35 °C with 5 °C intervals in 24 h darkness. Colony measurements were recorded daily in four perpendicular directions. Colony images were captured with a Sony Alpha a7 III camera equipped with a Sony FE 90 mm f/2.8 Macro G OSS lens (Tokyo, Japan). Sporodochial formation was evaluated after a 7 d incubation period at 25 °C under a 12/12 h dark/nUV light cycle on SNA and WA, both supplemented with sterilised pieces of carnation leaves. Micromorphological characteristics were examined with a Zeiss AXIO Imager.A2 compound and AXIO Zoom.V16 microscope equipped with an AxioCaM 512 colour camera driven by Zen Blue 3.2 software (Carl Zeiss CMP, Göttingen, Germany). Conidia and other morphological structures were measured using up to 50 measurements each in NIS-Elements Basic Research software v. 4.30.00 (Nikon Europe B.V.). Photographic plates were prepared using Affinity Designer v. 1.7.3 (Serif (Europe) Ltd, Nottingham, UK).

Results

Identifications and phylogenetic analyses

Isolations from the 95 mixed pasture grass samples collected in the Eastern Cape resulted in 708 strains isolated, with 55 genera and 133 species identified (Dewing et al. 2025). Of the 207 strains identified as Fusarium isolated from 12 of the 14 farms, 155 belonged to the Fusarium incarnatum-equiseti species complex (FIESC) (Table 1). The aligned concatenated dataset included 120 taxa and was 2,954 bp long (CaM: 1–644; RPB2_1: 645–1,471; RPB2_2: 1,471–2,334; TEF: 2,335–2,954). Fusarium concolor (NRRL 13459T) was selected as the outgroup. The obtained ML tree resolved strains into three main clades, including the Incarnatum-clade, Equiseti-clade and Camptoceras-clade (O’Donnell et al. 2009; Xia et al. 2019; Han et al. 2023) (Fig. 1). Strains isolated from pastures represented 11 species, with five well-supported clades representing new species. Individual gene phylogenies for CaM, RPB2 and TEF were used to assess these clades, applying genealogical concordance phylogenetic species recognition (GCPSR: Taylor et al. (2000)) (Suppl. materials 1–3). In all analyses, strains of the new species showed no discordance, noting that the branches holding F. mariecurieae did not have support in the CaM and RPB2 phylogenies.

Figure 1. 

Maximum likelihood phylogenetic tree of the Fusarium incarnatum-equiseti species complex based on a concatenated dataset, CaM, RPB2 and TEF. Strains of species isolated from this study are shown in black bold text; strains of new species are indicated in red bold text. The tree was rooted to Fusarium concolor. Branch support in nodes higher than 80% are indicated at relevant branches (T = ex-type, ET = epitype, NT = neotype).

Incarnatum-clade—We identified five species in the Incarnatum-clade, including F. coffeatum (FIESC 28; n = 7), F. goeppertmayerae (n = 14) and the clade we introduce as F. mariecurieae (n = 33) below (Fig. 1, Suppl. materials 1–3). Strains CMW 58691 and CMW 60930 showed variation in TEF by at least 11 bp but had similar CaM and RPB2 sequences from other F. goeppertmayerae strains. Fusarium goeppertmayerae was described based on a single isolate (BRIP 64547dT), and capturing this type of infraspecies variation is important to better establish its species boundaries. We provide a description of the species below in the Taxonomy section because Tan and Shivas (2023) did not provide this when naming their species. Two additional new species were isolated, including Fusarium FIESC 27 (O’Donnell et al. 2009) (n = 1) and Fusarium sp. nov. 1 (n = 2). However, due to the absence of key microscopic characteristics, we opted to not introduce names for these until additional strains are collected.

Equiseti-clade—Five of our species were resolved in the Equiseti-clade, from which F. brevicaudatum (FIESC 6; n = 2), F. clavus (FIESC 5; n = 19), F. croceum (FIESC 10; n = 55) and F. heslopiae (n = 1) are known species, while F. cumulatum (n = 4) is described below as a new species (Fig. 1, Suppl. materials 1–3). The F. clavus clade contains a lot of variation. In the TEF phylogeny, F. clavus strains form a unique group with F. tangerrinum, its closest relative. However, in RPB2, both F. tangerrinum and F. extenuatum resolve inside the broader F. clavus clade. In the CaM phylogeny, F. tangerrinum also resolves inside F. clavus, but F. extenuatum is a distant relative. Future work is needed on this group. Our F. croceum strains consistently formed a distinct clade closely related to other F. croceum strains (including the ex-type CBS 131777T), with ours differing by at least 9, 8 and 27 bp for CaM, RPB2 and TEF, respectively. Based on these findings, we could introduce a new species for the clade. However, at present we propose that our strains represent new genotypes of F. croceum with additional strains that will be needed in the future. Finally, we identify strain CN071C8 as F. heslopiae, a species originally introduced based solely on a TEF sequence, with no morphological description provided (Tan and Shivas 2024).

Camptoceras-clade—We identified a new species in the Camptoceras-clade, which we introduce below as F. pascuum (n = 17) (Fig. 1, Suppl. materials 1–3). The new species is a close relative of F. fecundum.

Taxonomy

Fusarium cumulatum Dewing, Visagie & Yilmaz, sp. nov.

MycoBank No: MycoBank No: 855721
Fig. 2

Etymology.

Latin, cumulatum, meaning to accumulate or heap up, named for its abundant chlamydospore formation.

Type.

South Africa • Eastern Cape, from mixed pasture samples, May 2020, collected by A. Davis (holotype: PRU(M) 4601, dried specimen in a metabolically inactive state); (ex-type strain: CBS 151773 = CMW 58688 = CN104D3).

Figure 2. 

Fusarium cumulatum (CBS 151773, ex-type culture) A colonies front (top row) and reverse (bottom row) on PDA after 7 d at 25 °C light, dark and nUV and OA after 7 d at 25 °C dark (from left to right), respectively B sporodochial formation on the surface of carnation leaves C, D sporodochial Sporodochial conidiophores and phialides E–G aerial Sporodochial conidiophores and phialides H–M intercalary and terminal chlamydospores N sporodochial conidia. Scale bars: 10 μm.

Description.

Conidiophores borne on aerial mycelium scarce, 13–71 μm tall, unbranched, bearing terminal phialides, often reduced to single phialides; aerial phialides scarce, monophialidic, subulate to subcylindrical, proliferating percurrently, smooth- and thin-walled, 2.5–20 × 2–4 μm, with inconspicuous thickening; aerial conidia absent. Sporodochia orange, present on the surface of carnation leaves and on agar. Sporodochial conidiophores densely and irregularly branched, bearing apical whorls of 2–5 phialides; sporodochial phialides monophialidic, subulate to subcylindrical, 7–16.5 × 2–4 μm, smooth, thin-walled, with inconspicuous periclinal thickening; sporodochial conidia falcate, sometimes becoming sinuate, slender, curved dorsiventrally, tapering towards both ends, with an elongated or whip-like curved apical cell and a barely notched to prominently extended basal cell, 1–5-septate, hyaline, smooth- and thin-walled; 1-septate conidia 16 × 4 μm (n = 1); 2-septate conidia 18–30 × 3–4 μm (av. 25.2 × 3.6 μm) (n = 3), 3-septate conidia 23–42 × 2.5–4 μm (av. 25.2 × 3.5 μm) (n = 15), 4-septate conidia 25.5–54.5 × 2.5–4 μm (av. 43.0 × 3.4 μm) (n = 14), 5-septate conidia 38–57 × 3–4.5 μm (av. 49.1 × 3.8 μm) (n = 17). Chlamydospores abundant, globose to subglobose, subhyaline, smooth- to slightly rough-walled, terminal or intercalary, solitary or in pairs forming chains, 8–19 μm diam.

Culture characteristics.

Colonies on PDA incubated at 25 °C in the dark with an average radial growth rate of 2–8 mm/d, reaching 44–46 mm diam at 25 °C; surface white, flat, felty to velvety, radiate, with abundant aerial mycelium, margin irregular. Additional colony diam (after 7 d, in mm): PDA 10 °C 13–15; PDA at 15 °C 22–26; PDA at 20 °C 27–32; PDA at 30 °C 64–75; PDA at 35 °C 0–2. Odour absent. Reverse yellowish white (2A2). Diffusible pigments absent. On OA in the dark, occupying an entire 90 mm Petri dish in 7 d; surface white to pale yellow, flat, felty to velvety, radiate, with abundant aerial mycelium, margin irregular, filiform. Reverse yellowish white (4A2). Diffusible pigments absent. On SNA with sparse aerial mycelium, sporulation moderate on the surface of the medium.

Additional materials examined.

South Africa • Eastern Cape, from mixed pasture samples, May 2020, collected by A. Davis, isolated by C. Dewing, Humansdorp area: CMW 58686 = CN071B9, CMW 58687 = CN071E5, close to Villa Fonte: CMW-IA 002138 = CMW 60936 = CN071G4.

Notes.

Fusarium cumulatum belongs to the Equiseti-clade and is closely related to F. arcuatisporum (FIESC 7) (Wang et al. 2019), F. brevicaudatum (FIESC 6) (Xia et al. 2019), F. heslopiae (Tan and Shivas 2024), F. longicaudatum (Xia et al. 2019), F. khuzestanicum and F. oryzicola (Afzalinia et al. 2024). No aerial phialides or conidia were observed for the closely related species (Wang et al. 2019; Xia et al. 2019; Afzalinia et al. 2024) compared to the few scarce monophialides we recorded for F. cumulatum. Sporodochia and chlamydospores were present in F. cumulatum and its closely related species, whereas F. oryzicola lacked chlamydospore formation (Wang et al. 2019; Xia et al. 2019; Afzalinia et al. 2024). Sporodochial conidia of F. cumulatum (1–5-septate; 16–57 × 2.5–4 μm) are similar in length to F. arcuatisporum (5-septate; 29–49.5 × 4–6 μm) (Wang et al. 2019) and F. brevicaudatum (1–5-septate; 8–64 × 3–5 μm) (Xia et al. 2019), while generally being shorter than those observed in F. khuzestanicum (4–7(–9)-septate; 48.5–82 × 2.7–4.3 μm) (Afzalinia et al. 2024), F. longicaudatum ((3–)5–6(–7)-septate; 45–81 × 4–5 μm) (Xia et al. 2019) and F. oryzicola (4–7-septate; 33.5–77.9 × 3–4 μm) (Afzalinia et al. 2024). Colony colour on PDA differs between F. cumulatum and closely related species (Wang et al. 2019; Xia et al. 2019; Afzalinia et al. 2024) as other species show more colour across the surface and reverse compared to the white surface and yellowish white (2A2) reverse of F. cumulatum, whereas the colony colour of F. khuzestanicum and F. oryzicola is white to pale grey. The growth rate after 7 d on PDA for F. cumulatum (44–46 mm) is slower than that of F. arcuatisporum (48–53 mm) (Wang et al. 2019), F. brevicaudatum (50–58 mm) (Xia et al. 2019) and F. longicaudatum (full 90 mm plate) (Xia et al. 2019). The growth rate for F. khuzestanicum (74–76 mm) (Afzalinia et al. 2024) and F. oryzicola (74 mm) (Afzalinia et al. 2024) was measured after 5 d on PDA but appears to be faster than that of F. cumulatum. No morphological data is currently available for F. heslopiae to compare with. Pairwise comparisons revealed that F. cumulatum differs from other species by at least 3, 6 and 16 bp for CaM, RPB2 and TEF, respectively.

Fusarium goeppertmayerae Y.P. Tan & R.G. Shivas, Index of Australian Fungi 5: 7. 2023.

MycoBank No: MycoBank No: 900363
Fig. 3

Type.

Australia • Queensland, Bongeen, from the peduncle of Zea mays (Poaceae), 25 Feb. 2016, B. Thrift (holotype: BRIP 64547d, ex-type: CBS 150772).

Figure 3. 

Fusarium goeppertmayerae (CBS 151775) A colonies front (top row) and reverse (bottom row) on PDA after 7 d at 25 °C light, dark and nUV and OA after 7 d at 25 °C dark (from left to right), respectively B sporodochial formation on the surface of carnation leaves C sporodochial Sporodochial conidiophores D–I aerial mono- and polyphialides J–K aerial conidia L sporodochial conidia. Scale bars: 10 μm.

Description.

Conidiophores borne on aerial mycelium, 8.5–98 um tall, unbranched, sympodial, bearing terminal or lateral phialides, often reduced to single phialides; aerial phialides mono- and polyphialidic, subulate to subcylindrical, proliferating percurrently, smooth- and thin-walled, 4–22 × 1.5–5 μm, with inconspicuous thickening; aerial conidia mostly fusiform, slender, curved dorsiventrally, no apparent tapering observed at ends, blunt to conical and straight to slightly curved apical cell and a blunt to papillate basal cell, 0–3-septate, 0-septate conidia: 7–22 × 2–5 μm (av. 15.0 × 3.4 μm) (n = 9); 1-septate conidia: 12–19 × 2.5–4 μm (av. 15.6 × 3.4 μm) (n = 13); 2-septate conidia: 16–20 × 3.5–4 μm (av. 18.2 × 3.8 μm) (n = 2); 3-septate conidia: 21–31 × 3.5–4 μm (av. 23.9 × 3.9 μm) (n = 6). Sporodochia pale yellow to white, formed between aerial mycelia around the carnation leaves. Sporodochial conidiophores densely and irregularly branched, bearing apical whorls of 2–3 phialides; sporodochial phialides monophialidic, subulate to subcylindrical, 6–12 × 1.5–4 μm, smooth, thin-walled, with inconspicuous periclinal thickening; sporodochial conidia falcate, curved dorsiventrally, tapering towards both ends, with a slightly curved apical cell and a blunt to foot-like basal cell, (1–)3–5-septate, hyaline, smooth- and thin-walled; 1-septate conidia: 12–17 × 3 μm (av. 14.4 × 3.2 μm) (n = 2); 3-septate conidia: 19–36 × 3 × 4 μm (av. 30.0 × 3.8 μm) (n = 23); 4-septate conidia: 30.5–36 × 4–5 μm (av. 33.2 × 4.3 μm) (n = 4); 5-septate conidia: 30 × 5 μm (n = 1). Chlamydospores not observed.

Culture characteristics.

Colonies on PDA incubated at 25 °C in the dark with an average radial growth rate of 1–15 mm/d and occupying an entire 90 mm Petri dish in 7 d; surface white, radiate, aerial mycelium felty to velvety, margin irregular, filiform. Additional colony diam (after 7 d, in mm): PDA at 10 °C 14–19; PDA at 15 °C 37–43; PDA at 20 °C 63–70; PDA at 30 °C 40–75; PDA at 35 °C 0–2. Odour absent. Reverse pale yellow. Diffusible pigments absent. On OA in the dark, occupying an entire 90 mm Petri dish in 7 d; surface white, flat, slightly felty to velvety, aerial mycelium scant, margin irregular, filiform. Reverse pale luteous, without diffusible pigments. On SNA with sparse aerial mycelium, sporulation moderate on the surface of the medium.

Materials examined.

South Africa • Eastern Cape, from mixed pasture samples, May 2020, collected by A. Davis, isolated by C. Dewing, close to Gamtoos River Mouth: CBS 151775 = CMW 58689 = CN040I5, Outside Humansdorp, close to Clarkson: CMW 58690 = CN070F3, CMW 58696 = CN071I8, CMW-IA 003340 = CMW 61384 = CN071H2, CMW 58693 = CN071H8, Humansdorp area: CMW 58691 = CN070G8, CMW 58692 = CN070G9, CMW-IA 002132 = CMW 60930 = CN070H9, CMW 58697 = CN104D4, CMW 58698 = CN106F2, CMW 58699 = CN106F3, CMW 58700 = CN106F4, close to Tsitsikamma on Sea: CMW 58694 = CN071I6, CMW 58695 = CN071I7, CMW 58696 = CN071I8.

Notes.

Fusarium goeppertmayerae belongs to the Incarnatum-clade and is closely related to the undescribed Fusarium FIESC 22 isolated from the human sinus cavity (O’Donnell et al. 2009) and F. sylviaearleae isolated from a leaf lesion of Sporobolus natalensis (Poaceae) (Tan and Shivas 2023). No morphological data are available for Fusarium FIESC 22 or F. sylviaearleae. Furthermore, we demonstrate that strains NRRL 32865 and NRRL 13335, previously considered to belong to F. guilinense, belong to F. goeppertmayerae, with F. guilinense (LC12160T) a distant relative.

Fusarium mariecurieae Dewing, Visagie & Yilmaz, sp. nov.

MycoBank No: MycoBank No: 855722
Fig. 4

Etymology.

Latin, mariecurieae, named after Maria Salomea Skłodowska-Curie (known simply as Marie Curie) (1867–1934), who was a renowned physicist and chemist known for her pioneering research on radioactivity. We also chose this name, as this study was supported by the Marie Skłodowska‐Curie Actions (MSCA) grant (number 101008129), project acronym “Mycobiomics”.

Figure 4. 

Fusarium mariecurieae (CBS 152079, ex-type culture) A colonies front (top row) and reverse (bottom row) on PDA after 7 d at 25 °C light, dark and nUV and OA after 7 d at 25 °C dark (from left to right), respectively B sporodochial formation on the surface of carnation leaves C, D sporodochial Sporodochial conidiophores and phialides E–G aerial Sporodochial conidiophores H–I mono- and polyphialides J–K aerial conidia L sporodochial conidia. Scale bars: 10 μm.

Type.

South Africa • Eastern Cape, from mixed pasture samples, May 2020, collected by A. Davis (holotype: PRU(M) 4611, dried specimen in a metabolically inactive state; ex-type strain: CBS 152079 = CMW 58673 = CN072A3).

Description.

Conidiophores borne on aerial mycelium, 13–106 μm tall, unbranched, sympodial or irregularly branched, bearing terminal or lateral phialides, often reduced to single phialides; aerial phialides mono- and polyphialidic, subulate to subcylindrical, proliferating percurrently, smooth- and thin-walled, 3.5–28.5 × 1.5–4 μm, with inconspicuous thickening; aerial conidia ellipsoidal, fusiform, slightly allantoid to falcate, slender, curved dorsiventrally and more pronounced on the apical half, tapering towards both ends, with a blunt to conical and straight to slightly curved apical cell and a blunt to papillate basal cell, 0–3(–5)-septate; 0-septate conidia: 8–11 × 2.5–3 μm (av. 9.6 × 2.6 μm) (n = 2); 1-septate conidia: 11–20 × 3–4 μm (av. 15.6 × 3.3 μm) (n = 11); 2-septate conidia: 15–23 × 3–4 μm (av. 18.7 × 3.6 μm) (n = 6); 3-septate conidia: 18.5–30.5 × 3–5 μm (av. 23.2 × 3.8 μm) (n = 26); 5-septate conidia: 33 × 5 μm (n = 1). Sporodochia peach to pale straw, formed abundantly on carnation leaves. Sporodochial conidiophores densely and irregularly branched, bearing apical whorls of 2–3 phialides; sporodochial phialides monophialidic, subulate to subcylindrical, 6–22 × 2–4 μm, smooth, thin-walled, with inconspicuous periclinal thickening; sporodochial conidia falcate, curved dorsiventrally, tapering towards both ends, with a slightly curved apical cell and a blunt to foot-like basal cell, (1–)3–5-septate, hyaline, smooth- and thin-walled; 1-septate conidia: 12–17 × 3 μm (av. 14.4 × 3.2 μm) (n = 2); 3-septate conidia: 19–36 × 3–4 μm (av. 30.0 × 3.8 μm) (n = 23); 4-septate conidia: 31–36 × 4–5 μm (av. 33.2 × 4.3 μm) (n = 4); 5-septate conidia: 30 × 5 μm (n = 1). Chlamydospores not observed.

Culture characteristics.

Colonies on PDA incubated at 25 °C in the dark with an average radial growth rate of 5–9 mm/d, occupying an entire 90 mm Petri dish in 7 d; surface white, flat, felty to velvety around the centre, floccose towards the margins, radiate, with abundant aerial mycelium, margin irregular, filiform. Additional colony diam (after 7 d): PDA 10 °C 12–17; PDA at 15 °C 29–40; PDA at 20 °C 48–70; PDA at 30 °C 68–76; PDA at 35 °C 4–6. Odour absent. Reverse yellowish white (3A2). Diffusible pigments absent. On OA in the dark, occupying an entire 90 mm Petri dish in 7 d; surface white, floccose around the centre, flat, felty to velvety towards the margin, radiate, with abundant aerial mycelium, margin irregular, filiform. Reverse yellowish white (2A2). Diffusible pigments absent. On SNA with sparse aerial mycelium, sporulation moderate on the surface of the medium.

Additional materials examined.

South Africa • Eastern Cape, from mixed pasture samples, May 2020, collected by A. Davis, isolated by C. Dewing, Humansdorp area: CMW 58664 = CN070E5, CMW-IA 002131 = CMW 60929 = CN070F5, CMW-IA 003328 = CMW 61372 = CN070G5, CMW 58666 = CN070H6, CBS 151774 = CMW 58667 = CN070I7, CMW 58668 = CN071B2, CMW 58669 = CN071C1, CMW 58670 = CN071E4, CMW-IA 002136 = CMW 60934 = CN071F2, CMW-IA 002137 = CMW 60935 = CN071F3, CMW 58671 = CN071F4, CMW 58676 = CN072E2, CMW 58677 = CN104C2, CMW 58678 = CN104E1, CMW 58679 = CN106F1, CMW 58680 = CN106F8, CMW-IA 003763 = CMW 61535 = CN106F9, CMW 58681 = CN106G1, CMW 58682 = CN106G2, CMW 58683 = CN106G3, CMW 58684 = CN106G4, CN106G5, CMW-IA 003764 = CMW 61536 = CN110D9, CMW 58685 = CN110E2, CN115C6, CN115C9, CN115D4, CN115E8, CMW 61371 = CN070G1, Outside Humansdorp, close to Clarkson: CMW 58665 = CN070G2, CMW 58672 = CN071H1, CMW 58674 = CN072B2, close to Villa Fonte: CMW 58675 = CN072B6.

Notes.

Fusarium mariecurieae belongs to the Incarnatum-clade and is most similar to an unsupported clade containing the following species: F. caatingaense (FIESC 20) (Santos et al. 2019), F. citrullicola (nom. inval.) (Khuna et al. 2022), F. irregulare (FIESC 15) (Wang et al. 2019), F. luffae (FIESC 18) (Wang et al. 2019), F. mianyagense (Han et al. 2023), F. multiceps (FIESC 19) (Xia et al. 2019), F. pernambucanum (FIESC 17) (Santos et al. 2019) and F. sulawesiense (FIESC 16) (Maryani et al. 2019). Fusarium mariecurieae produces both aerial mono- and polyphialides compared to F. irregulare that only produces monophialides (Wang et al. 2019), F. luffae that produces only polyphialides (Wang et al. 2019) and F. mianyagense that lacks aerial phialides (Han et al. 2023). Aerial conidia from F. mariecurieae (0–3(–5)-septate; 8–30.5 × 3–5 μm) are smaller than that of F. irregulare (mostly 3-septate; 16–38.5 × 3–5 μm) (Wang et al. 2019), F. luffae (3–5)-septate; 26.5–46 × 4–5 μm) (Wang et al. 2019), F. multiceps (1–)3–4(–5)-septate; 16–37 × 3–4 μm) (Xia et al. 2019), F. pernambucanum (1–7)-septate; 7–57 × 2.5–5 μm) (Santos et al. 2019) and F. sulawesiense (3–5(–9)-septate; 20.5–67 × 3.5–6 μm) (Maryani et al. 2019). Aerial conidia from F. caatingaense (0–6-septate; 6–45 × 2.5–5 μm) (Santos et al. 2019) and F. citrullicola (1–5-septate; 8–39 × 2–4.9 μm) (Khuna et al. 2022) were, at their largest, bigger than those of F. mariecurieae, while aerial conidia were absent from F. mianyagense (Han et al. 2023). Sporodochia were absent from F. citrullicola, F. irregulare and F. luffae (Wang et al. 2019), while chlamydospores were absent from F. irregulare, F. luffae, F. mianyagense, F. multiceps and F. sulawesiense (Maryani et al. 2019; Wang et al. 2019; Xia et al. 2019; Han et al. 2023). Sporodochial conidia from F. mariecurieae (1–3(–5)-septate; 12–36 × 3–5 μm) were smaller than that of F. caatingaense (1–5-septate; 15–50 × 2–4.5 μm) (Santos et al. 2019), F. mianyagense (3(–5)-septate; 24.5–36.6 × 2.5–4.9 μm) (Han et al. 2023), F. multiceps ((1–)2–5-septate; 16–46 × 3–4 μm) (Xia et al. 2019) and F. sulawesiense ((3–)5(–6)-septate; 29.5–43.5 × 4–5.5 μm) (Maryani et al. 2019). Colony colour on PDA differs between F. mariecurieae and closely related species (Maryani et al. 2019; Santos et al. 2019; Wang et al. 2019; Xia et al. 2019; Han et al. 2023) as most other species show more colour across the surface and reverse compared to the white surface and yellowish white (3A2) reverse of F. mariecurieae. The growth rate after 7 d on PDA for F. mariecurieae is faster (>90 mm plate) than that of F. citrullicola (68–74.5 mm) (Khuna et al. 2022), F. irregulare (53–59 mm) (Wang et al. 2019), F. luffae (53–57 mm) (Wang et al. 2019) and F. mianyagense (74–80 mm) (Han et al. 2023). The growth of F. multiceps (>90 mm plate) (Xia et al. 2019) is similar to that of F. mariecurieae, while the growth rate in terms of diameter was not reported for F. caatingaense, F. pernambucanum and F. sulawesiense (Maryani et al. 2019; Santos et al. 2019). Pairwise comparisons revealed that F. mariecurieae differs from other species by at least 1, 4 and 12 bp for CaM, RPB2 and TEF, respectively.

Fusarium pascuum Dewing, Visagie & Yilmaz, sp. nov.

MycoBank No: MycoBank No: 855720
Fig. 5

Etymology.

Latin, pascuum, meaning pasture, referring to the species isolated from grass pastures.

Type.

South Africa • Eastern Cape, from mixed pasture samples, May 2020, collected by A. Davis (holotype: PRU(M) 4600, dried specimen in a metabolically inactive state; ex-type strain: CBS 151772 = CMW 58653 = CN159G4 = CN071C4).

Figure 5. 

Fusarium pascuum (CBS 151772, ex-type culture) A colonies front (top row) and reverse (bottom row) on PDA after 7 d at 25 °C light, dark and nUV and OA after 7 d at 25 °C dark (from left to right), respectively B–J aerial Sporodochial conidiophores and phialides K aerial microconidia L, M aerial macroconidia. Scale bars: 10 μm.

Description.

Conidiophores borne on aerial mycelium, 15.5–101 μm tall, unbranched, sympodial or irregularly branched, bearing terminal or lateral phialides, often reduced to single phialides; aerial phialides mono- and polyphialidic, subulate to subcylindrical, proliferating percurrently, smooth- and thin-walled, 4–43 × 1–4.5 μm, with inconspicuous periclinal thickening; aerial conidia fusiform, falcate, slender, curved dorsiventrally and more pronounced on the apical half, tapering towards both ends, with a blunt to conical and straight to slightly curved apical cell and a blunt to papillate basal cell, 0–3-septate conidia; 0-septate conidia: 7–17 × 2–5 μm (av. 11.7 × 3.2 μm) (n = 34); 1-septate conidia: 12–26 × 3–6 μm (av. 19.2 × 3.8 μm) (n = 14); 2-septate conidia: 23–32 × 4–6 μm (av. 26.9 × 4.5 μm) (n = 7); 3-septate conidia: 27–32 × 3–5 μm (av. 29.5 × 4.4 μm) (n = 2). Sporodochia and chlamydospores not observed.

Culture characteristics.

Colonies on PDA incubated at 25 °C in the dark with an average radial growth rate of 3–10 mm/d, reaching 80 mm diam at 25 °C; surface white, flat, felty to velvety, radiate, with abundant aerial mycelium, margin irregular, filiform. Additional colony diam (after 7 d, in mm): PDA at 10 °C 13–15; PDA at 15 °C 36–42; PDA at 20 °C 63–65; PDA at 30 °C 34–39; PDA at 35 °C no growth. Odour absent. Reverse yellowish white (3A2). Diffusible pigments absent. On OA in the dark, occupying an entire 90 mm Petri dish in 7 d; surface white, flat, felty to velvety, radiate, with abundant aerial mycelium, margin irregular, filiform. Reverse yellowish white (3A2). Diffusible pigments absent. On SNA with sparse aerial mycelium, sporulation moderate on the surface of the medium.

Additional materials examined.

South Africa • Eastern Cape, from mixed pasture samples, May 2020, collected by A. Davis, isolated by C. Dewing, Humansdorp area: CMW-IA 003320 = CMW 61364 = CN056A8, CMW 58649 = CN070E7, CMW 58650 = CN070F7, CMW-IA 002133 = CMW 60931 = CN070I3, CMW 58651 = CN070I4, CMW 58652 = CN071B8, CMW 58654 = CN071D3, CMW 58655 = CN071E9, CMW 58662 = CN104D6, CMW 58663 = CN104D7, close to Kou-Kamma: CMW 58656 = CN071F9, Outside Humansdorp, close to Clarkson: CMW 58657 = CN071G8, CMW 58660 = CN071I9, CMW 58661 = CN072A1, close to Tsitsikamma on Sea: CMW 58658 = CN071I3, CMW 58659 = CN071I5.

Notes.

Fusarium pascuum belongs to the Camptoceras-clade (as introduced by Han et al. (2023)) and is closely related to F. fecundum. Both F. pascuum and F. fecundum produce aerial mono- and polyphialides. Aerial conidia from F. pascuum (0–3-septate; 7–32 × 2–6 μm) are comparably smaller than those of F. fecundum ((1–)2–4(–6)-septate; 3.6–35.8 × 3.6–6.8 μm) (Han et al. 2023). Sporodochia and chlamydospores are absent in both F. pascuum and F. fecundum. Colony colour on PDA differs between F. pascuum and F. fecundum, where the former is completely white across the surface and the latter is greyish yellow in the centre, while the reverse of F. pascuum is yellowish white and F. fecundum is just white (Han et al. 2023). The growth rate after 7 d on PDA in F. pascuum (reaching 80 mm) is slightly slower than that of F. fecundum (84–90 mm) (Han et al. 2023). Pairwise comparisons revealed that F. pascuum differs from other species by at least 8, 8 and 23 bp for CaM, RPB2 and TEF, respectively.

Discussion

In a 2020 survey exploring fungal diversity in dairy pastures, 95 mixed pasture samples were collected across 14 dairy farms in the Eastern Cape of South Africa. A total of 155 Fusarium strains, belonging to the Fusarium incarnatum-equiseti species complex (FIESC), were isolated from 12/14 dairy farms. Strains were analysed using a multigene phylogenetic approach, leading to the identification of 11 species, including five that are new. Of these, we opted to formally describe and name F. cumulatum, F. mariecurieae and F. pascuum. Fusarium croceum (n = 55) and F. mariecurieae (n = 33) were the most commonly isolated species, followed by F. clavus (n = 19), F. pascuum (n = 17), F. goeppertmayerae (n = 14), F. coffeatum (n = 7), F. cumulatum (n = 4), F. brevicaudatum (n = 2), Fusarium sp. nov. 1 (n = 2), F. heslopiae (n = 1) and Fusarium FIESC 27 (n = 1). Due to a lack of morphological character development in our strains, two of the new species were not described (e.g., Fusarium FIESC 27, Fusarium sp. nov. 1). In the future, it will be important to obtain additional isolates of the species and name them. Several recently FIESC-introduced species did not include morphological descriptions. This includes F. goeppertmayerae that was introduced based on sequence differences of a TEF sequence in a single isolate (Tan and Shivas 2023). We found several new isolates of this species in pasture samples, and here we provided a morphological description for the species and capture infraspecies variation in its DNA sequences.

Fusarium species are well-known for their frequent association with Poaceae (grasses), but of the 11 species identified, only five had previously been reported from this plant family. Fusarium clavus was reported from Phalaris minor (little seed canary grass), Leucopoa sclerophylla, Secale montanum (wild perennial rye) and Triticum (wheat) from Iran (Xia et al. 2019). Fusarium coffeatum and F. heslopiae were reported from Cynodon nlemfuensis (African Bermuda-grass) and Sporobolus creber (Western Rat-Tail grass), respectively (Lombard et al. 2019; Tan and Shivas 2024), while F. croceum has been isolated from wheat (Triticum sp.) from Iran (Xia et al. 2019). Fusarium goeppertmayerae has not previously been reported from grass species but was reported from maize peduncles from Australia (Tan and Shivas 2023). Given the diverse impacts of FIESC species, especially with regard to their ability to cause plant and animal diseases and produce mycotoxins (Kosiak et al. 2005; Desjardins 2006; O’Donnell et al. 2013; Villani et al. 2016; Munkvold 2017; O’Donnell et al. 2018; Gallo et al. 2022), it is crucial to investigate the potential implications that species present in our dairy pastures could have for animal health. This is especially relevant considering the growing evidence of Fusarium species contributing to toxic effects in livestock grazing on certain grasses (Kellerman et al. 2005; Bourke 2007).

Species previously implicated in kikuyu poisoning were identified in our study. Previous studies have identified Fusarium species as potential causal agents of kikuyu poisoning, a condition characterised by toxic effects in livestock, like cattle, that consume kikuyu grass (Pennisetum clandestinum) (Kellerman et al. 2005; Bourke 2007). Reports of kikuyu poisoning are sporadic in South Africa and Australia and pose significant economic concerns in dairy farming due to high cattle mortality rates (Kellerman et al. 2005; Bourke 2007). While the exact cause of kikuyu poisoning remains uncertain, Ryley et al. (2007) hypothesised that mycotoxins like wortmannin and butenolide produced by species like F. torulosum (Fusarium tricinctum species complex (FTSC)) may be involved. Botha et al. (2014) studied the Fusarium present in Eastern Cape (South Africa) dairy pastures where cattle intoxication outbreaks occurred. Strains were identified based on TEF sequences, and similar to our survey (Dewing et al. 2025), they mostly detected FIESC species and did not detect F. torulosum. Both studies, Botha et al. (2014) and Dewing et al. (2025), detected F. brevicaudatum, F. clavus, F. croceum and the two species we describe above as F. pascuum and F. mariecurieae (Suppl. material 4). Additionally, our study identified F. cumulatum, F. heslopiae, Fusarium FIESC 27 and Fusarium sp. nov. 1, which were not detected in the study by Botha et al. (2014). Conversely, Botha et al. (2014) identified F. tangerrinum and Fusarium FIESC 34 (undescribed), which were not found in our survey.

Although the mycotoxigenic potential of the species described in this study is unknown, members of the FIESC have been reported to produce various mycotoxins (Phillips et al. 1989; Logrieco et al. 1998; Hestbjerg et al. 2002; Kosiak et al. 2005; Villani et al. 2016; O’Donnell et al. 2018). Many of these, especially deoxynivalenol, fumonisins and zearalenone, can adversely affect cattle health, leading to symptoms such as decreased conception rates, reproductive disorders, feed refusal, gastrointestinal problems, immunosuppression, reduced animal performance, tremors, weight loss and even death (Trenholm et al. 1985; European Food Safety Authority 2004; Morgavi and Riley 2007; Fink-Gremmels 2008). However, toxicological information and their effects on animals for some commonly produced secondary metabolites, such as beauvericin, remain unavailable (de Felice et al. 2023; Hasuda and Bracarense 2024). This lack of information is often due to the absence of regulations for these mycotoxins, resulting in a lack of standardised testing methods, as well as limited monitoring and reporting requirements. It is also crucial to consider the potential synergistic, additive, or antagonistic interactions between emerging mycotoxins and other toxins in animal feed, as these combinations could pose unexpected health risks (Křížová et al. 2021). This is particularly true for FIESC that has only occasionally been linked to cattle poisoning, possibly due to a lack of sufficient studies on pasture fungal diversity. Therefore, the presence of the FIESC species in dairy pasture still poses a potential risk of mycotoxin contamination when these grasses are used for animal feed (Botha et al. 2014), and research into their mycotoxins is urgently needed.

Our study provides a valuable insight into the diversity of the FIESC in dairy pastures in the Eastern Cape. The presence of Fusarium species, seemingly in a consistent community in this environment, underscores the importance of further studying these species. Further research must focus on what secondary metabolites, including mycotoxins, these species produce. This will provide insights into their potential impact on cattle health in dairy pastures.

Acknowledgements

We acknowledge Konstanze Bensch (MycoBank curator) for her help regarding Latin names. We are thankful to Anthony Davis and Jan Myburgh for providing the grass samples analysed in this study.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

We are grateful for funding supported by the National Research Foundation (NRF) of South Africa (grant number: 137791) and the Future Leaders – African Independent Research fellowship programme (FLAIR, FLR\R1\201831). The FLAIR fellowship programme is a partnership between the African Academy of Sciences and the Royal Society funded by the UK Government’s Global Challenges Research Fund. This project is partially funded by the European Union’s Horizon 2020 research and innovation programme (RISE) through the Marie Skłodowska-Curie grant agreement No. 101008129, with the project acronym “Mycobiomics” (the lead beneficiaries are Cobus Visagie and Neriman Yilmaz). The authors would like to acknowledge the financial support of MycoKeys and the International Mycological Association. At IMC12 in Maastricht, the Netherlands, on 11 August 2024, the corresponding author, Neriman Yilmaz, was awarded the Young Mycologist Presentation Award, which included a publication prize covering the article processing charges for this manuscript.

Author contributions

Investigation and conceptualisation, C.V., E.S., B.W. and N.Y.; writing—original draft preparation, C.D.; formal analysis, C.D.; resources, C.V., E.S., B.W. and N.Y.; methodology, C.D., C.V. and N.Y.; supervision, C.V., E.S., B.W. and N.Y. All authors have read and agreed to the published version of the manuscript.

Author ORCIDs

Claudette Dewing https://orcid.org/0000-0001-6208-1721

Cobus M. Visagie https://orcid.org/0000-0003-2367-5353

Emma T. Steenkamp https://orcid.org/0000-0003-0217-8219

Brenda D. Wingfield https://orcid.org/0000-0002-6189-1519

Neriman Yilmaz https://orcid.org/0000-0002-4396-4630

Data availability

All sequence data generated for this work can be accessed via GenBank: https://www.ncbi.nlm.nih.gov/genbank/.

References

  • Afzalinia S, Mehrabi-Koushki M, Farokhinejad R (2024) Two new species of Fusarium in the F. incarnatum-equiseti species complex from Oryza sativa in Iran. Antonie van Leeuwenhoek 118: 5. https://doi.org/10.1007/s10482-024-02019-y
  • Aoki T, Smith JA, Mount LL, Geiser DM, O’Donnell K (2013) Fusarium torreyae sp. nov., a pathogen causing canker disease of Florida torreya (Torreya taxifolia), a critically endangered conifer restricted to northern Florida and southwestern Georgia. Mycologia 105: 312–319. https://doi.org/10.3852/12-262
  • Avila CF, Moreira GM, Nicolli CP, Gomes LB, Abreu LM, Pfenning LH, Haidukowski M, Moretti A, Logrieco A, del Ponte EM (2019) Fusarium incarnatum-equiseti species complex associated with Brazilian rice: Phylogeny, morphology and toxigenic potential. International Journal of Food Microbiology 306: 108267. https://doi.org/10.1016/j.ijfoodmicro.2019.108267
  • Bentley AR, Petrovic T, Griffiths SP, Burgess LW, Summerell BA (2007) Crop pathogens and other Fusarium species associated with Austrostipa aristiglumis. Australasian Plant Pathology 36: 434–438. https://doi.org/10.1071/AP07047
  • Botha PR, Meeske R, Snyman HA (2008a) Kikuyu over-sown with ryegrass and clover: Dry matter production, botanical composition and nutritional value. African Journal of Range and Forage Science 25: 93–101. https://doi.org/10.2989/AJRF.2008.25.3.1.598
  • Botha PR, Meeske R, Snyman HA (2008b) Kikuyu over-sown with ryegrass and clover: Grazing capacity, milk production and milk composition. African Journal of Range and Forage Science 25: 103–110. https://doi.org/10.2989/AJRF.2008.25.3.2.599
  • Botha CJ, Truter M, Jacobs A (2014) Fusarium species isolated from Pennisetum clandestinum collected during outbreaks of kikuyu poisoning in cattle in South Africa. Onderstepoort Journal of Veterinary Research 81: e1–e8. https://doi.org/10.4102/ojvr.v81i1.803
  • Brook PJ (1963) Ecology of the fungus Pithomyces chartarum (Berk. & Curt.) M. B. Ellis in pasture in relation to facial eczema disease of sheep. New Zealand Journal of Agricultural Research 6: 147–228. https://doi.org/10.1080/00288233.1963.10418130
  • Crous PW, Lombard L, Sandoval-Denis M, Seifert KA, Schroers HJ, Chaverri P, Gené J, Guarro J, Hirooka Y, Bensch K, Kema GHJ, Lamprecht SC, Cai L, Rossman AY, Stadler M, Summerbell RC, Taylor JW, Ploch S, Visagie CM, Yilmaz N, Frisvad JC, Abdel-Azeem AM, Abdollahzadeh J, Abdolrasouli A, Akulov A, Alberts JF, Araújo JPM, Ariyawansa HA, Bakhshi M, Bendiksby M, Ben Hadj Amor A, Bezerra JDP, Boekhout T, Câmara MPS, Carbia M, Cardinali G, Castañeda-Ruiz RF, Celis A, Chaturvedi V, Collemare J, Croll D, Damm U, Decock CA, de Vries RP, Ezekiel CN, Fan XL, Fernández NB, Gaya E, González CD, Gramaje D, Groenewald JZ, Grube M, Guevara-Suarez M, Gupta VK, Guarnaccia V, Haddaji A, Hagen F, Haelewaters D, Hansen K, Hashimoto A, Hernández-Restrepo M, Houbraken J, Hubka V, Hyde KD, Iturriaga T, Jeewon R, Johnston PR, Jurjević Ž, Karalti I, Korsten L, Kuramae EE, Kušan I, Labuda R, Lawrence DP, Lee HB, Lechat C, Li HY, Litovka YA, Maharachchikumbura SSN, Marin-Felix Y, Matio Kemkuignou B, Matočec N, McTaggart AR, Mlčoch P, Mugnai L, Nakashima C, Nilsson RH, Noumeur SR, Pavlov IN, Peralta MP, Phillips AJL, Pitt JI, Polizzi G, Quaedvlieg W, Rajeshkumar KC, Restrepo S, Rhaiem A, Robert J, Robert V et al. (2021) Fusarium: More than a node or a foot-shaped basal cell. Studies in Mycology 98: 100116. https://doi.org/10.1016/j.simyco.2021.100116
  • Davis AJ, Collett MG, Steyl JCA, Myburgh JG (2021) Hepatogenous photosensitisation in cows grazing turnips (Brassica rapa) in South Africa. Journal of South African Veterinary Association 92: e1–e6. https://doi.org/10.4102/jsava.v92i0.2106
  • Desjardins AE (2006) Fusarium mycotoxins: Chemistry, genetics, and biology. American Phytopathological Society, 260 pp.
  • Dewing C, Yilmaz N, Steenkamp ET, Wingfield BD, Visagie CM (2025) [submitted for review] Capturing the fungal diversity hidden in Eastern Cape dairy pastures. Mycological Progress.
  • di Menna ME, Lauren DR, Poole PR, Mortimer PH, Hill RA, Agnew MP (1987) Zearalenone in New Zealand pasture herbage and the mycotoxin-producing potential of Fusarium species from pasture. New Zealand Journal of Agricultural Research 30: 499–504. https://doi.org/10.1080/00288233.1987.10417963
  • Driehuis F, Spanjer MC, Scholten JM, te Giffel MC (2008) Occurrence of mycotoxins in feedstuffs of dairy cows and sstimation of total dietary intakes. Journal of Dairy Science 91: 4261–4271. https://doi.org/10.3168/jds.2008-1093
  • Edrington T, Kamps-Holtzapple C, Harvey R, Kubena L, Elissalde M, Rottinghaus G (1995) Acute hepatic and renal toxicity in lambs dosed with fumonisin-containing culture material. Journal of Animal Science 73: 508–515. https://doi.org/10.2527/1995.732508x
  • Eskola M, Altieri A, Galobart J (2018) Overview of the activities of the European Food Safety Authority on mycotoxins in food and feed. World Mycotoxin Journal 11: 277–289. https://doi.org/10.3920/WMJ2017.2270
  • EFSA [European Food Safety Authority] (2004) Opinion of the Scientific Panel on contaminants in the food chain [CONTAM] related to Deoxynivalenol (DON) as undesirable substance in animal feed. EFSA Journal 73: 1–42. https://doi.org/10.2903/j.efsa.2004.73
  • Gallo A, Mosconi M, Trevisi E, Santos RR (2022) Adverse effects of Fusarium toxins in ruminants: A review of in vivo and in vitro studies. Dairy 3: 474–499. https://doi.org/10.3390/dairy3030035
  • Golinski P, Kostechi M, Golinska BT, Golinsky PK (2003) Accumulation of mycotoxins in forage for winter pasture during prolonged utilisation of sward. Polish Journal of Veterinary Sciences 6: 81–88.
  • Gott PN, Stam A, Johns A, Miller BG, Bell B, Jenkins T, Murugesan GR (2017) Mycotoxin survey of common Bermudagrass in south-central Florida. Journal of Animal Science 95: 19–20. https://doi.org/10.2527/asasann.2017.039
  • Han SL, Wang MM, Ma ZY, Raza M, Zhao P, Liang JM, Gao M, Li YJ, Wang JW, Hu DM, Cai L (2023) Fusarium diversity associated with diseased cereals in China, with an updated phylogenomic assessment of the genus. Studies in Mycology 104: 87–148. https://doi.org/10.3114/sim.2022.104.02
  • Hestbjerg H, Nielsen KF, Thrane U, Elmholt S (2002) Production of trichothecenes and other secondary metabolites by Fusarium culmorum and Fusarium equiseti on common laboratory media and a soil organic matter agar: An ecological interpretation. Journal of Agriculture and Food Chemistry 50: 7593–7599. https://doi.org/10.1021/jf020432o
  • Hofstetter V, Miadlikowska J, Kauff F, Lutzoni F (2007) Phylogenetic comparison of protein-coding versus ribosomal RNA-coding sequence data: A case study of the Lecanoromycetes (Ascomycota). Molecular Phylogenetics and Evolution 44: 412–426. https://doi.org/10.1016/j.ympev.2006.10.016
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010
  • Kellerman TS, Coetzer JA (1985) Hepatogenous photosensitivity diseases in South Africa. Onderstepoort Journal of Veterinary Research 52: 157–173.
  • Kellerman TS, van der Westhuizen GC, Coetzer JA, Roux C, Marasas WF, Minne JA, Bath GF, Basson PA (1980) Photosensitivity in South Africa. II. The experimental production of the ovine hepatogenous photosensitivity disease geeldikkop (Tribulosis ovis) by the simultaneous ingestion of Tribulus terrestris plants and cultures of Pithomyces chartarum containing the mycotoxin sporidesmin. Onderstepoort Journal of Veterinary Research 47: 231–261.
  • Kellerman TS, Coetzer JAW, Naudé TW, Botha CJ (2005) Plant poisonings and mycotoxicoses of livestock in Southern Africa. Oxford University Press, Cape Town.
  • Khuna S, Kumla J, Thitla T, Nuangmek W, Lumyong S, Suwannarach N (2022) Morphology, molecular identification, and pathogenicity of two novel Fusarium species associated with postharvest fruit rot of Cucurbits in Northern Thailand. Journal of Fungi 8: 1135. https://doi.org/10.3390/jof8111135
  • Kornerup A, Wanscher J (1978) Metheun Hand Book of Colour. Metheun London Ltd, London.
  • Kosiak EB, Holst-Jensen A, Rundberget T, Gonzalez Jaen MT, Torp M (2005) Morphological, chemical and molecular differentiation of Fusarium equiseti isolated from Norwegian cereals. International Journal of Food Microbiology 99: 195–206. https://doi.org/10.1016/j.ijfoodmicro.2004.08.015
  • Křížová L, Dadáková K, Dvořáčková M, Kašparovský T (2021) Feedborne mycotoxins beauvericin and enniatins and livestock animals. Toxins 13: 32. https://doi.org/10.3390/toxins13010032
  • Laurence MH, Walsh JL, Shuttleworth LA, Robinson DM, Johansen RM, Petrovic T, Vu TTH, Burgess LW, Summerell BA, Liew ECY (2016) Six novel species of Fusarium from natural ecosystems in Australia. Fungal Diversity 77: 349–366. https://doi.org/10.1007/s13225-015-0337-6
  • Leslie JF, Zeller KA, Logrieco A, Mulè G, Moretti A, Ritieni A (2004) Species diversity of and toxin production by Gibberella fujikuroi species complex strains isolated from native prairie grasses in Kansas. Applied and Environmental Microbiology 70: 2254–2262. https://doi.org/10.1128/AEM.70.4.2254-2262.2004
  • Logrieco A, Moretti A, Castella G, Kostecki M, Golinski P, Ritieni A, Chelkowski J (1998) Beauvericin production by Fusarium species. Applied and Environmental Microbiology 64: 3084–3088. https://doi.org/10.1128/AEM.64.8.3084-3088.1998
  • Lombard L, van Doorn R, Crous P (2019) Neotypification of Fusarium chlamydosporum-a reappraisal of a clinically important species complex. Fungal Systematics and Evolution 4: 183–200. https://doi.org/10.3114/fuse.2019.04.10
  • Lombard L, van Doorn R, Groenewald JZ, Tessema T, Kuramae EE, Etolo DW, Raaijmakers JM, Crous PW (2022) Fusarium diversity associated with the Sorghum-Striga interaction in Ethiopia. Fungal Systematics and Evolution 10: 177–215. https://doi.org/10.3114/fuse.2022.10.08
  • Marais JP (2001) Factors affecting the nutritive value of kikuyu grass (Pennisetum clandestinum) - A review. Tropical Grasslands 35: 65–84.
  • Maryani N, Sandoval-Denis M, Lombard L, Crous PW, Kema GHJ (2019) New endemic Fusarium species hitch-hiking with pathogenic Fusarium strains causing Panama disease in small-holder banana plots in Indonesia. Persoonia 43: 48–69. https://doi.org/10.3767/persoonia.2019.43.02
  • Morgavi DP, Riley RT (2007) An historical overview of field disease outbreaks known or suspected to be caused by consumption of feeds contaminated with Fusarium toxins. Animal Feed Science and Technology 137: 201–212. https://doi.org/10.1016/j.anifeedsci.2007.06.002
  • Newsholme SJ, Kellerman TS, van der Westhuizen GCA, Soley JT (1983) Intoxication of cattle on kikuyu grass following army worm (Spodoptera exempta) invasion. Onderstepoort Journal of Veterinary Research 50: 157–167.
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32: 268–274. https://doi.org/10.1093/molbev/msu300
  • Nichea MJ, Palacios SA, Chiacchiera SM, Sulyok M, Krska R, Chulze SN, Torres AM, Ramirez ML (2015) Presence of multiple mycotoxins and other fungal metabolites in native grasses from a wetland ecosystem in Argentina intended for grazing cattle. Toxins 7: 3309–3329. https://doi.org/10.3390/toxins7083309
  • Nirenberg H (1976) Untersuchungen über die morphologische und biologische Differenzierung in der Fusarium-Sektion Liseola. Technische Universität Berlin, Fachbereich Internationale Agrarentwicklung.
  • Nor Azliza I, Hafizi R, Nurhazrati M, Salleh B (2014) Production of major mycotoxins by Fusarium species isolated from wild grasses in peninsular Malaysia. Sains Malaysiana 43: 89–94.
  • O’Donnell K, Nirenberg HI, Aoki T, Cigelnik E (2000) A multigene phylogeny of the Gibberella fujikuroi species complex: Detection of additional phylogenetically distinct species. Mycoscience 41: 61–78. https://doi.org/10.1007/BF02464387
  • O’Donnell K, Sutton DA, Rinaldi MG, Gueidan C, Crous PW, Geiser DM (2009) Novel multilocus sequence typing scheme reveals high genetic diversity of human pathogenic members of the Fusarium incarnatum-F. equiseti and F. chlamydosporum species complexes within the United States. Journal of Clinical Microbiology 47: 3851–3861. https://doi.org/10.1128/JCM.01616-09
  • O’Donnell K, Sutton DA, Rinaldi MG, Sarver BA, Balajee SA, Schroers H-J, Summerbell RC, Robert VA, Crous PW, Zhang N (2010) Internet-accessible DNA sequence database for identifying fusaria from human and animal infections. Journal of Clinical Microbiology 48: 3708–3718. https://doi.org/10.1128/JCM.00989-10
  • O’Donnell K, Humber RA, Geiser DM, Kang S, Park B, Robert VA, Crous PW, Johnston PR, Aoki T, Rooney AP, Rehner SA (2012) Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST. Mycologia 104: 427–445. https://doi.org/10.3852/11-179
  • O’Donnell K, Rooney AP, Proctor RH, Brown DW, McCormick SP, Ward TJ, Frandsen RJ, Lysøe E, Rehner SA, Aoki T, Robert VA, Crous PW, Groenewald JZ, Kang S, Geiser DM (2013) Phylogenetic analyses of RPB1 and RPB2 support a middle Cretaceous origin for a clade comprising all agriculturally and medically important fusaria. Fungal Genetics and Biology 52: 20–31. https://doi.org/10.1016/j.fgb.2012.12.004
  • O’Donnell K, McCormick SP, Busman M, Proctor RH, Ward TJ, Doehring G, Geiser DM, Alberts JF, Rheeder JP (2018) Marasas et al. 1984 “Toxigenic Fusarium Species: Identity and mycotoxicology” revisited. Mycologia 110: 1058–1080. https://doi.org/10.1080/00275514.2018.1519773
  • Penagos-Tabares F, Khiaosa-Ard R, Nagl V, Faas J, Jenkins T, Sulyok M, Zebeli Q (2021) Mycotoxins, phytoestrogens and other secondary metabolites in Austrian pastures: Occurrences, contamination levels and implications of geo-climatic factors. Toxins 13: 460. https://doi.org/10.3390/toxins13070460
  • Phillips N, Goodwin J, Fraiman A, Cole R, Lynn D (1989) Characterization of the Fusarium toxin equisetin: The use of phenylboronates in structure assignment. Journal of the American Chemical Society 111: 8223–8231. https://doi.org/10.1021/ja00203a025
  • Reeb V, Lutzoni F, Roux C (2004) Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Molecular Phylogenetics and Evolution 32: 1036–1060. https://doi.org/10.1016/j.ympev.2004.04.012
  • Reed KFM, Moore DD (2009) A preliminary survey of zearalenone and other mycotoxins in Australian silage and pasture. Animal Production Science 49: 696–703. https://doi.org/10.1071/EA08164
  • Ryley M, Bourke C, Liew ECY, Summerell B (2007) Is Fusarium torulosum the causal agent of kikuyu poisoning in Australia? Australasian Plant Disease Notes 2: 133–135. https://doi.org/10.1071/DN07053
  • Sandoval-Denis M, Guarnaccia V, Polizzi G, Crous PW (2018) Symptomatic citrus trees reveal a new pathogenic lineage in Fusarium and two new Neocosmospora species. Persoonia 40: 1–25. https://doi.org/10.3767/persoonia.2018.40.01
  • Santos A, Trindade JVC, Lima CS, Barbosa RDN, da Costa AF, Tiago PV, de Oliveira NT (2019) Morphology, phylogeny, and sexual stage of Fusarium caatingaense and Fusarium pernambucanum, new species of the Fusarium incarnatum-equiseti species complex associated with insects in Brazil. Mycologia 111: 244–259. https://doi.org/10.1080/00275514.2019.1573047
  • Skládanka J, Nedělník J, Adam V, Doležal P, Moravcová H, Dohnal V (2011) Forage as a primary source of mycotoxins in animal diets. International Journal of Environmental Research and Public Health 8: 37–50. https://doi.org/10.3390/ijerph8010037
  • Smith JF, di Menna ME, McGowan LT (1990) Reproductive performance of Coopworth ewes following oral doses of zearalenone before and after mating. Journal of Reproduction and Fertility 89: 99–106. https://doi.org/10.1530/jrf.0.0890099
  • Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. https://doi.org/10.1006/fgbi.2000.1228
  • Trenholm HL, Thompson BK, Hartin KE, Greenhalgh R, McAllister AJ (1985) Ingestion of vomitoxin (deoxynivalenol)-contaminated wheat by nonlactating dairy cows. Journal of Dairy Science 68: 1000–1005. https://doi.org/10.3168/jds.S0022-0302(85)80921-8
  • Truter WF, Botha PR, Dannhauser CS, Maasdorp BV, Miles N, Smith A, Snyman HA, Tainton NM (2015) Southern African pasture and forage science entering the 21st century: Past to present. African Journal of Range and Forage Science 32: 73–89. https://doi.org/10.2989/10220119.2015.1054429
  • van der Colf J, Botha PR, Meeske R, Truter WF (2015) Grazing capacity, milk production and milk composition of kikuyu over-sown with annual or perennial ryegrass. African Journal of Range and Forage Science 32: 143–151. https://doi.org/10.2989/10220119.2015.1052096
  • Villani A, Moretti A, de Saeger S, Han Z, di Mavungu JD, Soares CMG, Proctor RH, Venâncio A, Lima N, Stea G, Paciolla C, Logrieco AF, Susca A (2016) A polyphasic approach for characterization of a collection of cereal isolates of the Fusarium incarnatum-equiseti species complex. International Journal of Food Microbiology 234: 24–35. https://doi.org/10.1016/j.ijfoodmicro.2016.06.023
  • Weaver G, Kurtz H, Behrens J, Robison T, Seguin B, Bates F, Mirocha C (1986) Effect of zearalenone on the fertility of virgin dairy heifers. American Journal of Veterinary Research 47: 1395–1397. https://doi.org/10.2460/ajvr.1986.47.06.1395
  • Wong PT, Roth IJ, Jackson AR (1987) Kikuyu poisoning of cattle in New South Wales and its relationship to pasture fungi on kikuyu grass (Pennisetum clandestinum). Austrian Veterinary Journal 64: 229–232. https://doi.org/10.1111/j.1751-0813.1987.tb09688.x
  • Yilmaz N, Sandoval-Denis M, Lombard L, Visagie CM, Wingfield BD, Crous PW (2021) Redefining species limits in the Fusarium fujikuroi species complex. Persoonia 46: 129–162. https://doi.org/10.3767/persoonia.2021.46.05

Supplementary materials

Supplementary material 1 

Maximum likelihood phylogenetic tree of the Fusarium incarnatum-equiseti species complex based on the CaM dataset

Claudette Dewing, Cobus M. Visagie, Emma T. Steenkamp, Brenda D. Wingfield, Neriman Yilmaz

Data type: pdf

Explanation note: Strains of species isolated from this study are shown in black bold text; strains of newly described species are indicated in red bold text. The tree was rooted to Fusarium concolor. Branch support in nodes higher than 80% are indicated at relevant branches (T = ex-type, ET = epitype, NT = neotype).

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (63.34 kb)
Supplementary material 2 

Maximum likelihood phylogenetic tree of the Fusarium incarnatum-equiseti species complex based on the RPB2 dataset

Claudette Dewing, Cobus M. Visagie, Emma T. Steenkamp, Brenda D. Wingfield, Neriman Yilmaz

Data type: pdf

Explanation note: Strains of species isolated from this study are shown in black bold text; strains of newly described species are indicated in red bold text. The tree was rooted to Fusarium concolor. Branch support in nodes higher than 80% are indicated at relevant branches (T = ex-type, ET = epitype, NT = neotype).

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (66.32 kb)
Supplementary material 3 

Maximum likelihood phylogenetic tree of the Fusarium incarnatum-equiseti species complex based on the TEF dataset

Claudette Dewing, Cobus M. Visagie, Emma T. Steenkamp, Brenda D. Wingfield, Neriman Yilmaz

Data type: pdf

Explanation note: Strains of species isolated from this study are shown in black bold text; strains of newly described species are indicated in red bold text. The tree was rooted to Fusarium concolor. Branch support in nodes higher than 80% are indicated at relevant branches (T = ex-type, ET = epitype, NT = neotype).

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (66.88 kb)
Supplementary material 4 

Maximum likelihood phylogenetic tree of the Fusarium incarnatum-equiseti species complex based on the TEF dataset obtained from Botha et al. (2014) and relevant reference sequences

Claudette Dewing, Cobus M. Visagie, Emma T. Steenkamp, Brenda D. Wingfield, Neriman Yilmaz

Data type: pdf

Explanation note: Strains of species isolated from this study are shown in black bold text; strains of newly described species are indicated in red bold text. The tree was rooted to Fusarium concolor. Branch support in nodes higher than 80% are indicated at relevant branches (T = ex-type, ET = epitype, NT = neotype).

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (131.43 kb)
Supplementary material 5 

Strains examined in this study, with information about substrate, country and GenBank accessions of sequences

Claudette Dewing, Cobus M. Visagie, Emma T. Steenkamp, Brenda D. Wingfield, Neriman Yilmaz

Data type: xlsx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (28.56 kb)
login to comment