Research Article
Print
Research Article
Morphological and phylogenetic analyses reveal two new species of the Fusarium fujikuroi (Hypocreales, Nectriaceae) species complex in China
expand article infoMingwei Zhang‡, Cheng Peng‡, Shuji Li‡, Chengming Tian‡
‡ Beijing Forestry University, Beijing, China

Corresponding author: Chengming Tian ( chengmt@bjfu.edu.cn )

Academic editor: Thorsten Lumbsch
© 2025 Mingwei Zhang, Cheng Peng, Shuji Li, Chengming Tian.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Zhang M, Peng C, Li S, Tian C (2025) Morphological and phylogenetic analyses reveal two new species of the Fusarium fujikuroi (Hypocreales, Nectriaceae) species complex in China. MycoKeys 112: 127-163. https://doi.org/10.3897/mycokeys.112.133472
Open Access

Abstract

The Fusarium fujikuroi species complex (FFSC) encompasses a diverse array of more than 80 phylogenetic species with both phytopathological and clinical importance. A stable taxonomy is crucial for species in the FFSC due to their economical relevance. Fungal strains used in this study were obtained from Castanea mollissima and Rubus lambertianus, collected from Beijing and Shaanxi Province. We employ morphological and phylogenetic analyses based on partial gene fragments of the translation elongation factor 1-alpha (tef1), beta-tubulin (tub2), calmodulin (CaM), RNA polymerase largest subunit (rpb1), and RNA polymerase II second largest subunit (rpb2), as well as the pairwise homoplasy index tests. Studies have shown that these phylospecies are clustered in the Asian clade of the FFSC. The present study delineates two novel Fusarium species within the FFSC, named F. castaneophilum and F. rubicola, complemented by illustrations and descriptions.

Key words

Ascomycota, morphology, phylogeny, taxonomy

Introduction

Fusarium (Ascomycota, Hypocreales, Nectriaceae) is a large and diverse genus that includes approximately 400 recognized species found in various habitats worldwide (https://www.fusarium.org). It is also the fourth-highest-cited genus of fungi (Bhunjun et al. 2024), underscoring its widespread significance across various sectors. As one of the most economically destructive and diverse groups of mycotoxin-producing pathogens, Fusarium poses significant threats to plant, animal, and human health, as well as to global food security (Desjardins 2006; Leslie and Summerell 2006; O’Donnell et al. 2013; Renev et al. 2021). Fusarium species cause a range of diseases that impact forestry worldwide (Yilmaz et al. 2021). For example, F. oxysporum causes wilt of Albizia julibrissin, leading to substantial damage in scenic areas where A. julibrissin is used as a landscape tree. In Hevea brasiliensis, F. decemcellulare causes basal rot, while F. venfricosum is responsible for brown spot disease; both diseases severely weaken the trees, reducing rubber production (Jiang et al. 2015). Fusarium annulatum, F. avenaceum, F. sporotrichioides and F. tricinctum cause xylem browning in Malus pumila, which can lead to yield reductions and potentially plant death (Cheng 2019).

The Fusarium fujikuroi species complex (FFSC) is one of the largest and most extensively studied species complexes within the genus (Sandoval-Denis et al. 2018a, b; Al-Hatmi et al. 2019). Species within the FFSC have been extensively researched due to their ability to cause plant infections, such as rice bakanae, maize ear rot, soybean root rot, and cankers in Pinus species, which lead to significant decreases in crop yield and economic income (Herron et al. 2015; O’Donnell et al. 2015; Qiu et al. 2020). FFSC was first established by Wollenweber et al. (1925) as the section Liseola, characterised by sporodochial conidia (macroconidia), microconidia in chains and/or false heads, and does not produce chlamydospores. However, later studies identified species conforming to these traits but also capable of producing chlamydospores—such as F. beomiforme (Nelson et al. 1987), F. dlamini (Marasas et al. 1985), F. napiforme (Marasas et al. 1987) and F. nygamai (Burgess and Trimboli 1986). Both F. dlamini and F. beomiforme did not produce tandem microconidia. In order to accommodate these species, Kwasna et al. (1991) introduced the section Dlaminia. Subsequent molecular studies, nonetheless, have shown that based on phylogenetic analyses of DNA sequences obtained from multiple unlinked loci, sections Liseola and Dlaminia are non-monophyletic (O’Donnell and Cigelnik 1997; O’Donnell et al. 1998a). In cases where morphology often disagreed with DNA sequence data, this highlights the challenges of using phenotypic traits to deduce relationships and evolutionary histories. With these drawbacks in mind, the term “species complex” was introduced, mainly referring to phylogenetic clades (O’Donnell and Cigelnik 1997; O’Donnell et al. 1998a).

O’Donnell et al. (1998a) developed the FFSC biogeography hypothesis and clustered the isolates into three relatively well-supported phylogenetic clades, named African, American, and Asian clades, believed to be a result of the fragmentation of Gondwana during the Upper Cretaceous through to the Paleocene. However, the authors later reported that this complex appeared much later. This apparent biogeographic aggregation may be attributed to long-distance dispersal from South America to Africa and then to Asia in the late Miocene (O’Donnell et al. 2013). In the subsequent study, the non-monophyletic African Clade was divided into two distinct and highly supported lineages: the African Clade A (core African Clade) and African Clade B (Herron et al. 2015; Sandoval-Denis et al. 2018b), along with a monotypic clade that joined the sister clades of America and Africa B, which is termed African C. Therefore, the analysis of the current dataset mainly supports five significant clades in the FFSC (Crous et al. 2021). With advancements in molecular techniques, further studies have continued to refine our understanding of FFSC’s diversity and complexity.

Presently, with the application of modern classification methods, more than 60 species have been identified in the FFSC (Yilmaz et al. 2021). Given the considerable economic impact of Fusarium, ongoing research is essential to uncover additional hidden species. In this study, through a combination of morphology and multi-locus phylogeny, we introduce two new species and advance our knowledge of the species diversity of fusarioid taxa from China.

Materials and methods

Sample collection and fungal isolation

Fungal strains used in this study were obtained from Castanea mollissima and Rubus lambertianus, collected from Beijing city and Shaanxi Province. The collected samples were placed in paper bags and transported to the laboratory for isolation. The sample surface was disinfected with 75% alcohol for 30 seconds, then with 1.25% sodium hypochlorite (NaOCl) for 90 seconds, followed by being rinsed three times with sterile water and dried on sterile filter paper. Plant tissue pieces were excised from the leaves and branches of the plant samples into 0.5 × 0.5 cm sections using a sterile blade. These plant tissue pieces were then placed on potato dextrose agar plates (PDA; containing 200 g potatoes, 20 g dextrose and 20 g agar per liter). The petri plates were cultured for three days at 25 °C in the dark. The fungal isolates were purified using the monosporic isolation method as described by Li et al. (2007). Holotype specimens of the new species identified in this study were stored at the Forest Pathology Laboratory at Beijing Forestry University and all cultures were preserved at the China Forestry Culture Collection Center (CFCC), Chinese Academy of Forestry, Beijing, China.

DNA extraction, PCR and sequencing

Genomic DNAs were extracted from fungal mycelia grown on potato dextrose agar (PDA) using the cetyltrimethylammonium bromide (CTAB) method (Guo et al. 2000) and stored at -20 °C until polymerase chain reaction (PCR). Five different loci were targeted for sequencing, including the partial translation elongation factor (tef1), partial RNA polymerase largest subunit (rpb1), partial RNA polymerase second largest subunit (rpb2) gene regions, partial β-tubulin (tub2), and partial calmodulin (CaM), which were amplified and sequenced, respectively. The primer pairs and PCR amplification procedures are listed in Table 1. PCR amplifications were performed in a reaction mixture consisting of 10 μL 2 × ES × Taq PCR Master Mix (Tsingke Biotechnology Co. Ltd., Beijing, China), 1 μL each of primer pairs, 1 μL of undiluted genomic DNA, adjusted to a final volume of 20 μL with distilled deionized water. The PCR products were assayed by electrophoresis in 2% agarose gels. Amplified PCR products were sent to a commercial sequencing provider (Tsingke Biotechnology Co. Ltd., Beijing, China). Newly generated sequences were submitted to GenBank, with accession numbers provided in Table 2.

Table 1.
Download as
CSV
XLSX

Primer pairs, PCR amplification procedures and references used in this study.

Gene/DNA regions Primers PCR amplification procedures References
Name Abbreviation Name Direction Sequence (5’→3’)1
translation elongation factor 1-alpha tef1 EF-1 Forward ATGGGTAAGGARGACAAGAC 95 °C 5 min; 35 cycles of 95 °C 45 s, 55 °C 30 s, 72 °C 45 s; 72 °C 10 min; 4 °C soak O’Donnell et al. (1998b)
EF-2 Reverse GGARGTACCAGTSATCATG
RNA polymerase largest subunit rpb1 Fa Forward CAYAARGARTCYATGATGGGWC 95 °C 5 min; 5 cycles of 95 °C 1 min, 58 °C 45 s, 72 °C 2 min; 5 cycles of 95 °C 1 min, 57 °C 45 s, 72 °C 2 min; 35 cycles of 95 °C 1 min, 56 °C 45 s, 72 °C 2 min; 72 °C 10 min; 4 °C soak O’Donnell et al. (2010)
F7 Forward CRACACAGAAGAGTTTGAAGG
G2R Reverse GTCATYTGDGTDGCDGGYTCDCC
RNA polymerase second largest subunit rpb2 5f2 Forward GGGGWGAYCAGAAGAAGGC 95 °C 5 min; 35 cycles of 95 °C 30 s, 55 °C 1 min, 72 °C 1 min; 72 °C 5 min; 4 °C soak Reeb et al. (2004) Liu et al. (1999)
7cr Reverse CCCATRGCTTGYTTRCCCAT
partial Beta tubulin tub2 T1 Forward AACATGCGTGAGATTGTAAGT 95 °C 3 min; 35 cycles of 94 °C 30 s, 54 °C 45 s, 72 °C 15 s; 72 °C 10 min; 4 °C soak O’Donnell and Cigelnik (1997)
T2 Reverse TAGTGACCCTTGGCCCAGTTG
Calmodulin CaM CL1 Forward GARTWCAAGGAGGCCTTCTC 95 °C 1 min; 35 cycles of 94 °C 30 s, 55 °C 30 s, 72 °C 15 s; 72 °C 10 min; 4 °C soak O’Donnell et al. (2000)
CL2A Reverse TTTTTGCATCATGAGTTGGAC

1 R = A or G; S = C or G; W = A or T; Y = C or T.
Table 2.
Download as
CSV
XLSX

Fusarium strains used in this study.

Species namea Isolateb Country/Location Host/Habitat GenBank accession numbersc
CAM tef1 RPB1 RPB2 tub2
Fusarium acaciae-mearnsii NRRL 25754 T South Africa Acacia mearnsii – AF212448 – – AF212765
F. acuminatum LC18312 China, Henan Province, Shangqiu City Wheat – OQ124240 OQ124201 OQ124233 –
F. acutatum NRRL 13308 India Environmental – MN193855 MN193911 MN193883 –
F. acutatum CBS 402.97 T India Environmental MW402459 MW402125 MW402653 MW402768 MW402323
F. acutatum CBS 401.97 India Cajanus cajan MW402458 MW402124 MW402652 MW402813 MW402322
F. aethiopicum NRRL 46726 T Ethiopia Triticum aestivum – FJ240298 MW233298 MW233470 FJ240288
F. agapanthi NRRL 54463 T Australia Agapanthus sp. KU900611 KU900630 KU900620 KU900625 KU900635
F. agapanthi CBS 100193 New Zealand Agapanthus praecox MW402363 MW401959 MW402491 MW402727 MW402160
F. aglaonematis ZHKUCC 22-0077 T China, Guangdong province, Guangzhou city Aglaonema modestum Schott ex Engl. ON330434 ON330437 ON330446 ON330443 ON330440
F. aglaonematis ZHKUCC 22-0078 China, Guangdong province, Guangzhou city Aglaonema modestum Schott ex Engl. ON330435 ON330438 ON330447 ON330444 ON330441
F. aglaonematis ZHKUCC 22-0079 China, Guangdong province, Guangzhou city Aglaonema modestum Schott ex Engl. ON330436 ON330439 ON330448 ON330445 ON330442
F. algeriense NRRL 66647 T Algeria Triticum durum – MF120510 MF120488 MF120499 –
F. ananatum CBS 118516 T South Africa Ananas comosus fruit LT996175 LT996091 LT996188 LT996137 LT996112
F. andiyazi NRRL 31727 T South Africa Sorghum bicolor soil debris LT996176 LT996092 LT996189 LT996138 LT996113
F. andiyazi CBS 119856 Ethiopia Sorghum grain MN534174 MN533989 MW402523 MN534286 MN534081
F. anguioides NRRL 25385 China bamboo – MH742689 JX171511 JX171624 –
F. annulatum CBS 139739 USA Xylosandrus amputatas galleries in Cinnamonum camphora branch MW402420 MW402074 MW402602 MW402754 MW402273
F. annulatum CBS 115.97 Italy Dianthus caryophyllus MW402373 MW401973 MW402503 MW402785 MW402173
F. annulatum CBS 133.95 Netherlands Dianthus caryophyllus MW402407 MW402040 MW402568 MW402743 MW402239
F. annulatum CBS 143605 Iran Smut MW402435 MW402094 MW402615 MW402760 MW402293
F. annulatum CBS 792.91 Netherlands Gladiolus MW402481 MW402153 MW402706 MW402774 MW402354
F. annulatum CBS 137537 Pakistan Human tissue MW402414 MW402060 MW402586 MW402749 MW402259
F. annulatum NRRL 62905 USA Zea mays kernel – MN193865 MW402722 MN193893 –
F. annulatum CBS 258.54 T New Caledonia Oryza sativa – MT010994 MT010944 MT010983 –
F. annulatum LC18417 China, HeBei Province, Xingtai City Maize – OQ126003 OQ125817 OQ126448 OQ126274
F. annulatum LC1105 China Lithocarpus glabra MW566339 MW580512 MW024500 MW474458 MW533791
F. annulatum LC11490 China, Beijing Vitis sp. MW566340 MW580513 MW024501 MW474459 MW533792
F. annulatum LC11527 China, Hebei Province Vitis sp. MW566341 MW580514 MW024502 MW474460 MW533793
F. annulatum LC11584 China, Hebei Province Vitis sp. MW566342 MW580515 MW024503 MW474461 MW533794
F. annulatum LC11650 China, Hainan Province Oryza sp. MW566343 MW580516 MW024504 MW474462 MW533795
F. annulatum LC11670 China, Hainan Province Oryza sp. MW566344 MW580517 MW024505 MW474463 MW533796
F. annulatum LC11672 China, Hainan Province Oryza sp. MW566345 MW580518 MW024506 MW474464 MW533797
F. annulatum LC13658 China, Neimenggu Province unidentified mushroom MW566346 MW580519 MW024507 MW474465 MW533798
F. annulatum LC13659 USA Glycine max MW566347 MW580520 MW024508 MW474466 MW533799
F. annulatum LC13660 Philippines Musa sp. MW566348 MW580521 MW024509 MW474467 MW533800
F. annulatum LC13661 Italy Malus domestica MW566349 MW580522 MW024510 MW474468 MW533801
F. annulatum LC13662 Spain Chamaerops humilis MW566350 MW580523 MW024511 MW474469 MW533802
F. annulatum LC13663 Ukraine Zea mays MW566351 MW580524 MW024512 MW474470 MW533803
F. annulatum LC13664 USA Sorghum bicolor MW566352 MW580525 MW024513 MW474471 MW533804
F. annulatum LC13665 Spain Olea europaea MW566353 MW580526 MW024514 MW474472 MW533805
F. annulatum LC13666 China, Guangdong Province, Guangzhou city Musa nana MW566354 MW580527 MW024515 MW474473 MW533806
F. annulatum LC13667 China, Guangdong Province, Guangzhou city Musa nana MW566355 MW580528 MW024516 MW474474 MW533807
F. annulatum LC13668 China, Guangdong Province, Guangzhou city Musa nana MW566356 MW580529 MW024517 MW474475 MW533808
F. annulatum LC13669 China, Guangxi Zhuang Autonomous Region, Baise city Musa nana MW566357 MW580530 MW024518 MW474476 MW533809
F. annulatum LC13670 China, Guangxi Zhuang Autonomous Region, Chongzuo city Musa nana MW566358 MW580531 MW024519 MW474477 MW533810
F. annulatum LC13671 China, Guangxi Zhuang Autonomous Region, Laibin city Musa nana MW566359 MW580532 MW024520 MW474478 MW533811
F. annulatum LC13673 China, Hebei Province Oryza sp. MW566361 MW580534 MW024522 MW474480 MW533813
F. annulatum LC13674 China, Jiangxi Province Oryza sp. MW566362 MW580535 MW024523 MW474481 MW533814
F. annulatum LC13675 China, Jiangxi Province Oryza sp. MW566363 MW580536 MW024524 MW474482 MW533815
F. annulatum LC2825 China, Beijing unidentified grass MW566364 MW580537 MW024525 MW474483 MW533816
F. annulatum LC5984 China submerged wood MW566365 MW580538 MW024526 MW474484 MW533817
F. annulatum LC6002 China submerged wood MW566366 MW580539 MW024527 MW474485 MW533818
F. annulatum LC7208 China, Guangdong Province, Guangzhou city bamboo MW566367 MW580540 MW024528 MW474486 MW533819
F. annulatum LC7924 China, Shandong Province Capsicum sp. MW566368 MW580541 MW024529 MW474487 MW533820
F. anthophilum CBS 222.76 ET Germany Euphorbia pulcherrima MW402451 MW402114 MW402641 MW402811 MW402312
F. anthophilum NRRL 13602 Germany Hippeastrum sp. LT996177 LT996093 LT996190 LT996139 LT996114
F. aquaticum LC13615 China, Guizhou Province, Zunyi city water – MW580446 MW024437 MW474392 MW533728
F. aquaticum LC13616 China, Guizhou Province, Zunyi city water – MW580447 MW024438 MW474393 MW533729
F. aquaticum LC7502 T China, Guizhou Province, Zunyi city water – MW580448 MW024439 MW474394 MW533730
F. armeniacum NRRL 29133 T Australia Triticum aestivum – GQ915501 KT597715 GQ915485 GQ915435
F. armeniacum LC15881 China, Jiangsu Province, Lianyungang City Maize – OQ124873 OQ124463 OQ124668 –
F. asiaticum NRRL 13818 T Japan Hordeum vulgare – AF212451 JX171459 JX171573 AF212768
F. asiaticum LC18286 China, Zhejiang Province, Jiaxing City Wheat – OQ124900 OQ124545 OQ124718 –
F. atrovinosum CBS 445.67 T Australia Triticum aestivum MN120693 MN120752 MN120713 MW928822 –
F. austroafricanum NRRL 66741 T South Africa Endophyte of Pennisetum clandestinum – MH742687 MH742537 MH742616 –
F. avenaceum NRRL 26911 NT Denmark Hordeum vulgare – MW928836 MG282372 MG282401 –
F. avenaceum LC18558 China, Gansu Province, Longnan City Wheat – OQ124249 OQ124211 OQ124222 –
F. awaxy LGMF 1930 T Brazil Rotten stalks of Zea mays MK766940 MG839004 – MK766941 MG839013
F. awaxy LC18783 China, Gansu Province, Qingyang City Maize OQ125655 OQ126101 OQ125981 OQ126652 OQ126328
F. aywerte NRRL 25410 T Australia Soil – – JX171513 JX171626 KU171777
F. babinda NRRL 25807 T Australia Soil MN534162 MN534060 – MN534245 MN534100
F. bactridioides CBS 100057 T USA Pinus leiophylla MN534173 KC514053 MT010939 MT010963 MN534112
F. bactridioides NRRL 20476 USA Cronartium conigenum AF158343 AF160290 – – U34434
F. begonia NRRL 25300 T Germany Begonia elatior hybrid AF158346 AF160293 LT996191 LT996140 U61543
F. beomiforme NRRL 13606 T Australia Soil – MF120507 MF120485 MF120496 –
F. beomiforme NRRL 25174 New Caledonia Soil – – JX171506 JX171619 –
F. boothii NRRL 26916 T South Africa Zea mays – GQ915503 KM361641 KM361659 GQ915437
F. boothii LC18723 China, Gansu Province, Qingyang City Maize – OQ124953 OQ124486 OQ124824 –
F. brachiariae CML 3032 T Brazil Brachiaria decumbens – MT901348 – MT901314 MT901321
F. brachiariae CML 3163 Brazil Brachiaria decumbens – MT901349 – MT901315 MT901322
F. brachygibbosum NRRL 20954 T India Sorghum vulgare – MW233075 MW233246 MW233418 –
F. brachygibbosum HN-1 China Maize – KX984345 KX984349 KX984353 –
F. brasilicum NRRL 31281 T Brazil Avena sativa – AY452964 – – AY452956
F. brevicatenulatum CBS 404.97 T Madagascar Striga asiatica MW834108 MN533995 – MN534295 MN534063
F. buharicum NRRL 13371 Iran Hibiscus cannabinus – OM160859 JX171449 JX171563 –
F. buharicum NRRL 25488 ET Uzbekistan Gossypium herbaceum – KX302912 KX302920 KX302928 –
F. bulbicola NRRL 13618 T Germany Nerine bowdenii KF466327 KF466415 KF466394 KF466404 KF466437
F. burgessii NRRL 66654 T Australia Soil – HQ667148 MT409440 HQ646393 –
F. caapi CML 3657 T Brazil Brachiaria decumbens – MT901350 – MT901316 MT901323
F. caapi CML 3658 Brazil Brachiaria decumbens – MT901351 – MT901317 MT901324
F. caatingaense URM 6779 T Brazil Dactylopius opuntiae – LS398466 – LS398495 –
F. caatingaense CBS 976.97 USA Juniper chinensis MN170315 MN170449 – MN170382 –
F. camptoceras CBS 193.65 NT Costa Rica Theobroma cacao MN170316 MN170450 MW928800 MN170383 AB820714
F. casha PPRI 21883 T South Africa Lesions in Amaranthus cruentus associated with Athesapeuta dodonis and Baris amaranti weevils – MF787261 – MN605065 MF787255
F. casha PPRI 20462 South Africa Athesapeuta dodonis – MF787262 – MN605066 MF787256
F. castaneophilum CFCC 70814 T China, BeiJing Castanea mollissima PP946917 PP946923 PP946937 PP946935 PP946929
F. castaneophilum CFCC 70815 China, BeiJing Castanea mollissima PP946918 PP946924 PP946938 PP946936 PP946930
F. cerealis FRC R-4758 USA Soil – MZ921929 MZ921689 MZ921800 –
F. chinhoyiense NRRL 25221 T Zimbabwe Zea mays MN534196 MN534050 MW402711 MN534262 MN534082
F. chinhoyiense NY 001B5 South Africa Soil MN534197 MN534051 MW402725 MN534263 MN534083
F. chuoi CPC 39664 T Vietnam Musa itinerans OK626304 OK626308 OK626306 OK626302 OK626310
F. chuoi CPC 39667 Vietnam Musa itinerans OK626305 OK626309 OK626307 OK626303 OK626311
F. circinatum CBS 405.97 T USA Pinus radiata KM231393 KM231943 JX171510 HM068354 KM232080
F. clavus CBS 126202 T Namibia Desert soil MN170322 MN170456 – MN170389 –
F. clavus LC18293 China, Hubei Province, Xiangyang City Wheat OQ125253 OQ125112 – OQ125519 –
F. coffeatum CBS 635.76 T South Africa Cynodon lemfuensis MN120696 MN120755 MN120717 MN120736 –
F. coicis RBG 5368 T Australia Coix gasteenii LT996178 KP083251 KP083269 KP083274 LT996115
F. commune CBS 110090 T Denmark Soil – AF362263 MW928803 MW934368 –
F. commune LC18583 China, Hunan Province, Hengyang City Maize – OQ125097 OQ125091 OQ125103 –
F. concentricum NRRL 25181 T Costa Rica Musa sapientum AF158335 AF160282 LT996192 – U61548
F. concentricum LC18523 China, Guangdong Province, Qingyuan City Maize OQ125644 OQ126090 OQ125868 OQ126523 OQ126285
F. concentricum LC1003 China, Guangdong Province, Guangzhou city Reineckia carnea – MW580449 MW024440 MW474395 MW533731
F. concentricum LC11489 China, Beijing Vitis sp. – MW580450 MW024441 MW474396 MW533732
F. concentricum LC11491 China, Beijing Vitis sp. – MW580451 MW024442 MW474397 MW533733
F. concentricum LC11507 China, Beijing Vitis sp. – MW580452 MW024443 MW474398 MW533734
F. concentricum LC13617 China, Jiangsu Province, Changshu city unknown plant – MW580453 MW024444 MW474399 MW533735
F. concentricum LC13618 Japan Podocarpus macrophyllus – MW580454 MW024445 MW474400 MW533736
F. concentricum LC13619 China, Fujian Province, Wuyi Mountain Musa nana – MW580455 MW024446 MZ399207 MW533737
F. concentricum LC13620 China, Fujian Province, Wuyi Mountain Musa nana – MW580456 MW024447 MW474402 MW533738
F. concentricum LC13647 China, Fujian Province, Fuzhou city Lablab sp. MW566324 MW580497 MW024485 MW474443 MW533776
F. concentricum LC13648 China, Fujian Province, Fuzhou city Lablab sp. MW566325 MW580498 MW024486 MW474444 MW533777
F. concentricum LC13649 China, Fujian Province, Fuzhou city Lablab sp. MW566326 MW580499 MW024487 MW474445 MW533778
F. concentricum LC4326 China, Jiangxi Province Aglaonema modestum MW566288 MW580461 MW024452 MW474407 MW533743
F. concentricum LC4359 China, Jiangxi Province Hedera nepalensis MW566289 MW580462 MW024453 MW474408 MW533744
F. concentricum LC7032 China, Hainan Province Musa nana MW566290 MW580463 MW024454 MW474409 MW533745
F. concolor NRRL 13459 South Africa Plant debris in soil GQ505585 GQ505674 JX171455 GQ505852 –
F. concolor NRRL 13994 T Uruguay Hordeum vulgare – MH742650 MH742492 MH742569 –
F. continuum NRRL 66286 T China Zanthoxylum bungeanum – KM236722 KM520387 KM236782 –
F. cortaderiae NRRL 29297 T New Zealand Cortaderia selloana – AY225885 KM361644 KM361662 AH012625
F. cugenangense NRRL 25387 New Zealand Human toe nail – MH485011 JX171512 JX171625 –
F. cugenangense LC18297 China, Fujian Province, Zhangzhou City Maize – OQ125083 – OQ125080 –
F. culmorum NRRL 25475 ET Denmark Hordeum vulgare – MW233082 JX171515 JX171628 AF212780
F. curculicola PPRI 20458 T South Africa Athesapeuta dodonis – MF787266 – MN605069 MF787258
F. curculicola PPRI 20386 South Africa Isolated from lesion in Amaranthus cruentus associated with Athesapeuta dodonis weevils – MF787268 – MN605071 MF787260
F. curculicola PPRI 20464 South Africa Athesapeuta dodonis – MF787267 – MN605070 MF787259
F. nirenbergiae CBS 744.97 USA Pseudotsuga menziesii AF158365 AF160312 LT996203 LT575065 U34424
F. curvatum CBS 238.94 T Netherlands Beaucarnea sp. MH484711 MH484984 MW928804 MH484893 MH485075
F. denticulatum NRRL 25302 USA Ipomoea batatas AF158322 AF160269 LT996195 LT996143 U61550
F. denticulatum CBS 407.97 T USA Ipomoea batatas MT010890 KR909385 MT010953 MT010970 MT011060
F. dhileepanii BRIP 71717 T Australia Cyperus aromaticus – OK509072 – OK533536 –
F. dlaminii NRRL 13164 T South Africa Soil debris in cornfield AF158330 AF160277 KU171681 KU171701 U34430
F. dlaminii CBS 175.88 South Africa Zea mays soil MN534150 MN534002 MW402623 MN534256 MN534138
F. dlaminii CBS 671.94 South Africa Soil MN534152 MN534004 MW402690 MN534254 MN534136
F. duoseptatum InaCC F916 T Indonesia Pseudostem of Musa var. Pisang Kepok – LS479688 LS479495 LS479239 –
F. echinatum CBS 146496 South Africa Unidentified tree MW834109 MW834272 MW834186 MW834003 MW834300
F. echinatum CBS 146497 T South Africa Unidentified tree MW834110 MW834273 MW834187 MW834004 MW834301
F. elaeagni LC18815 China, Fujian Province, Fuzhou City Rice OQ125618 OQ126068 OQ125848 OQ126520 OQ126241
F. elaeagni LC13627 T China, Jiangsu Province, Suzhou city Elaeagnus pungens MW566293 MW580466 MW024457 MW474412 MW533748
F. elaeagni LC13628 China, Jiangsu Province, Suzhou city Elaeagnus pungens MW566294 MW580467 MW024458 MW474413 MW533749
F. elaeagni LC13629 China, Jiangsu Province, Suzhou city Elaeagnus pungens MW566295 MW580468 MW024459 MW474414 MW533750
F. elaeidis CBS 217.49 T Zaire Elaeis sp. MH484688 MH484961 MW928805 MH484870 MH485052
F. equiseti NRRL 20697 Chile Beta vulgaris GQ505506 – JX171481 JX171595 –
F. equiseti CBS 307.94 ET Germany Soil GQ505511 GQ505599 – GQ505777 –
F. erosum LC15877 T China, Guangdong Province, Meizhou City Maize OQ125648 OQ126066 OQ125772 OQ126518 OQ126321
F. fabacearum CBS 144743 T South Africa Glycine max MH484757 MH485029 MW928806 MH484938 MH485121
F. falsibabinda LC13611 Japan Camellia sasanqua MW566261 MW580434 – MW474380 MW533720
F. fecundum LC15875 T China, Shaanxi Province, Hanzhong City Wheat OQ125281 OQ125250 – OQ125544 –
F. ficicrescens CBS 125178 T South Africa Unidentified tree KU603958 KU604452 MW402546 KT154002 MT011061
F. ficicrescens CBS 125177 South Africa Unidentified tree MN534176 MN534006 MW402545 MN534281 MN534071
F. flagelliforme NRRL 36269 T Croatia Pinus nigra GQ505557 GQ505645 – GQ505823 –
F. foetens CBS 110286 T Netherlands Begonia elatior hybrid – AY320087 MW928808 MW928825 –
F. fracticaudum CMW 25245 T Colombia Pinus maximonoii – KJ541059 – – KJ541051
F. fractiflexum NRRL 28852 T Japan Cymbidium sp. AF158341 AF160288 LR792578 LT575064 –
F. fredkrugeri CBS 144209 T South Africa Melhania acuminata rhizosphere LT996181 LT996097 LT996199 LT996147 LT996117
F. fujikuroi CBS 221.76 T Taiwan Oryza sativa – – MW834188 MW834005 –
F. fujikuroi LC18819 China, Sichuan Province, Mianyang City Maize OQ125638 OQ126071 OQ125853 OQ126528 OQ126292
F. fujikuroi LC13633 USA Glycine max MW566299 MW580472 MW024460 MW474418 MW533751
F. fujikuroi LC13634 Japan Acer palmatum MW566300 MW580473 MW024461 MW474419 MW533752
F. fujikuroi LC13635 USA Sorghum bicolor MW566301 MW580474 MW024462 MW474420 MW533753
F. fujikuroi LC13636 Japan Rhododendron simsii MW566302 MW580475 MW024463 MW474421 MW533754
F. fujikuroi LC13637 China, Fujian Province, Wuyi mountain Musa nana MW566303 MW580476 MW024464 MW474422 MW533755
F. fujikuroi LC13638 China, Guangdong Province, Qingyuan city Musa nana MW566304 MW580477 MW024465 MW474423 MW533756
F. fujikuroi LC13639 China, Guangxi Zhuang Autonomous Region, Baise city Musa nana MW566305 MW580478 MW024466 MW474424 MW533757
F. fujikuroi LC13640 China, Guangxi Zhuang Autonomous Region, Liuzhou city Musa nana MW566306 MW580479 MW024467 MW474425 MW533758
F. fujikuroi LC13641 China, Hebei Province Oryza sp. MW566307 MW580480 MW024468 MW474426 MW533759
F. fujikuroi LC13642 China, Hainan Province, Wanning city Panicum sp. MW566308 MW580481 MW024469 MW474427 MW533760
F. fujikuroi LC13643 China, Hainan Province, Wanning city Panicum sp. MW566309 MW580482 MW024470 MW474428 MW533761
F. fujikuroi LC5916 China, Jiangxi Province, Nanchang city submerged wood MW566310 MW580483 MW024471 MW474429 MW533762
F. fujikuroi LC5927 China, Jiangxi Province, Nanchang city submerged wood MW566311 MW580484 MW024472 MW474430 MW533763
F. fujikuroi LC5945 China, Jiangxi Province, Nanchang city submerged wood MW566312 MW580485 MW024473 MW474431 MW533764
F. fujikuroi LC5955 China, Jiangxi Province, Nanchang city submerged wood MW566313 MW580486 MW024474 MW474432 MW533765
F. fujikuroi LC5979 China, Jiangxi Province, Nanchang city submerged wood MW566314 MW580487 MW024475 MW474433 MW533766
F. fujikuroi LC6014 China, Jiangxi Province, Nanchang city submerged wood MW566315 MW580488 MW024476 MW474434 MW533767
F. fujikuroi LC6015 China, Jiangxi Province, Nanchang city submerged wood MW566316 MW580489 MW024477 MW474435 MW533768
F. fujikuroi LC6024 China, Jiangxi Province, Nanchang city submerged wood MW566317 MW580490 MW024478 MW474436 MW533769
F. fujikuroi LC6973 China, Jiangxi Province Citrus reticulata MW566318 MW580491 MW024479 MW474437 MW533770
F. fujikuroi LC7147 China, Jiangxi Province bamboo MW566319 MW580492 MW024480 MW474438 MW533771
F. fujikuroi LC7864 China, Guangxi Zhuang Autonomous Region Poaceae sp. MW566320 MW580493 MW024481 MW474439 MW533772
F. fujikuroi CBS 186.56 Japan Oryza sativa seedling MW402447 MW402108 MW402632 MW402765 MW402306
F. fujikuroi CBS 257.52 Japan Oryza sativa seedling MW402454 MW402119 MW402645 MW402812 MW402317
F. fujikuroi CBS 265.54 Unknown Oryza sativa MN534222 MN534011 MW402650 MN534268 MN534132
F. fujikuroi CBS 119855 Unknown Environmenta MW402387 MW401994 – MW402735 MW402194
F. fujikuroi NRRL 13566 China Oryza sativa culm AF158332 AF160279 – JX171570 U34415
F. gaditjirrii NRRL 45417 Unknown Unknown – MN193881 MN193937 MN193909 –
F. gaditjirrii NRRL 53678 T Australia Heteropogon triticeus AY639631 AY639636 – HQ662690 AY639626
F. gerlachii NRRL 36905 T USA Triticum aestivum – DQ459742 KM361646 KM361664 –
F. gigantean 1-F T Brazil Panicum maximum – OR610357 – OR578833 –
F. globosum NRRL 26131 T South Africa Zea mays KF466329 KF466417 KF466396 KF466406 KF466439
F. globosum CBS 430.97 South Africa Zea mays MN534219 MN534013 – MN534265 MN534125
F. globosum CBS 120992 South Africa Maize kernels MW402390 MW401998 MW402529 MW402788 MW402198
F. globosum CBS 431.97 South Africa Zea mays MW402465 MW402131 MW402669 MW402816 MW402330
F. glycines CBS 144746 T South Africa Glycine max MH484760 MH485033 MW928809 MH484942 MH485124
F. goolgardi RBG 5411 T Australia Xanthorrhoea glauca – KP101123 KP083270 KP083280 –
F. gossypinum CBS 116613 T Ivory Coast Gossypium hirsutum MH484727 MH485000 – MH484909 MH485091
F. graminearum LC18796 China, Shandong Province, Dezhou City Maize – OQ124986 OQ124494 OQ124787 –
F. graminearum NRRL 31084 USA Zea mays – MW233103 JX171531 MW233447 HQ141668
F. graminum NRRL 20692 Unknown Paspalum, Vicia – – JX171479 JX171593 –
F. guilinense LC12160 T China Musa nana MK289652 MK289594 MK289831 MK289747 MW533851
F. guttiforme CBS 409.97 T Brazil Ananas comosus MT010901 KC514066 MT010938 MT010967 MT011048
F. hainanense LC11638 T China Oryza sp. MK289657 MK289581 MK289833 MK289735 MW533852
F. hainanense LC18701 China, Guangxi Zhuang Autonomous Region, Guigang City Maize OQ125282 OQ125148 – OQ125490 –
F. hechiense LC13644 T China, Guangxi Zhuang Autonomous Region,Hechi city Musa nana MW566321 MW580494 MW024482 MW474440 MW533773
F. hechiense LC13645 China, Guangxi Zhuang Autonomous Region,Hechi city Musa nana MW566322 MW580495 MW024483 MW474441 MW533774
F. hechiense LC13646 China, Guangxi Zhuang Autonomous Region,Hechi city Musa nana MW566323 MW580496 MW024484 MW474442 MW533775
F. heterosporum NRRL 20693 Netherlands Claviceps purpurea on Lolium perenne – – JX171480 JX171594 –
F. heterosporum CBS 391.68 ET Germany Claviceps purpurea on Lolium perenne – MW928839 MW928811 MW928827 –
F. hoodiae CBS 132474 T South Africa Root of Hoodia gordonii MH484747 MH485020 – MH484929 MH485111
F. hostae NRRL 29889 T USA Hosta sp. – AY329034 JX171527 JX171640 AY329042
F. humuli CQ1039 T China Humulus scandens MK289712 MK289570 MK289840 MK289724 MW533857
F. incarnatum NRRL 25478 ET Malawi Tricho-santhes dioica MN170342 MN170476 – MN170409 –
F. incarnatum ITEM 7155 Unknown Unknown LN901597 LN901581 – LN901617 LN901630
F. ipomoeae LC18759 China, Shandong Province, Jinan City Maize OQ125260 OQ125122 – OQ125529 –
F. jinanense LC15878 T China, Shandong Province, Jinan City Maize OQ125271 OQ125131 – OQ125521 –
F. konzum CBS 119849 T USA Sorghastrum nuttans LT996182 LT996098 LT996200 LT996148 LT996118
F. kyushuense NRRL 3509 T Japan Triticum aestivum – MH582292 MW233227 MH582098 –
F. kyushuense LC18277 China, Sichuan Province, Suining City Wheat – OQ125072 OQ124662 OQ124671 –
F. lactis NRRL 25200 ET USA Ficus carica AF158325 AF160272 LT996201 LT996149 U61551
F. lactis CBS 420.97 USA Ficus carica MN534181 MN534015 MW402667 MN534296 MN534078
F. langsethiae CBS 113234 T Norway Avena sativa – AB674298 MW928812 MW928828 AB587069
F. languescens CBS 645.78 T Morocco Solanum lycopersicum MH484698 MH484971 MW928813 MH484880 MH485062
F. lateritium NRRL 13622 USA Ulmus sp. – – JX171457 JX171571 –
F. libertatis CBS 144749 T South Africa Rock surface MH484762 MH485035 – MH484944 MH485126
F. longicornicola NRRL 52706 T Ethiopia Insect MW402487 JF740788 – – MW402360
F. longicornicola NRRL 52712 Ethiopia Insect MW402488 JF740794 MW402716 – MW402361
F. longipes NRRL 20723 England Unknown – – JX171483 JX171596 –
F. longipes NRRL 20695 T USA Soil – GQ915509 MW233244 GQ915493 GQ915443
F. louisianense NRRL 54197 T USA Seeds of Triticum sp – KM889633 KM889655 KM889657 KM889628
F. luffae LC12167 T China Luffa aegyptiaca MK289698 MK289601 MK289869 MK289754 –
F. mangiferae Indo63 Indonesia Musa sp. var. Pisang Raja Nangka – LS479441 – LS479850 LS479433
F. lumajangense LC13650 China, Guangxi Zhuang Autonomous Region Chongzuo city Musa nana MW566328 MW580501 MW024489 MW474447 MW533780
F. lumajangense LC13651 China, Guangxi Zhuang Autonomous Region Chongzuo city Musa nana MW566329 MW580502 MW024490 MW474448 MW533781
F. lumajangense LC13652 China, Guangxi Zhuang Autonomous Region Arenga caudata MW566330 MW580503 MW024491 MW474449 MW533782
F. lyarnte NRRL 54252 T Australia Soil – EF107118 JX171549 JX171661 –
F. madaense LC13614 China, Hebei Province Oryza sp. MW566272 MW580445 MW024436 MW474391 MW533727
F. madaense CBS 146656 Nigeria Arachis hypogaea MW402438 MW402097 MW402618 MW402763 MW402296
F. madaense CBS 146669 T Nigeria Arachis hypogaea MW402439 MW402098 MW402619 MW402764 MW402297
F. mangiferae NRRL 53980 T Israel Mangifera indica – LT574978 MW402530 LT575059 MN534128
F. mangiferae NRRL 25226 Israel Mangifera indica AF158334 AF160281 JX171509 HM068353 U61561
F. marasasianum CMW 25512 Colombia Pinus tecunumanii MN534208 MN534018 – MN534249 MN534113
F. meridionale NRRL 28436 T New Caledonia Citrus sinensis – AF212435 KM361642 KM361660 AF212752
F. meridionale LC18774 China, Yunnan Province, Xuanwei City Maize – OQ125048 OQ124527 OQ124830 –
F. mesoamericanum NRRL 25797 T Honduras Musa sp. – AF212441 KM361639 KM361657 AF212758
F. mexicanum NRRL 53147 T Mexico Mangifera indica – MG838032 MG838088 MN724973 MG838107
F. mexicanum NRRL 47473 Mexico Mangifera indica GU737389 GU737416 LR792579 LR792615 GU737308
F. mianyangense LC15879 T China, Sichuan Province, Mianyang City Rice OQ125335 OQ125232 – OQ125510 –
F. mirum CML 3859 T Mallawi, Egypt Sorghum bicolor – MK895725 – MK907308 MK907329
F. mirum CML 3858 Mallawi, Egypt Sorghum bicolor – MK895726 – MK907307 MK907328
F. mirum KSU 15077 Bokle, Cameroon Sorghum bicolor – MT374735 – MT374738 MT374740
F. mirum LLC929 Ethiopia Soil OP485896 OP487012 – OP486581 –
F. miscanthi NRRL 26231 T Denmark Miscanthus sinensis – MN193878 JX171521 JX171634 KU171785
F. mundagurra RBG5717 T Australia Soil – KP083256 KP083272 KP083276 MT901328
F. mundagurra LC13689 China, Hainan Province Paspalum vaginatum MW566383 MW580556 MW024544 MW474502 MW533835
F. mundagurra LGS129.2 China, Hainan Province Paspalum vaginatum MZ399201 MZ399211 MZ399204 MZ399208 MZ399214
F. mundagurra LGS129.3 China, Hainan Province Paspalum vaginatum MZ399202 MZ399212 MZ399205 MZ399209 MZ399215
F. musae NRRL 25059 T Honduras Musa sp. FN552064 FN552086 MW402689 FN552108 FN545368
F. musae NRRL 28893 Mexico Musa sp. FN552070 FN552092 – FN552114 FN545374
F. nanum LC12168 T China Musa nana MK289651 MK289602 MK289871 MK289755 –
F. napiforme NRRL 13604 T Namibia Pennisetum typhoides AF158319 AF160266 HM347136 EF470117 U34428
F. napiforme CBS 135139 India Keratitis (Human) MN534183 MN534019 MW402572 MN534290 MN534084
F. nelsonii CBS 119876 T South Africa Triticum soil GQ505374 GQ505404 MN120722 GQ505468 –
F. nelsonii NRRL 13338 Australia Soil GQ505372 MW233225 MW233397 MW233569 –
F. nepalense NRRL 54222 T Nepal Oryza sativa – KM889631 KM361650 KM361668 –
F. newnesense NRRL 66241 T Australia Soil – KP083261 – – –
F. nirenbergiae CBS 744.97 Unknown Unknown AF158365 AF160312 – LT575065 U34424
F. nirenbergiae CBS 840.88 T Netherlands Dianthus caryophyllus MH484705 MH484978 – MH484887 MH485069
F. nisikadoi NRRL 25308 T Japan Triticum aestivum – KR909358 MG282391 MG282421 –
F. nodosum CBS 201.63 T Portugal Arachis hypogaea MN120704 MN120763 MN120725 MN120743 –
F. nodosum NRRL 36351 Lisboa, Portugal Stored peanuts – MW233117 MW233289 MW233461 –
F. nothincarnatum LC18436 T China, Heilongjiang Province, Daqing City Rice – OQ125147 – OQ125509 –
F. nurragi NRRL 36452 Australia Soil – – JX171538 JX171650 –
F. nurragi CBS 393.96 T Australia Soil – MW928840 MW928814 MW928830 –
F. nygamai NRRL 13448 T Australia Sorghum bicolor AF158326 AF160273 LT996202 EF470114 U34426
F. nygamai CBS 413.97 Morocco Oryza sativa MW402462 MW402127 MW402660 MW402815 MW402325
F. odoratissimum Indo8 T Indonesia Musa sp. cv. Pisang Kepok – LS479828 LS479618 LS479386 –
F. ophioides CBS 118512 T South Africa Panicum maximum MN534209 EU921239 – MN534303 MN534118
F. ophioides CBS 118515 South Africa Panicum maximum MN534205 MN534025 – MN534298 MN534120
F. oxysporum CBS 144134 Germany Solanum tuberosum MH484771 MH485044 – MH484953 MH485135
F. palustre NRRL 54056 T USA Spartina alterniflora – MW233131 MW233303 KT597731 MH875687
F. palustre NRRL 54050 USA Spartina alterniflora – – KT597717 KT597729 –
F. panlongense LC13656 T China, Guangxi Zhuang Autonomous Region,Guilin city Musa nana MW566337 MW580510 MW024498 MW474456 MW533789
F. parvisorum CMW 25267 Colombia Pinus patula – KJ541060 – – KJ541055
F. pharetrum CBS 144751 T South Africa Aloidendron dichotomum MH484770 MH485043 MW928815 MH484952 MH485134
F. phyllophilum NRRL 13617 T Italy Dracaena deremensis KF466333 KF466421 KF466399 KF466410 KF466443
F. pilosicola NRRL 29124 T USA Bidens pilosa MN534159 MN534055 – MN534248 MN534099
F. pilosicola NRRL 29123 USA Bidens pilosa MN534165 MN534054 – MN534247 MN534098
F. pininemorale CMW 25243 T Colombia Pinus tecunumanii MN534211 MN534026 – MN534250 MN534115
F. planum LC15876 T China, Guangdong Province, Qingyuan City Maize OQ125677 OQ126125 OQ125871 OQ126555 OQ126352
F. poae NRRL 13714 Canada Overwintered wheat – – JX171458 JX171572 –
F. poae NRRL 26941 ET USA infected barley kernel – – KU171686 KU171706 KU171786
F. poae LC18712 China, Qinghai Province, Haidong City Maize – OQ125075 OQ124666 OQ124674 –
F. praegraminearum NRRL 39664 T New Zealand Litter in maize paddock – KX260120 KX260125 KX260126 KX260131
F. prieskaense CBS 146498 T South Africa Prunus spinosa MW834112 MW834275 MW834190 MW834007 MW834303
F. prieskaense CBS 146499 South Africa Prunus spinosa MW834113 MW834276 MW834191 MW834008 MW834304
F. proliferatum F026 China, Zhejiang Province, Ningbo city Musa sp. MZ399203 MZ399213 MZ399206 MZ399210 MZ399216
F. proliferatum CBS 480.96 ET Papua New Tropical rain forest soil MN534217 MN534059 – MN534272 MN534129
F. pseudoanthophilum CBS 414.97 T Zimbabwe Zea mays MW402463 MT011006 MT010949 MT010980 MW402326
F. pseudoanthophilum CBS 415.97 Zimbabwe Zea mays – MW402129 MW402662 – MW402327
F. pseudoanthophilum CBS 745.97 Zimbabwe Zea mays MW402476 MW402148 MW402697 MW402820 MW402349
F. pseudocircinatum NRRL 22946 T Ghana Solanum sp. AF158324 AF160271 LT996204 LT996151 U34427
F. pseudocircinatum CBS 455.97 Papua New Heteropsylla incisa MN534184 MN534029 – MN534276 MN534070
F. pseudocircinatum LC13676 China, Taiwan Province Syzygium samarangense MW566369 MW580542 MW024530 MW474488 MW533821
F. pseudocircinatum LC13677 China, Taiwan Province Syzygium samarangense MW566370 MW580543 MW024531 MW474489 MW533822
F. pseudograminearum NRRL 28062 T Australia Hordeum vulgare – AF212468 JX171524 JX171637 AF107867
F. pseudonygamai NRRL 13592 T Nigeria Pennisetum typhoides AF158316 AF160263 LT996205 LT996152 U34421
F. pseudonygamai CBS 416.97 Nigeria Pennisetum typhoides MN534194 MN534030 MW402663 MN534283 MN534064
F. ramigenum NRRL 25208 T USA Ficus carica KF466335 MN193867 MN193923 MN193895 KF466445
F. ramigenum CBS 526.97 USA Ficus carica MN534188 MN534032 MW402682 MN534292 MN534086
F. redolens NRRL 22901 Canada Pseudotsuga menziesii – MT409452 JX171503 JX171616 –
F. redolens NRRL 25600 ET Germany Pisum sativum – MT409453 MT409433 MT409443 AY329040
F. rubicola CFCC 70816 T China, Shaanxi Province Rubus lambertianus PP946919 PP946925 PP946939 – PP946931
F. rubicola CFCC 70817 China, Shaanxi Province Rubus lambertianus PP946920 PP946926 PP946940 – PP946932
F. rubicola CFCC 70818 China, Shaanxi Province Rubus lambertianus PP946921 PP946927 PP946941 – PP946933
F. rubicola CFCC 70819 China, Shaanxi Province Rubus lambertianus PP946922 PP946928 PP946942 – PP946934
F. sacchari NRRL 13999 ET India Saccharum officinarum AF158331 AF160278 JX171466 JX171580 U34414
F. sacchari LC1058 China, Guangdong Province, Guangzhou city Arundina graminifolia MW566371 MW580544 MW024532 MW474490 MW533823
F. sacchari LC13625 Philippines Musa sp. MW566291 MW580464 MW024455 MW474410 MW533746
F. sacchari LC13626 China, Guangdong Province, Guangzhou city Musa nana MW566292 MW580465 MW024456 MW474411 MW533747
F. sacchari LC13657 China, Guangxi Zhuang Autonomous Region, Baise city Musa nana MW566338 MW580511 MW024499 MW474457 MW533790
F. sacchari LC13678 China, Guangdong Province, Guangzhou city Musa nana MW566372 MW580545 MW024533 MW474491 MW533824
F. sacchari LC13679 China, Guangxi Zhuang Autonomous Region, Qinzhou city Musa nana MW566373 MW580546 MW024534 MW474492 MW533825
F. sacchari LC13680 China, Guangxi Zhuang Autonomous Region, Qinzhou city Musa nana MW566374 MW580547 MW024535 MW474493 MW533826
F. sacchari LC13681 China, Beijing Poa annua MW566375 MW580548 MW024536 MW474494 MW533827
F. sambucinum NRRL 22187 England Solanum tuberosum – MW834277 JX171493 JX171606 KM232078
F. sanyaense LC15882 T China, Hainan Province, Sanya City Maize OQ125641 OQ126093 OQ125859 OQ126547 OQ126322
F. sarcochroum NRRL 20472 NT Switzerland Viscum album – MW834278 JX171472 JX171586 –
F. scirpi NRRL 13402 Australia Soil GQ505504 GQ505592 JX171452 JX171566 –
F. scirpi NRRL 36478 ET Australia Soil GQ505566 GQ505654 – GQ505832 –
F. secorum NRRL 62593 T USA Beta vulgaris KJ189235 KJ189225 – – –
F. secorum NRRL 62594 USA Beta vulgaris KJ189238 KJ189228 – – –
F. sibiricum NRRL 53430 T Russia Avena sativa – HM744684 MW233302 HQ154472 HQ141659
F. siculi CPC 27188 T Italy Citrus sinensis – LT746214 LT746299 LT746327 –
F. siculi CPC 27189 Italy Citrus sinensis LT746190 LT746215 – LT746328 LT746347
F. sororula CMW 40578 T Colombia Pinus patula LT996184 KJ541067 LT996206 LT996153 KJ541057
F. spartum NRRL 66896 T Tunisia Rhizosphere of Macrochloa tenacissima – MT409459 MT409439 MT409449 –
F. sporotrichioides NRRL 3299 T France Corn – DQ676612 JX171444 DQ676587 HQ141641
F. sterilihyphosum NRRL 25623 T South Africa Mangifera indica – MN193869 MW402713 MN193897 –
F. stilboides NRRL 20429 Nyasaland Coffea sp. – – JX171468 JX171582 –
F. stilboides CBS 746.79 ET Cook Islands Citrus sp. – MW928843 MW928817 MW928832 –
F. subglutinans NRRL 22016 NT USA Zea mays AF158342 AF160289 JX171486 JX171599 U34417
F. subglutinans LC18249 China, Heilongjiang Province, Yichun City Maize OQ125674 OQ126108 OQ125971 OQ126671 OQ126342
F. subglutinans CBS 215.76 Germany Zea mays MN534171 MN534061 MW402636 MN534241 MN534109
F. subglutinans CBS 479.94 South Africa Zea mays kernel MN534166 MN534036 MW402678 MN534236 MN534105
F. subglutinans LC13682 USA Glycine max MW566376 MW580549 MW024537 MW474495 MW533828
F. subglutinans LC13683 USA Zea mays MW566377 MW580550 MW024538 MW474496 MW533829
F. subglutinans LC13684 Canada Glycine max MW566378 MW580551 MW024539 MW474497 MW533830
F. subglutinans LC13685 Canada Glycine max MW566379 MW580552 MW024540 MW474498 MW533831
F. subglutinans LC13686 Canada Glycine max MW566380 MW580553 MW024541 MW474499 MW533832
F. sublunatum NRRL 13384 Costa Rica Soil KM231389 – JX171451 JX171565 KM232076
F. subtropicale NRRL 66764 T Brazil Hordeum vulgare – MH706974 MH706972 MH706973 MH706968
F. succisae NRRL 13613 ET Germany Succisa pratensis AF158344 AF160291 LT996207 LT996154 U34419
F. sudanense CBS 454.97 T Sudan Striga hermonthica LT996185 KU711697 LT996208 LT996155 KU603909
F. sudanense CBS 675.94 Sudan Striga hermonthica MN534182 MN534038 MW402693 MN534279 MN534074
F. sulawesiense InaCC F940 T Indonesia Musa acuminata var. – LS479443 – LS479855 –
F. sulawesiense LC18688 China, Jiangsu Province, Lianyungang City Maize OQ125344 OQ125216 – OQ125467 –
F. sulawesiense LC13723 China, Guangxi Zhuang Autonomous Region Smilax corbularia MW574215 MW594393 – MW474536 MW533906
F. tanahbumbuense InaCC F965 T Indonesia Musa var. Pisang Hawa LS479432 LS479448 LS479877 LS479863 –
F. tanahbumbuense CBS 145.44 Unknown Unknown MN170371 MN170505 – MN170438 –
F. tanahbumbuense LC18534 China, Hainan Province, Lingao County Maize OQ125392 OQ125140 – OQ125499 –
F. temperatum MUCL 52463 T Belgium Zea mays MW402486 KM487197 – MW402776 MW402359
F. temperatum LC18813 China, Yunnan Province, Xuanwei City Maize OQ125672 OQ126118 OQ125989 OQ126670 OQ126332
F. temperatum NRRL 25622 South Africa Zea mays AF158354 AF160301 – – AF160317
F. temperatum LC5848 China, Guizhou Province unidentified lichen MW566327 MW580500 MW024488 MW474446 MW533779
F. terricola CBS 483.94 T Australia Soil KU603951 KU711698 LT996209 LT996156 KU603908
F. terricola CBS 119850 Australia Soil MN534180 MN534041 MW402520 MN534280 MN534075
F. thapsinum NRRL 22045 South Africa Sorghum bicolor LT996186 AF160270 JX171487 JX171600 U34418
F. thapsinum CBS 776.96 T Unknown Unknown KU603967 MN534044 MW402704 MN534289 MN534080
F. thapsinum CBS 539.79 Italy Man, white grained mycetoma MW402472 MW402140 MW402686 MW402818 MW402340
F. thapsinum LC13687 USA Sorghum bicolor MW566381 MW580554 MW024542 MW474500 MW533833
F. thapsinum LC13688 USA Glycine max MW566382 MW580555 MW024543 MW474501 MW533834
F. tjaetaba RBG 5361 T Australia Sorghum interjectum LT996187 KP083263 MW834192 KP083275 –
F. torreyae NRRL 54149 USA Torreya sp. – HM068337 JX171548 JX171660 –
F. torulosum NRRL 22748 Netherlands Boxwood – OL772877 JX171502 JX171615 –
F. trachichlamydosporum CBS 102028 Malaysia Musa sapientum MH484715 MH484988 – MH484897 MH485079
F. transvaalense CBS 144211 T South Africa Sida cordifolia – LT996099 LT996210 LT996157 –
F. transvaalense NRRL 31008 Australia Soil – MW233102 MW233274 MW233446 –
F. tricinctum NRRL 25481 ET Germany Winter wheat culm base – AB674263 JX171516 JX171629 –
F. triseptatum CBS 258.50 T USA Ipomoea batatas MH484691 MH484964 MW928820 MH484873 MH485055
F. tupiense NRRL 53984 T Brazil Mangifera indica GU737377 GU737404 LR792583 LR792619 –
F. udum NRRL 22949 Germany Lactarius pubescens AF158328 AF160275 LT996220 LT996172 U34433
F. udum BBA 65058 ET India Cajanus cajan – MK639096 – KY498875 KY498892
F. ussurianum NRRL 45681 T Russia Avena sativa – FJ240301 KM361648 KM361666 –
F. venenatum NRRL 22196 Germany Zea mays – MW233078 JX171494 JX171607 –
F. verticillioides LC18525 China, Anhui Province, Chuzhou City Maize OQ125739 OQ126150 OQ125919 OQ126583 OQ126357
F. verticillioides NRRL 22172 Germany Zea mays AF158315 AF160262 LT996221 EF470122 U34413
F. verticillioides CBS 218.76 ET Germany Zea mays MW402449 KF499582 MW402638 MW928835 MW402311
F. verticillioides LC18464 China, Liaoning Province, Shenyang City Maize OQ125698 OQ126216 – OQ126649 OQ126379
F. verticillioides LC13653 Brazil Glycine max MW566331 MW580504 MW024492 MW474450 MW533783
F. verticillioides LC13654 USA Glycine max MW566332 MW580505 MW024493 MW474451 MW533784
F. verticillioides LC13655 China, Guangdong Province, Guangzhou city Musa nana MW566333 MW580506 MW024494 MW474452 MW533785
F. verticillioides LC2810 China, Sichuan Province, Zhangjiajie bamboo MW566334 MW580507 MW024495 MW474453 MW533786
F. verticillioides LC2818 China, Beijing Physosfegia virginiana MW566335 MW580508 MW024496 MW474454 MW533787
F. verticillioides LC5896 China, Jiangxi Province, Nanchang city submerged wood MW566336 MW580509 MW024497 MW474455 MW533788
F. veterinarium NRRL 36153 T Netherlands Peritoneum of Selachimorpha MH484717 MH484990 – MH484899 MH485081
F. volatile CBS 143874 T French Guiana Human bronchoalveolar lavage fluid MK984595 LR596007 – LR596006 LR596008
F. vorosii NRRL 37605 T Hungary Triticum aestivum – DQ459745 KM361647 KM361665 –
F. weifangense LC18333 T China, Shandong Province, Weifang City Wheat OQ125276 OQ125107 – OQ125515 –
F. werrikimbe CBS 125535 T Australia Sorghum leiocladum MN534203 MW928846 MW928821 MN534304 MN534104
F. xylarioides NRRL 25486 ET Ivory Coast Coffea sp. MW402455 AY707136 JX171517 HM068355 AY707118
F. xyrophilum NRRL 62721 T Guyana Xyris surinamensis – MN193877 MN193933 MN193905 –
F. xyrophilum NRRL 62710 Guyana Xyris surinamensis – MN193875 MW402720 MN193903 –
F. zanthoxyli NRRL 66285 T China Zanthoxylum bungeanum – OM160879 OM160837 OM160858 –
Fusicolla violacea CBS 634.76 T Iran Quadraspidiotus perniciosus KM231407 KM231956 KM232251 – KM232095

a The new species names, described in this study are in bold. b Abbreviations for the culture collections: the U.S. Agricultural Research Service culture collection (NRRL); the Westerdijk Fungal Biodiversity Institute (WI) collection (CBS); the working collection of FABI (CMW) of the Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, South Africa; the working collection of the author Neriman Yilmaz (NY), University of Pretoria, South Africa; (BBA) Julius Kühn-Institute, Institute for Epidemiology and Pathogen Diagnostics, Berlin & Braunschweig, Germany; the University Recife Mycology culture collection at the Universidade Federal de Pernambuco, Recife, Brazil (URM); Mycotheque de lUniversite Catholique de Louvain, Louvain-la-Neuve, Belgium (MUCL); Lei Cai’s personal culture collection (LC), the Institute of Microbiology, Chinese Academy of Sciences, Beijing, China; Indonesian culture collection (InaCC); Zhongkai University of Agriculture and Engineering (ZHKUCC); South African National Collection of Fungi (PPRI); (CPC) Collection of P.W. Crous, held at WI; (FRC) Fusarium Research Center, University Park, PA, USA. c The sequences deposited to GenBank in this study are in bold. ET: Ex-epitype, NT: Ex-neotype, HT: Ex-holotype, T: Ex-type.

Phylogenetic analyses

Sequences were aligned in MAFFT v. 7 at the web server (http://mafft.cbrc.jp/alignment/server) (Katoh et al. 2019) and further corrected manually using MEGA7.0.21 (Kumar et al. 2016). Phylogenies were calculated for each gene individually, followed by a concatenated dataset of the five genes (each gene region was treated as a separate partition) using Maximum Likelihood (ML) and Bayesian Inference (BI) methods. Using RAxMLHPC Blackbox 8.2.10 (Stamatakis 2014) on the CIPRES Science Gateway portal to perform Maximum Likelihood (ML) analysis (https://www.phylo.org), the GTR-GAMMA model was selected, and a total of 1000 bootstrap replicates were run. The Bayesian posterior probability (BPP) was determined using Markov chain Monte Carlo (MCMC) sampling in MrBayes v.3.2.6 (Ronquist et al. 2012). The six Markov chains run simultaneously for 1 million generations from a random tree, with tree sampling occurring every 100 generations. For accuracy, 25% of the aged samples were discarded and the analysis was continued until the mean standard deviation of the split frequencies was below 0.01. The phylogram was visualized in FigTree v.1.3.1 (http://tree.bio.ed.ac.uk/software) and edited using Adobe Illustrator CS5 (Adobe Systems Inc., USA).

The genealogical concordance phylogenetic species recognition (GCPSR) model was used to analyze phylogenetically related but ambiguous species, and a pairwise homoplasy index (PHI) test was performed. A pairwise homoplasy index (PHI) test (Philippe and Bryant 2006) was conducted in SplitsTree (Huson 1998; Huson and Bryant 2006) to assess the level of recombination among phylogenetically closely related species, using both the LogDet transformation and splits decomposition options. This analysis utilized a concatenated five-locus dataset (tef1, CaM, rpb1, rpb2, and tub2) from closely related species. If the pairwise homoplasy index results were below a 0.05 threshold (Φw < 0.05), it indicated significant recombination in the dataset. The relationships between closely related species were visualized by constructing splits graph.

Morphological observations

Fusarium species were characterized and described based on the previously defined macroscopic and microscopic morphological characteristics (Crous et al. 2021). After incubating at 25 °C in darkness for 7 days, approximately 5 × 5 mm agar plates were taken from the edge of colonies on SNA (synthetic nutrient-poor agar; Nirenberg 1976) and transferred to the culture medium for morphological characterization. Colony morphology, production of pigments, and odors were documented on PDA, OA (oatmeal agar; Crous et al. 2019), and SNA after incubation for 7 days at 25 °C in darkness. Colony color codes were determined following the protocols of Kornerup and Wanscher (1978).

For morphological comparison, cultures on CLA (carnation leaf agar; Fisher et al. 1982) should be incubated at 25 °C for 7–14 days under a 12/12-hour near-ultraviolet/dark cycle to observe micromorphological characteristics, including sporodochia, conidiophores, phialides, conidia (both sporodochial and aerial), and chlamydospores. Morphological characteristics were examined and photodocumented using water as a mounting medium under a Leica DM 2500 dissecting microscope (Wetzlar, Germany) and a Nikon Eclipse 80i compound microscope equipped with differential interference contrast (DIC) illumination. Images were captured with a Nikon DS-Ri2 camera and processed using the Nikon NIS Elements F4.30.01 software. For each species, 30 phialides and chlamydospores, and 50 conidia were randomly measured to calculate the mean, standard deviation, and minimum-maximum values. Taxonomic novelties were deposited in MycoBank (http://www.mycobank.org).

Results

Phylogeny

The Bayesian Inference (BI) and Maximum Likelihood (ML) phylogenetic analyses of the phylogeny of the six isolates of Fusarium fungi produced topologically similar trees. The analysis was conducted using a combined dataset of tef1, rpb1, and rpb2, which contained 3 241 characters, including gaps. This dataset comprised 777 bp for tef1, 1 559 bp for rpb1, and 898 bp for rpb2. Fusicolla camptoceras CBS 634.76 (ex-type) was used as the outgroup taxon. The combined tef1, rpb1, and rpb2 phylogeny (Fig. 1) revealed that the six isolates clustered into the Fusarium fujikuroi species complex (FFSC).

Figure 1. 

Fifty percent majority rule consensus tree from a Bayesian analysis based on a three-locus combined dataset (tef1, rpb1, and rpb2) illustrating the phylogenetic relationship between six isolates of Fusarium and the Fusarium species complex. The Bayesian posterior probabilities (PP > 0.95) and PhyML Bootstrap support values (BS > 50) are displayed at the nodes (PP/ML). The tree was rooted to Fusicolla violacea (CBS 634.76 T). Ex-type cultures are indicated with ‘T’, epi-type with ‘ET’, neotype with ‘NT’.

In order to conduct further phylogenetic analysis on 6 strains of Fusarium, a multigene phylogeny was used to reveal the identities of the FFSC (Fig. 2). The alignment contained 269 taxa and was 4 342 bp long, including the gaps. This dataset comprised 681 bp for tef1, 668 bp for CaM, 1 555 bp for rpb1, 879 bp for rpb2, and 535 bp for tub2. In addition, individual gene phylogenies were generated to assess the genealogical concordance of the novel species of FFSC (Suppl. material 1: figs S1–S5). Genealogical concordance analyses subsequently confirmed the distinctiveness of the two novel species described in this study. The two new species are now recognized as F. castaneophilum and F. rubicola.

Figure 2. 

Fifty percent majority rule consensus tree from a Bayesian analysis based on a five-locus combined dataset (tef1, CaM, rpb1, rpb2, and tub2) showing the phylogenetic relationships of species within the Fusarium fujikuroi species complex (FFSC). The Bayesian posterior probabilities (PP > 0.9) and PhyML Bootstrap support values (BS > 50) are displayed at the nodes (PP/ML). The tree was rooted to F. nirenbergiae (CBS 744.97). New species are indicated in bold, ex-type cultures with ‘T’, epi-type with ‘ET’, neotype with ‘NT’.

Applying the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) concept to F. castaneophilum, we selected F. elaeagni (LC18815, LC13627, LC13628, LC13629), F. erosum (LC15877), F. fujikuroi (LC13634, LC13635) and F. siculi (CPC 27189), as closely related species. The concatenated sequence dataset of five-loci (tef1, CaM, rpb1, rpb2 and tub2) underwent the Population History Index (PHI) test, revealing that no significant recombination was observed among these isolates/taxa (Φw = 0.7005) (Fig. 3A). This finding provided strong support for the proposition that these isolates belonged to three distinct taxa.

Figure 3. 

The results of the pairwise homoplasy index (PHI) test for two newly described taxa and closely related species were obtained from the five-locus concatenated datasets (tef1, CaM, rpb1, rpb2, and tub2), using both LogDet transformation and splits decomposition A the PHI of Fusarium castaneophilum sp. nov. with their phylogenetically related isolates or species B the PHI of Fusarium rubicola sp. nov. with their phylogenetically related isolates or species. PHI test results (Φw) < 0.05 indicate significant recombination within the dataset.

Applying the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) concept to F. rubicola, we selected F. fractiflexum (NRRL 28852) and F. sanyaense (LC15882) as closely related species. The concatenated sequence dataset of five-loci (tef1, CaM, rpb1, rpb2 and tub2) underwent the Population History Index (PHI) test, revealing that no significant recombination was observed among these isolates/taxa (Φw = 1.0) (Fig. 3B), which strongly supported the proposition that these isolates belonged to three distinct taxa.

Taxonomy

In this section, Latin binomials are provided for the two novel phylospecies resolved in this study, namely F. castaneophilum and F. rubicola.

Fusarium castaneophilum M.W. Zhang & C.M. Tian, sp. nov.

MycoBank No: 854421
Fig. 4

Type

China • BeiJing, Huairou District Castanea Technology Test and Promotion Station (40°25'37.21"N, 116°32'42.83"E), on branch of Castanea mollissima, 9 Oct 2022, Y. Ren, holotype BJFC-HR08, ex-type living culture CFCC 70814.

Figure 4. 

Fusarium castaneophilum (ex-type culture CFCC 70814) A colony on PDA B colony on OA C colony on SNA D, E aerial conidiophores and conidiogenous cells F, G aerial microconidia H, I chlamydospores J aerial macroconidia. Scale bars: 10 μm (D–K)

Etymology

Named after the host genus from which it was isolated, Castanea.

Description

Conidiophores in aerial mycelia, 12–49 μm tall, simple or loosely irregularly branched, bearing terminal or intercalary polyphialides, smooth- and thin-walled, 5.9–35.8 × 1.9–4.3 (av. ± sd. 14.2 ± 6.5 × 2.7 ± 0.5 μm), periclinal thickening inconspicuous or absent; aerial conidia hyaline, smooth- and thin-walled, of two types: (a) microconidia ellipsoidal, obovoid to subclavate, 0–1-septate: 4.5–12 × 2–3.6 μm (av. ± sd. 7.2 ± 1.5 × 2.7 ± 0.3 μm); (b) macroconidia clavate to falcate, straight or dorsiventrally curved, with a blunt to slightly papillate apical cell and a blunt to barely notched or foot-like basal cell, smooth- and thin-walled, 1–3-septate; 1-septate conidia: 14.7–48.6 × 2.3–7.5 μm (av. ± sd. 28.9 ± 8.1 × 4.8 ± 1.3 μm); 2-septate conidia: 24.6–70.4 × 2.2–7.1 μm (av. ± sd. 39.9 ± 8.9 × 5.1 ± 0.9 μm); 3-septate conidia: 26.6–90.4 × 2.2–7.3 μm (av. ± sd. 56.3 ± 14.1 × 5 ± 1.2 μm). Chlamydospores formed in pairs or forming chains, intercalary, globose to subglobose, 7.3–9.5 µm diam, thick-walled, smooth. Sporodochia not observed.

Culture characteristics

Colonies on PDA growing in the dark reaching 7.8–8.0 cm diam after 7 days at 25 °C, optimal 25–30 °C (after 7 days), raised, aerial mycelia dense, colony margin filamentous, surface vinaceous purple in the center, pale luteous at the margin; reverse dark purple in the center, pure yellow at the margin. Colonies on OA growing in the dark reaching 6.8–7 cm diam after 7 days at 25 °C, raised, aerial mycelia dense, colony margin entire, surface white; reverse orange in the center, luteous at the margin. Colonies on SNA grown in the dark reaching 6.4–6.6 cm diam after 7 days at 25 °C, flat, aerial mycelia scant, colony margin entire, white; reverse white. Pigment and odor absent.

Notes

The isolates of F. castaneophilum were phylogenetically closely related to F. elaeagni (ex-type, LC 13627) isolated from Elaeagnus pungens in China (Fig. 2). There were 24 nucleotide position differences between the two species (7/658 in tef1, 1/591 in CaM, 9/891 in rpb1, 3/879 in rpb2, 4/490 in tub2). The PHI analysis showed that there was no significant recombination between F. castaneophilum isolates and its related species (Φw = 0.7005) (Fig. 3A). Morphologically, F. elaeagni did not produce any pigment, and the aerial mycelium on PDA was raised, aerial mycelia dense, sporodochia were grayish-orange, and abundantly formed on carnation leaves. However, F. castaneophilum produces a purple pigment, and the mycelium on PDA is sparser than the former, no obvious protruding colonies. Microscopically, F. castaneophilum has chlamydospores and its aerial phialides are longer than F. elaeagni, microconidia are slightly larger than F. elaeagni. Thus, F. castaneophilum is recognized as a novel species in FFSC.

Fusarium rubicola M.W. Zhang & C.M. Tian, sp. nov.

MycoBank No: 854422
Fig. 5

Type

China • Shaanxi Province, Ningshan County Huoditang Shibazhang Waterfall Park (33°23'56.23"N, 108°22'9.93"E), on leaf of Rubus lambertianus, 19 Jul 2021, S.J. Li, holotype BJFC-H187, ex-type living culture CFCC 70819.

Figure 5. 

Fusarium rubicola (ex-type culture CFCC 70816) A colony on PDA B colony on OA C colony on SNA D–F aerial conidiophores, phialides, and aerial conidia G, H aerial microconidia I, J chlamydospores K, L aerial macroconidia. Scale bars: 10 μm (D–K).

Etymology

Named after the host genus from which it was isolated, Rubus.

Description

Conidiophores in aerial mycelia, 27–90 μm tall, straight or flexuous, smooth- and thin-walled, unbranched, sympodial or irregularly branched, bearing terminal or lateral phialides; aerial phialides polyphialides, subulate to subcylindric, smooth- and thin-walled, periclinal thickening inconspicuous or absent, 5.9–35.8 × 1.9–4.3 μm; aerial conidia hyaline, smooth- and thin-walled, of two types: (a) microconidia ellipsoidal to clavate, aseptate, 7.9–42.7 × 1.7–4.3 μm (av. ± sd. 22.6 ± 7.6 × 3.0 ± 0.6 μm), clustering in discrete false heads at the phialide tips; (b) macroconidia slightly clavate to falcate, straight or gently dorsiventrally curved, with a blunt to slightly papillate apical cell and a blunt to gently notched basal cell, smooth- and thin-walled, 1–3-septate; 1-septate conidia: 15.9–41.5 × 2.7–5.1 μm (av. ± sd. 24.9 ± 4.4 × 4 ± 0.5 μm); 2-septate conidia: 27–51 × 2.9–6.4 μm (av. ± sd. 36.7 ± 5.6 × 4.6 ± 0.8 μm); 3-septate conidia: 26.9–82 × 2.1–6.3 μm (av. ± sd. 53.7 ± 11.7 × 4.6 ± 0.9 μm). Chlamydospores abundant, globose, subglobose to ovoid, subhyaline, smooth-walled, intercalary, solitary, in pairs or forming chains, 7.4–14.9 μm diam. Sporodochia not observed.

Culture characteristics

Colonies on PDA growing in the dark reaching 7.8–8.0 cm diam after 7 days at 25 °C, optimal 25–30 °C (after 7 days), raised, aerial mycelia dense, colony margin entire, surface pale violet to mauve in the center, pale luteous to white at the margin; reverse livid purple in the center, pure yellow at the margin. Colonies on OA growing in the dark reaching 7.0–7.2 cm diam after 7 days at 25 °C, raised, aerial mycelia dense, colony margin crimp, surface pale purple in the center, white at the marginwhite; reverse vinaceous purple in the center, pale luteous at the margin. Colonies on SNA grown in the dark reaching 6.0–6.2 cm diam after 7 days at 25 °C, slightly raised, aerial mycelia scant, colony margin entire, white; reverse white. Pigment and odor absent.

Notes

The isolates of F. rubicola were phylogenetically closely related to F. fractiflexum (ex-type, NRRL 28852) isolated from Cymbidium ssp. in Japan (Fig. 2). There were 15 nucleotide position differences between the two species (8/667 in tef1, 2/645 in CaM, 5/865 in rpb1). The PHI analysis showed that there was no significant recombination between F. rubicola isolates and its related species (Φw = 1.0) (Fig. 3B). Morphologically, F. fractiflexum forms yellowish colonies, while F. rubicola forms purple colonies on the PDA. Microscopically, the microconidia of F. fractiflexum are 0–3 septate, forming zigzag-like conidial chains, without chlamydospores. Nevertheless, the microconidia of F. rubicola are aseptate, lack zigzag-like conidial chains, and inherence chlamydospores. In conclusion, the phylogenetic and morphological evidence support this fungus being a new species within the FFSC.

Discussion

The genus Fusarium was first discovered by Link (1809) and established based on F. roseum. At that time, the main morphological characteristics of Fusarium were determined to be unique canoe-like or banana-like conidia. However, several other genera also produce spores in this form, so it may be incorrect to identify Fusarium based solely on morphology. With the development of molecular biology, molecular technology has been widely applied in fungal taxonomy and systematics. The phylogenetic species established based on molecular biology can compensate for some deficiencies of morphological species, reflect the phylogenetic relationship of Fusarium more scientifically, and provide a scientific basis and technical methods for rapid molecular detection and identification of strains. The current study reveals that the FFSC comprises more than 60 accepted species, including numerous cryptic species that can only be identified through phylogenetic analysis. In this study, morphology, phylogeny, and Pathogenicity-Related Index (PHI) tests were combined to identify two new species within the Fusarium fujikuroi species complex (FFSC). Phylogenetic analyses of a five-gene dataset strongly supported the uniqueness of the two Fusarium phylospecies identified, with robust monophyletic statistical support values.

Research indicates that the FFSC (Fusarium fujikuroi species complex) comprises three primary clades, which were classified at the time as the Asian, American, and African clades. (O’Donnell et al. 1998a). Subsequently, they found that the African branch was divided into three sub-branches: African Clade A, African Clade B, and African Clade C. In this study, we confirmed that the African clade is not monophyletic, and that F. dlaminii and F. fredkrugeri form a separate group (the African clade B). This is consistent with the studies of Herron et al. (2015), Sandoval-Denis et al. (2018b), and Wang et al. (2022). And the study found that the African clade C forms a sister clade of the American clade and African clade B, which is consistent with the findings of Crous et al. (2021). This experiment further verified and clarified that the African clade is not monophyletic. Two of the newly named species in this study, F. castaneophilum and F. rubicola, were resolved in the Asian clade.

Fusarium is a notorious plant pathogen that can lead to the death of the host, decrease the yield of cash crops, and result in significant economic losses. This study isolated two new species from Castanea mollissima and Rubus lambertianus. Fusarium castaneophilum was isolated from chestnut plants (C. mollissima). Castanea mollissima is an important economic tree species widely distributed in Asia, America, Africa, and Europe (Sun et al. 2022). Wang et al. (2006) reported that a significant number of Fusarium species have been isolated from the C. mollissima fruit rot disease in Beijing, but the specific species have not been identified. Numerous studies have shown that Fusarium poses a threat to the safety of C. mollissima in China. In which, F. proliferatum (FFSC), F. graminearum (FSAMSC), F. equiseti (FIESC), and F. solani (Neocosmospora currently) have all been reported as pathogens of C. mollissima in Guizhou, Beijing, Hebei, and other locations in China (Zhang et al. 2022; Zhu 2024). Fusarium castaneophylum may be a potential pathogenic fungus for C. mollissima, and its pathogenicity requires further study.

In this study, F. rubicola was isolated from Rubus lambertianus. There is currently limited research on Fusarium affecting R. lambertianus. Studies have found that Fusarium can make other plants in Rubus (such as R. idaeus, R. fruticosus, etc.) susceptible to diseases (Pastrana et al. 2021; Yang et al. 2024). Among them, Zhang et al. (2013) found that the pathogen responsible for R. idaeus stem blight is F. equiseti (FIESC), while the pathogen causing R. idaeus fruit rot is F. avenaceum (FTSC). In addition, Heilongjiang and Yunnan provinces have also discovered fungi from the Fusarium that damage plants of Rubus. Fusarium rubicola may be a potential pathogenic fungus for R. lambertianus, requiring further research on its pathogenicity.

The newly described Fusarium species in this study have not been linked to any pathogenic effects on their hosts. However, they should not be ignored, as the host range of several species in the FFSC has not yet been determined. For some researchers, it may be irrelevant to describe species without information regarding its pathogenic and/or mycotoxigenic potential. Regardless, it is still of utmost importance to better understand the biodiversity of a specific Fusarium species. This study provides Latin binomials for two new species, which will facilitate the opportunity to more easily identify other isolates of these species in future research.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This study is financed by National Natural Science Foundation of China (Project No.: 32371887).

Author contributions

Conceptualization, Mingwei Zhang and Chengming Tian; data curation, Mingwei Zhang; funding acquisition, Chengming Tian; investigation, Mingwei Zhang, Shuji Li; project administration, Chengming Tian; resources, Mingwei Zhang; supervision, Chengming Tian; writing-original draft, Mingwei Zhang; writing-review and editing, Mingwei Zhang, Cheng Peng, and Chengming Tian. All authors have read and agreed to the published version of the manuscript.

Author ORCIDs

Mingwei Zhang https://orcid.org/0009-0006-9906-1234

Cheng Peng https://orcid.org/0009-0005-9619-8246

Shuji Li https://orcid.org/0009-0006-4734-8399

Chengming Tian https://orcid.org/0000-0002-3352-7664

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Al-Hatmi AMS, Sandoval-Denis M, Nabet C, Ahmed SA, Demar M, Normand A-C, de Hoog GS (2019) Fusarium volatile a new potential pathogen from a human respiratory sample. Fungal Systematics and Evolution 4(11): 171–181. https://doi.org/10.3114/fuse.2019.04.09
  • Bhunjun CS, Chen YJ, Phukhamsakda C, Boekhout T, Groenewald JZ, McKenzie EHC, Francisco EC, Frisvad JC, Groenewald M, Hurdeal VG, Luangsa-Ard J, Perrone G, Visagie CM, Bai FY, Błaszkowski J, Braun U, de Souza FA, de Queiroz MB, Dutta AK, Gonkhom D, Goto BT, Guarnaccia V, Hagen F, Houbraken J, Lachance MA, Li JJ, Luo KY, Magurno F, Mongkolsamrit S, Robert V, Roy N, Tibpromma S, Wanasinghe DN, Wang DQ, Wei DP, Zhao CL, Aiphuk W, Ajayi-Oyetunde O, Arantes TD, Araujo JC, Begerow D, Bakhshi M, Barbosa RN, Behrens FH, Bensch K, Bezerra JDP, Bilański P, Bradley CA, Bubner B, Burgess TI, Buyck B, Čadež N, Cai L, Calaça FJS, Campbell LJ, Chaverri P, Chen YY, Chethana KWT, Coetzee B, Costa MM, Chen Q, Custódio FA, Dai YC, Damm U, Santiago ALCMA, De Miccolis Angelini RM, Dijksterhuis J, Dissanayake AJ, Doilom M, Dong W, Álvarez-Duarte E, Fischer M, Gajanayake AJ, Gené J, Gomdola D, Gomes AAM, Hausner G, He MQ, Hou L, Iturrieta-González I, Jami F, Jankowiak R, Jayawardena RS, Kandemir H, Kiss L, Kobmoo N, Kowalski T, Landi L, Lin CG, Liu JK, Liu XB, Loizides M, Luangharn T, Maharachchikumbura SSN, Mkhwanazi GJM, Manawasinghe IS, Marin-Felix Y, McTaggart AR, Moreau PA, Morozova OV, Mostert L, Osiewacz HD, Pem D, Phookamsak R, Pollastro S, Pordel A, Poyntner C, Phillips AJL, Phonemany M, Promputtha I, Rathnayaka AR, Rodrigues AM, Romanazzi G, Rothmann L, Salgado-Salazar C, Sandoval-Denis M, Saupe SJ, Scholler M, Scott P, Shivas RG, Silar P, Silva-Filho AGS, Souza-Motta CM, Spies CFJ, Stchigel AM, Sterflinger K, Summerbell RC, Svetasheva TY, Takamatsu S, Theelen B, Theodoro RC, Thines M, Thongklang N, Torres R, Turchetti B, van den Brule T, Wang XW, Wartchow F, Welti S, Wijesinghe SN, Wu F, Xu R, Yang ZL, Yilmaz N, Yurkov A, Zhao L, Zhao RL, Zhou N, Hyde KD, Crous PW (2024) What are the 100 most cited fungal genera? Studies in Mycology 108: 1–411. https://doi.org/10.3114/sim.2024.108.01
  • Crous PW, Verkley GJM, Groenewald JZ, Houbraken J (2019) Fungal Biodiversity. In: Westerdijk Laboratory Manual Series 1. Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands.
  • Crous PW, Lombard L, Sandoval-Denis M, Seifert KA, Schroers HJ, Chaverri P, Gené J, Guarro J, Hirooka Y, Bensch K, Kema GHJ, Lamprecht SC, Cai L, Rossman AY, Stadler M, Summerbell RC, Taylor JW, Ploch S, Visagie CM, Yilmaz N, Frisvad JC, Abdel-Azeem AM, Abdollahzadeh J, Abdolrasouli A, Akulov A, Alberts JF, Araújo JPM, Ariyawansa HA, Bakhshi M, Bendiksby M, Ben Hadj Amor A, Bezerra JDP, Boekhout T, Câmara MPS, Carbia M, Cardinali G, Castañeda-Ruiz RF, Celis A, Chaturvedi V, Collemare J, Croll D, Damm U, Decock CA, de Vries RP, Ezekiel CN, Fan XL, Fernández NB, Gaya E, González CD, Gramaje D, Groenewald JZ, Grube M, Guevara-Suarez M, Gupta VK, Guarnaccia V, Haddaji A, Hagen F, Haelewaters D, Hansen K, Hashimoto A, Hernández-Restrepo M, Houbraken J, Hubka V, Hyde KD, Iturriaga T, Jeewon R, Johnston PR, Jurjević Ž, Karalti İ, Korsten L, Kuramae EE, Kušan I, Labuda R, Lawrence DP, Lee HB, Lechat C, Li HY, Litovka YA, Maharachchikumbura SSN, Marin-Felix Y, Matio Kemkuignou B, Matočec N, McTaggart AR, Mlčoch P, Mugnai L, Nakashima C, Nilsson RH, Noumeur SR, Pavlov IN, Peralta MP, Phillips AJL, Pitt JI, Polizzi G, Quaedvlieg W, Rajeshkumar KC, Restrepo S, Rhaiem A, Robert J, Robert V, Rodrigues AM, Salgado-Salazar C, Samson RA, Santos ACS, Shivas RG, Souza-Motta CM, Sun GY, Swart WJ, Szoke S, Tan YP, Taylor JE, Taylor PWJ, Tiago PV, Váczy KZ, van de Wiele N, van der Merwe NA, Verkley GJM, Vieira WAS, Vizzini A, Weir BS, Wijayawardene NN, Xia JW, Yáñez-Morales MJ, Yurkov A, Zamora JC, Zare R, Zhang CL, Thines M (2021) Fusarium: More than a node or a foot-shaped basal cell. Studies in Mycology 98: 100116. https://doi.org/10.1016/j.simyco.2021.100116
  • Desjardins AE (2006) Fusarium mycotoxins: chemistry, genetics and biology. American Phytopathological Society, USA.
  • Fisher NL, Burgess LW, Toussoun TA, Nelson PE (1982) Carnation leaves as a substrate and for preserving cultures of Fusarium species. Phytopathology 72(1): 151–153. https://doi.org/10.1094/Phyto-72-151
  • Herron DA, Wingfield MJ, Wingfield BD, Rodas CA, Marincowitz S, Steenkamp ET (2015) Novel taxa in the Fusarium fujikuroi species complex from Pinus spp. Studies in Mycology 80(1): 131–150. https://doi.org/10.1016/j.simyco.2014.12.001
  • Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108
  • Kornerup A, Wanscher JH (1978) Methuen handbook of colour. 3rd edn. Eyre Methuen, London.
  • Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Kwasna H, Chelkowski J, Zajkowski P (1991) Grzyby (Mycota) tom XXII. Sierpik (Fusarium). Polska Akademia Nauk, Flora Polska, Warsaw, Poland.
  • Li MF, He J, Ding L, Kang J, Zhang Q, Zheng Q (2007) Single spore strains without producing fruit body isolated from Cordyceps militeris and their RAPD analysis. Xi Nan Nong Ye Xue Bao 20(3): 547–550. https://doi.org/10.16213/j.cnki.scjas.2007.03.050
  • Link JHF (1809) Observationes in ordines plantarum naturales. Dissertatio Ima. Gesellschaft Naturforschender Freunde zu Berlin. Magazin 3(1): 3–42.
  • Nirenberg H (1976) Untersuchungen über die morphologische und biologische Differenzierung in der Fusarium-Sektion Liseola. Mitteilungen aus der Biologischen Bundesanstalt für Landund Forstwirtschaft Berlin-Dahlem 169: 1–117.
  • O’Donnell K, Cigelnik E (1997) Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7(1): 103–116. https://doi.org/10.1006/mpev.1996.0376
  • O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC (1998b) Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the United States of America 95(5): 2044–2049. https://doi.org/10.1073/pnas.95.5.2044
  • O’Donnell K, Nirenberg H, Aoki T, Cigelnik E (2000) A multigene phylogeny of the Gibberella fujikuroi species complex: Detection of additional phylogenetically distinct species. Mycoscience 41(1): 61–78. https://doi.org/10.1007/BF02464387
  • O’Donnell K, Sutton DA, Rinaldi MG, Sarver BA, Balajee SA, Schroers HJ, Summerbell RC, Robert VA, Crous PW, Zhang N, Aoki T, Jung K, Park J, Lee Y-H, Kang S, Park B, Geiser DM (2010) An Internet-accessible DNA sequence database for identifying fusaria from human and animal infections. Journal of Clinical Microbiology 48(10): 3708–3718. https://doi.org/10.1128/JCM.00989-10
  • O’Donnell K, Rooney AP, Proctor RH, Brown DW, McCormick SP, Ward TJ, Frandsen RJN, Lysøe E, Rehner SA, Aoki T, Robert VARG, Crous PW, Groenewald JZ, Kang S, Geiser DM (2013) Phylogenetic analyses of RPB1 and RPB2 support a middle Cretaceous origin for a clade comprising all agriculturally and medically important fusaria. Fungal Genetics and Biology 52: 20–31. https://doi.org/10.1016/j.fgb.2012.12.004
  • O’Donnell K, Ward TJ, Robert VARG, Crous PW, Geiser DM, Kang S (2015) DNA sequence-based identification of Fusarium: Current status and future directions. Phytoparasitica 43(5): 583–595. https://doi.org/10.1007/s12600-015-0484-z
  • Qiu J, Lu Y, He D, Lee YW, Ji F, Xu J, Shi J (2020) Fusarium fujikuroi species complex associated with rice, maize, and soybean from Jiangsu province, China: Phylogenetic, pathogenic, and toxigenic analysis. Plant Disease 104(8): 2193–2201. https://doi.org/10.1094/PDIS-09-19-1909-RE
  • Reeb V, Lutzoni F, Roux C (2004) Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Molecular Phylogenetics and Evolution 32(3): 1036–11060. https://doi.org/10.1016/j.ympev.2004.04.012
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Sandoval-Denis M, Guarnaccia V, Polizzi G, Crous PW (2018a) Symptomatic Citrus trees reveal a new pathogenic lineage in Fusarium and two new Neocosmospora species. Persoonia 40(1): 1–25. https://doi.org/10.3767/persoonia.2018.40.01
  • Wang MM, Crous PW, Sandoval-Denis M, Han SL, Liu F, Liang JM, Duan WJ, Cai L (2022) Fusarium and allied genera from China: Species diversity and distribution. Persoonia 48(1): 1–153. https://doi.org/10.3767/persoonia.2022.48.01
  • Wollenweber HW, Sherbakoff CD, Reinking OA, Johann H, Bailey AA (1925) Fundamentals for taxonomic studies of Fusarium. Journal of Agricultural Research 30: 833–843.
  • Yilmaz N, Sandoval-Denis M, Lombard L, Visagie CM, Wingfield BD, Crous PW (2021) Redefining species limits in the Fusarium fujikuroi species complex. Persoonia 46(1): 129–162. https://doi.org/10.3767/persoonia.2021.46.05

Supplementary material

Supplementary material 1 

Phylogeny of the different genes region of species from the Fusarium fujikuroi species complex

Mingwei Zhang, Cheng Peng, Shuji Li, Chengming Tian

Data type: zip

Explanation note: fig. S1. Phylogeny of the tef1 gene region of species from the Fusarium fujikuroi species complex. F. nirenbergiae (CBS 744.97) was selected as the out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥50%) are indicated above branches. Ex-type cultures are indicated with ‘T’, epi-type with ‘ET’, and neotype with ‘NT’. fig. S2. Phylogeny of the CaM gene region of species from the Fusarium fujikuroi species complex. F. nirenbergiae (CBS 744.97) was selected as the out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥50%) are indicated above branches. Ex-type cultures are indicated with ‘T’, epi-type with ‘ET’, and neotype with ‘NT’. fig. S3. Phylogeny of the rpb1 gene region of species from the Fusarium fujikuroi species complex. F. nirenbergiae (GUCC 197140.2) was selected as the out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥50%) are indicated above branches. Ex-type cultures are indicated with ‘T’, epi-type with ‘ET’, and neotype with ‘NT’. fig. S4. Phylogeny of the rpb2 gene region of species from the Fusarium fujikuroi species complex. F. nirenbergiae (CBS 744.97) was selected as the out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥50%) are indicated above branches. Ex-type cultures are indicated with ‘T’, epi-type with ‘ET’, and neotype with ‘NT’. fig. S5. Phylogeny of the tub2 gene region of species from the Fusarium fujikuroi species complex. F. nirenbergiae (CBS 744.97) was selected as the out-group. Strains belonging to new species are indicated in bold. Bootstrap values (≥50%) are indicated above branches. Ex-type cultures are indicated with ‘T’, epi-type with ‘ET’, and neotype with ‘NT’.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (1.99 MB)
login to comment