Research Article
Print
Research Article
Morphological and phylogenetic analyses reveal eight novel species of Pestalotiopsis (Sporocadaceae, Amphisphaeriales) from southern China
expand article infoXing-Xing Luo‡, Ming-Gen Liao‡, Kai Zhang§, Rafael F. Castañeda-Ruíz|, Jian Ma‡, Zhao-Huan Xu‡
‡ Jiangxi Agricultural University, Nanchang, China
§ Shandong Agriculture and Engineering University, Jinan, China
| Instituto de Investigaciones de Sanidad Vegetal, Havana, Cuba

Corresponding author: Jian Ma ( jxaumj@126.com )

Corresponding author: Zhao-Huan Xu ( hzzhaohuan@163.com )

Academic editor: Xinlei Fan
© 2024 Xing-Xing Luo, Ming-Gen Liao, Kai Zhang, Rafael F. Castañeda-Ruíz, Jian Ma, Zhao-Huan Xu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Luo X-X, Liao M-G, Zhang K, Castañeda-Ruiz RF, Ma J, Xu Z-H (2024) Morphological and phylogenetic analyses reveal eight novel species of Pestalotiopsis (Sporocadaceae, Amphisphaeriales) from southern China. MycoKeys 109: 207-238. https://doi.org/10.3897/mycokeys.109.131000
Open Access

Abstract

Plants play an important role in maintaining the ecological balance of the biosphere, but often suffer from pathogenic fungi during growth. During our continuing mycological surveys of plant pathogens from terrestrial plants in Jiangxi and Yunnan provinces, China, 24 strains of Pestalotiopsis isolated from diseased and healthy tissues of plant leaves represented eight new species, viz. P. alpinicola, P. camelliicola, P. cyclosora, P. eriobotryae, P. gardeniae, P. hederae, P. machiliana and P. mangifericola. Multi-locus (ITS, tef1-α and tub2) phylogenetic analyses were performed using maximum-likelihood and Bayesian inference to reveal their taxonomic placement within Pestalotiopsis. Both molecular phylogenetic analyses and morphological comparisons supported them as eight independent taxa within Pestalotiopsis. Illustrations and descriptions of these eight taxa were provided, in conjunction with comparisons with closely related taxa in the genus. This work highlights the large potential for new fungal species associated with diseased plant leaves.

Key words

Asexual Ascomycota, molecular phylogeny, new species, Sordariomycetes, taxonomy

Introduction

Fungi are widely distributed and highly diverse in nature, forming large and complex ecosystems that play crucial roles in many biological processes (Schimann et al. 2017). Current estimates of fungal diversity are highly uncertain, ranging from 1.5 to 12 million species (Wu et al. 2019; Hyde et al. 2021; Bhunjun et al. 2022). The abundance of fungi remains to be unexplored, and only 10% of fungi were currently described (Hyde et al. 2021), but most species lack the molecular data before the advent of Sanger sequencing. In recent years, with the development of molecular techniques, the DNA-based species delimitation techniques are maturing gradually and have become an important approach to evaluate the fungal phylogenetic relationships and taxonomic placements in the study of modern fungal classification.

Pestalotiopsis Steyaert is a species-rich asexual genus with conidial appendages in the family Sporocadaceae Corda (Barr 1975, 1990; Kang et al. 1998, 1999), which was originally introduced to accommodate those Pestalotia-like species that have 5-celled conidia rather than 6-celled conidia (Steyaert 1949), and such a morphological distinction was subsequently supported by further evidence of the electronic microscopy (Guba 1961; Steyaert 1963; Griffiths and Swart 1974a,b; Sutton 1980). For Pestalotiopsis species, the traditional taxonomy of delineating interspecific relationships is mainly based on morphological characteristics, and most species are distinguished by conidial dimensions (Maharachchikumbura et al. 2011). Based on morphological and multi-locus phylogenetic analyses, Maharachchikumbura et al. (2014) proposed two segregated anamorphic genera from Pestalotiopsis, namely Neopestalotiopsis Maharachch., K.D. Hyde & Crous and Pseudopestalotiopsis Maharachch., K.D. Hyde & Crous to accommodate Pestalotiopsis species. Neopestalotiopsis is distinguished from Pestalotiopsis and Pseudopestalotiopsis by its multicolored median cells, and Pseudopestalotiopsis has three darker median cells compared to Pestalotiopsis.

To data, about 437 epithets for Pestalotiopsis have been listed in Index Fungorum (Index Fungorum 2024). Members of the genus are widely distributed in tropical and temperate regions as endophytes, plant pathogens or saprobes (Bate-Smith and Metcalfe 1957; Maharachchikumbura et al. 2012, 2014), but occasionally, some species of Pestalotiopsis have been reported as mycoparasites, human and insect pathogens (Lv et al. 2011; Monden et al. 2013; Xie et al. 2014; Li et al. 2017). The genus Pestalotiopsis has received considerable attention in recent years, and more research on its species diversity is still needed.

China is considered an important Asian reservoir of biodiversity by the Convention on Biological Diversity. Its rich vegetation and varied climatic regimes create a very wide range of habitats favoring the development of various microbial species. During ongoing mycological surveys of plant pathogens from terrestrial plants in Jiangxi and Yunnan provinces, 24 Pestalotiopsis strains isolated from diseased plant leaves are obtained. Based on morphological and multi-locus (ITS, tef1-α and tub2) phylogenetic analyses, eight Pestalotiopsis species were proposed as new to science in the present study.

Materials and methods

Sample collection, fungal isolation and morphological characterization

Samples of plant disease leaves were collected from different habitats in Yunnan and Jiangxi provinces, China, labeled and returned to the laboratory in Ziploc™ bags. The tissue isolation method was used for the isolation and identification of pathogenic fungi in this study (Gao et al. 2014). The fresh leaves were washed with running water to remove dirt and dust, then tissue pieces of junction from the diseased and healthy parts of plant leaves were cut into small pieces (5 × 5 mm). The tissue pieces were surface-sterilized with 75% ethanol for 1 min and 5% sodium hypochlorite (NaClO) for 45 s, then washed 3 times with sterile distilled water for 20 s each time, placed on sterilized filter paper to dry out the water, the tissue pieces were transferred to the potato dextrose agar (PDA, 200 g potato, 20 g glucose, 20 g agar, and 1000 mL water) plates and incubated at 25 °C in darkness until spores germinated, and the hyphal tip of individual colonies were transferred to fresh PDA plates to obtain a pure culture for further study. All fungal strains were stored in 10% sterilized glycerin at 4 °C for further studies. Cultural characteristics were observed and recorded after 7 days. Morphological characteristics were examined using an Olympus BX 53 compound microscope and photographed using the Olympus DP 27 digital camera (Olympus Optical Co., Tokyo, Japan) with a 60 × objective at the same background color and scale, and the conidia were randomly selected for measurement. The studied specimens and cultures were deposited in the Herbarium of Jiangxi Agricultural University, Plant Pathology, Nanchang, China (HJAUP). The names of the new taxa were registered in Index Fungorum (http://www.indexfungorum.org/Names/Names.asp).

DNA extraction, PCR amplification and sequencing

When the single colonies on PDA were grown for 7 days, approximately 500 mg of fresh fungal mycelia were scraped for the total genomic DNA extraction using the Solarbio Fungi Genomic DNA Extraction Kit (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) following the manufacturer’s protocol. To confirm the species, the regions (ITS, tef1-α and tub2) of all fungal isolates were sequenced. A portion of the internal transcribed spacer (ITS), translation elongation factor 1- alpha gene (tef1-α) and β-tubulin (tub2) loci were amplified using primers pairs ITS5/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone and Kohn 1999) and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. The corresponding primer pairs and PCR processes are listed in Table 1. The PCR mixture consisted of 10 µL Power Taq PCR Master Mix, 7.4 µL double-distilled water (ddH2O), 0.8 µL of each primer, and 1 µL template DNA were made up to the final volume of 20 µL. The PCR amplification products were checked via electrophoresis in 1% agarose gels and stained with ethidium bromide. Purification and sequencing of PCR products were carried out at Beijing Tsingke Biotechnology Co., Ltd., Beijing, China. The newly obtained sequences were deposited in NCBI GenBank (www.ncbi.nlm.nih.gov, accessed on 28 June Table 2).

Table 1.
Download as
CSV
XLSX

Primers and PCR program used in this study.

Locus Primers PCR Program
Name Sequence 5′–3′
ITS ITS5 GGAAGTAAAAGTCGTAACAAGG 94 °C: 3 min, (94 °C: 15 s, 54 °C: 15 s, 72 °C: 30 s) ×35 cycles, 72 °C: 5 min
ITS4 TCCTCCGCTTATTGATATGC
tef1-α EF1-728F CATCGAGAAGTTCGAGAAGG 94 °C: 3 min, (94 °C: 15 s, 59.5 °C: 15 s, 72 °C: 30 s) ×35 cycles, 72 °C: 5 min
EF1-986R TACTTGAAGGAACCCTTACC
tub2 Bt2a GGTAACCAAATCGGTGCTGCTTTC 94 °C: 3 min, (94 °C: 15 s, 55 °C: 15 s, 72 °C: 30 s) ×35 cycles, 72 °C: 5 min
Bt2b ACCCTCAGTGTAGTGACCCTTGGC

Phylogenetic analyses

The newly sequences generated in this study were analyzed with other related sequences obtained from GenBank (Table 2), based on recent publications (Hsu et al. 2024; Li et al. 2024; Wang et al. 2024; Zhao et al. 2024). Nonappendiculata quercina (CBS 116061) and N. quercina (CBS 270.82) were used as outgroup taxa. Multiple sequences were aligned using MAFFT version 7 (http://mafft.cbrc.jp/alignment/server/index.html) with default settings (Katoh and Standley 2013). To identify Pestalotiopsis taxa, single gene phylogenies were inferred for ITS, tef1-α and tub2, and the sequences of three loci (ITS, tef1-α and tub2) were concatenated using the “Concatenate Sequence” function in Phylosuite software v1.2.1 (Zhang et al. 2020) to conduct a multi-locus analysis including maximum-likelihood (ML) and Bayesian inference (BI) methods, and the best evolutionary model was selected for each alignment dataset using ModelFinder (Kalyaanamoorthy et al. 2017) and incorporated into the analyses. For the ML analysis, maximum-likelihood phylogenies were inferred using IQ-TREE (Nguyen et al. 2015) under best partitioned models, and tree stability was evaluated with 10,000 ultrafast bootstraps (Minh et al. 2013). The TIM3e+I+G4 model was selected as the most suitable for ITS data partitions, and the TIM2+F+I+G4 model was selected for tef1-α and tub2 data partition. For the BI analysis, Bayesian inference phylogenies were performed using MrBayes 3.2.6 (Ronquist et al. 2012), in which the best nucleotide substitution model for each locus was identified using ModelFinder of Phylosuite, and the best-fit model was GTR+F+I+G4 for ITS, tef1-α and tub2. Phylogenetic trees were visualized in FigTree v1.4.2 (http://tree.bio.ed.ac.uk/software/figtree, accessed on 12 September 2024), edited and typeset using Adobe Illustrator 2021. The names of the isolates from the present study are marked in red in the trees.

Table 2.
Download as
CSV
XLSX

Taxa used in the phylogenetic analyses and their GenBank accession numbers. New sequences are in bold.

Species Strain Number Host/Substrate Locality GenBank Accession Number
ITS tef1-α tub2
Pestalotiopsis abietis CFCC 53011 T Abies fargesii China MK397013 MK622277 MK622280
P. abietis CFCC 53012 Abies fargesii China MK397014 MK622278 MK622281
P. adusta ICMP 6088 T Refrigerator door Fiji JX399006 JX399070 JX399037
P. adusta MFLUCC 10–146 Syzygium sp. Thailand JX399007 JX399071 JX399038
P. aggestorum LC 6301 T Camellia sinensis China KX895015 KX895234 KX895348
P. aggestorum LC 8186 Camellia sinensis China KY464140 KY464150 KY464160
P. alloschemones CGMCC 3.23480 T Alloschemone occidentalis China OR247981 OR361456 OR381056
P. alloschemones LC15841 Alloschemone occidentalis China OR247982 OR361457 OR381057
P. alpinicola HJAUP C1644.221 T Alpinia zerumbet China PP962274 PP952249 PP952219
P. alpinicola HJAUP C1644.222 Alpinia zerumbet China PP962275 PP952248 PP952220
P. anacardiacearum IFRDCC 2397 T Mangifera indica China KC247154 KC247156 KC247155
P. anhuiensis CFCC 54791 T Cyclobalanopsis glauca China ON007028 ON005045 ON005056
P. aporosae-dioicae SAUCC224004 T Aporosa dioica China OR733506 OR912988 OR912985
P. aporosae-dioicae SAUCC224005 Aporosa dioica China OR733505 OR912989 OR912986
P. appendiculata CGMCC 3.23550 T Rhododendron decorum China OP082431 OP185509 OP185516
P. arceuthobii CBS 434.65 T Arceuthobium campylopodum USA KM199341 KM199516 KM199427
P. arengae CBS 331.92 T Arenga undulatifolia Singapore KM199340 KM199515 KM199426
P. australasiae CBS 114126 T Knightia sp. New Zealand KM199297 KM199499 KM199409
P. australasiae CBS 114141 Protea sp. New South Wales KM199298 KM199501 KM199410
P. australis CBS 111503 Protea neriifolia × susannae cv. ‘Pink Ice’ South Africa KM199331 KM199557 KM199382
P. australis CBS 114193 T Grevillea sp. New South Wales KM199332 KM199475 KM199383
P. biappendiculata CGMCC 3.23487 T Rhododendron sp. China OR247984 OR361459 OR381059
P. biappendiculata LC4282 Rhododendron sp. China OR247990 OR361465 OR381065
P. biappendiculata LC4283 Rhododendron sp. China OR247991 OR361466 OR381066
P. biciliata CBS 124463 T Platanus × hispanica Slovakia KM199308 KM199505 KM199399
P. biciliata CBS 236.38 Paeonia sp. Italy KM199309 KM199506 KM199401
P. brachiata LC 2988 T Camellia sp. China KX894933 KX895150 KX895265
P. brachiata LC 8188 Camellia sp. China KY464142 KY464152 KY464162
P. brachiata LC 8189 Camellia sp. China KY464143 KY464153 KY464163
P. brassicae CBS 170.26 T Brassica napus New Zealand KM199379 KM199558 –
P. camelliicola HJAUP C1804.221 T Camellia japonica China PP962357 PP952236 PP952229
P. camelliicola HJAUP C1804.222 Camellia japonica China PP962358 PP952235 PP952230
P. camelliae MFLUCC 12–0277 T Camellia japonica China JX399010 JX399074 JX399041
P. camelliae–oleiferae CSUFTCC 08 T Camelliae oleiferae China OK493593 OK507963 OK562368
P. camelliae–oleiferae CSUFTCC 09 Camelliae oleiferae China OK493594 OK507964 OK562369
P. cangshanensis CGMCC 3.23544 T Rhododendron delavayi China OP082426 OP185510 OP185517
P. castanopsidis CFCC 54430 T Castanopsis lamontii China OK339732 OK358493 OK358508
P. castanopsidis CFCC 54305 Castanopsis hystrix China OK339733 OK358494 OK358509
P. castanopsidis CFCC 54384 Castanopsis hystrix China OK339734 OK358495 OK358510
P. chamaeropis CBS 186.71 T Chamaerops humilis Italy KM199326 KM199473 KM199391
P. chamaeropis CFCC 55122 Quercus aliena China OM746229 OM840001 OM839902
P. chamaeropis CFCC 55023 Castanopsis fissa China OM746233 OM840005 OM839906
P. changjiangensis CFCC 54314 T Castanopsis tonkinensis China OK339739 OK358500 OK358515
P. changjiangensis CFCC 54433 Castanopsis hainanensis China OK339740 OK358501 OK358516
P. changjiangensis CFCC 52803 Cyclobalanopsis austrocochinchinensis China OK339741 OK358502 OK358517
P. chaoyangensis CFCC 55549 T Euonymus japonicus China OQ344763 OQ410582 OQ410584
P. chaoyangensis CFCC 58805 Euonymus japonicus China OQ344764 OQ410583 OQ410585
P. chiangmaiensis MFLUCC 22–0127 Phyllostachys edulis Thailand OP497990 OP753374 OP752137
P. chiaroscuro BRIP 72970 T Sporobolus natalensis Australia OK422510 OK423753 OK423752
P. chinensis MFLUCC 12–0273 T NA China JX398995 – –
P. clavata MFLUCC 12–0268 T Buxus sp. China JX398990 JX399056 JX399025
P. colombiensis CBS 118553 T Eucalyptus urograndis Colombia KM199307 KM199488 KM199421
P. cratoxyli CGMCC 3.23512 T Cratoxylum cochinchinense China OR248005 OR361480 OR381080
P. cratoxyli LC8772 Cratoxylum cochinchinense China OR248004 OR361479 OR381079
P. cyclobalanopsidis CFCC 54328 T Cyclobalanopsis glauca China OK339735 OK358496 OK358511
P. cyclobalanopsidis CFCC 55891 Cyclobalanopsis glauca China OK339736 OK358497 OK358512
P. cyclosora HJAUP C1724.221 T Cyclosorus interruptus China PP962279 PP952247 PP952221
P. cyclosora HJAUP C1724.222 Cyclosorus interruptus China PP962280 PP952246 PP952222
P. cyclosora HJAUP C1725.221 Microlepia marginata China PP962281 PP952245 PP952223
P. cyclosora HJAUP C1725.222 Microlepia marginata China PP962282 PP952244 PP952233
P. cyclosora HJAUP C1726.221 Punica granatum China PP962283 PP952243 PP952224
P. cyclosora HJAUP C1726.222 Punica granatum China PP962284 PP952242 PP952232
P. daliensis CGMCC 3.23548 T Rhododendron decorum China OP082429 OP185511 OP185518
P. dianellae CBS 143421 T Dianella sp. Australia MG386051 – MG386164
P. digitalis MFLU 14–0208 T Digitalis purpurea New Zealand KP781879 – KP781883
P. dilucida LC3232 T Camellia sinensis China KX894961 KX895178 KX895293
P. dilucida LC8184 Camellia sinensis China KY464138 KY464148 KY464158
P. diploclisiae CBS 115449 Psychotria tutcheri China KM199314 KM199485 KM199416
P. diploclisiae CBS 115587 T Diploclisia glaucescens China KM199320 KM199486 KM199419
P. disseminata CBS 143904 Persea americana New Zealand MH554152 MH554587 MH554825
P. disseminata MEAN 1165 Pinus pinea Portugal MT374687 MT374699 MT374712
P. diversiseta MFLUCC 12–0287 T Rhododendron sp. China JX399009 JX399073 JX399040
P. doitungensis MFLUCC 14–0115 Dendrobium sp. Thailand MK993574 MK975832 MK975837
P. dracaenae HGUP 4037 T Dracaena fragrans China – MT598644 MT598645
P. dracaenicola MFLUCC 18–0913 T Dracaena sp. Thailand MN962731 MN962732 MN962733
P. dracaenicola MFLUCC 18–0914 Dracaena sp. Thailand MN962734 MN962735 MN962736
P. dracontomelonis MFLU 14–0207 Dracontomelon dao Thailand KP781877 KP781880 –
P. eleuthero–cocci HMJAU 60189 Eleutherococcus brachypus China OL996126 – –
P. eleuthero–cocci HMJAU 60190 Eleutherococcus brachypus China OL996127 – OL898722
P. endophytica MFLUCC 18–0932 T Magnolia garrettii Thailand MW263946 MW417119 –
P. endophytica MFLUCC 18–0946 Magnolia garrettii Thailand MW263947 MW729384 –
P. ericacearum IFRDCC 2439 T Rhododendron delavayi China KC537807 KC537814 KC537821
P. eriobotryae HJAUP C1742.221 T Eriobotrya japonica China PP962289 PP952238 PP952227
P. eriobotryae HJAUP C1742.222 Eriobotrya japonica China PP962291 PP952237 PP952228
P. etonensis BRIP 66615 T Sporobolus jacquemontii Australia MK966339 MK977635 MK977634
P. exudata CGMCC 3.23488 T Aucuba japonica China OR247985 OR361460 OR381060
P. exudata LC15850 Aucuba japonica China OR247986 OR361461 OR381061
P. ficicrescens HGUP 861 T Camellia japonica China MZ477311 MZ868328 MZ868301
P. foliicola CFCC 54440 T Castanopsis faberi China ON007029 ON005046 ON005057
P. foliicola CFCC 57359 Castanopsis faberi China ON007030 ON005047 ON005058
P. foliicola CFCC 57360 Castanopsis faberi China ON007031 ON005048 ON005059
P. formosana NTUCC 17–009 T Poaceae sp. China MH809381 MH809389 MH809385
P. formosana NTUCC 17–010 Poaceae sp. China MH809382 MH809390 MH809386
P. furcata MFLUCC 12–0054 T Camellia sinensis Thailand JQ683724 JQ683740 JQ683708
P. furcata LC6691 Camellia sinensis China KX895030 KX895248 KX895363
P. fusiformis CGMCC 3.23495 T Rhododendron sp. China OR247995 OR361470 OR381070
P. fusiformis LC15852 Rhododendron sp. China OR247996 OR361471 OR381071
P. fusoidea CGMCC 3.23545 T Rhododendron delavayi China OP082427 OP185512 OP185519
P. ganzhouensis CGMCC 3.23489 T Cinnamomum camphora China OR247987 OR361462 OR381062
P. ganzhouensis LC5089 Cinnamomum camphora China OR247998 OR361473 OR381073
P. gardeniae HJAUP C1729.221 T Gardenia jasminoides China PP962285 PP952241 PP952225
P. gardeniae HJAUP C1729.222 Gardenia jasminoides China PP962286 PP952240 PP952226
P. gardeniae HJAUP C1729.223 Gardenia jasminoides China PP962287 PP952239 PP952231
P. gaultheriae IFRD 411–014 T Gaultheria forrestii China KC537805 KC537812 KC537819
P. gibbosa NOF 3175 T Gaultheria shallon Canada LC311589 LC311591 LC311590
P. grevilleae CBS 114127 T Grevillea sp. Australia KM199300 KM199504 KM199407
P. guangdongensis ZHKUCC 22–0016 T Arenga pinnata China ON180762 ON221520 ON221548
P. guangdongensis ZHKUCC 22–0017 Arenga pinnata China ON180763 ON221521 ON221549
P. guangdongensis ZHKUCC 22–0018 Arenga pinnata China ON180764 ON221522 ON221550
P. guangxiensis CFCC 54308 T Quercus griffithii China OK339737 OK358498 OK358513
P. guangxiensis CFCC 54300 Quercus griffithii China OK339738 OK358499 OK358514
P. guiyangensis CFCC 70626 Eriobotrya japonica China PP784740 PP842629 PP842617
P. guiyangensis CFCC 70630 Rohdea japonica China PP784741 PP842630 PP842618
P. guizhouensis CFCC 54803 Cyclobalanopsis glauca China ON007035 ON005052 ON005063
P. guizhouensis CFCC 57364 T Cyclobalanopsis glauca China ON007036 ON005053 ON005064
P. hawaiiensis CBS 114491 T Leucospermum sp. USA KM199339 KM199514 KM199428
P. hederae HJAUP C1638.221 T Hedera helix China PP962270 PP952252 PP952234
P. hederae HJAUP C1638.222 Hedera helix China PP962271 – PP952216
P. hispanica CBS 115391 T Protea sp. Spain MH553981 MH554399 MH554640
P. hollandica CBS 265.33 T Sciadopitys verticillata Netherlands KM199328 KM199481 KM199388
P. hollandica MEAN 1091 T Pinus pinea Portugal MT374678 MT374691 MT374703
P. humicola CBS 336.97 T Soil Papua New Guinea KM199317 KM199484 KM199420
P. hunanensis CSUFTCC15 T Camellia oleifera China OK493599 OK507969 OK562374
P. hunanensis CSUFTCC18 Camellia oleifera China OK493600 OK507970 OK562375
P. hydei MFLUCC 20–0135 T Litsea petiolata Thailand MW266063 MW251113 MW251112
P. iberica CAA 1004 T Pinus radiata Spain MW732248 MW759038 MW759035
P. iberica CAA 1006 Pinus radiata Spain MW732249 MW759039 MW759036
P. inflexa MFLUCC 12–0270 T Unidentified tree China JX399008 JX399072 JX399039
P. intermedia MFLUCC 12–0259 T Unidentified tree China JX398993 JX399059 JX399028
P. italiana MFLU 14–0214 T Cupressus glabra Italy KP781878 KP781881 KP781882
P. jesteri MFLUCC12–0279 Fagraea bodenii China JX399012 JX399076 JX399043
P. jiangsuensis CFCC 59538 Pinus massoniana China OR533577 OR539186 OR539191
P. jiangsuensis CFCC 59539 Pinus massoniana China OR533578 OR539187 OR539192
P. jiangsuensis CFCC 59542 Pinus massoniana China OR533581 OR539190 OR539195
P. jiangxiensis LC4399 T Camellia sp. China KX895009 KX895227 KX895341
P. jiangxiensis LC4242 Eurya sp. China KX895035 KX895213 KX895327
P. jinchanghensis LC6636 T Camellia sinensis China KX895028 KX895247 KX895361
P. jinchanghensis LC8190 Camellia sinensis China KY464144 KY464154 KY464164
P. kaki KNU–PT–1804 T Diospyros kaki Korea LC552953 LC553555 LC552954
P. kandelicola NCYUCC 19–0355 T Kandelia candel China MT560723 MT563102 MT563100
P. kenyana CBS 442.67 T Coffea sp. Kenya KM199302 KM199502 KM199395
P. kenyana LC6633 Camellia sinensis China KX895027 KX895246 KX895360
P. kenyana CFCC 54962 Quercus aliena China OM746237 OM840009 OM839910
P. kenyana CFCC 54805 Cyclobalanopsis glauca China OM746253 OM840025 OM839926
P. kenyana CFCC 55088 Castanopsis fissa China OM746254 OM840026 OM839927
P. knightiae CBS 111963 Knightia sp. New Zealand KM199311 KM199495 KM199406
P. knightiae CBS 114138 T Knightia sp. New Zealand KM199310 KM199497 KM199408
P. krabiensis MFLUCC 16–0260 T Pandanus sp. Thailand MH388360 MH388395 MH412722
P. leucadendri CBS 121417 T Leucadendron sp. South Africa MH553987 MH554412 MH554654
P. licualicola HGUP 4057 T Licuala grandis China KC492509 KC481684 KC481683
P. lijiangensis CFCC 50738 T Castanopsis carlesii var. spinulosa China KU860520 KU844185 KU844184
P. linearis MFLUCC 12–0271 T Trachelospermum sp. China JX398992 JX399058 JX399027
P. linguae ZHKUCC 22–0159 T Pyrrosia lingua China OP094104 OP186110 OP186108
P. linguae ZHKUCC 22–0160 Pyrrosia lingua China OP094103 OP186109 OP186107
P. lithocarpi CFCC 55100 T Lithocarpus chiungchungensis China OK339742 OK358503 OK358518
P. lithocarpi CFCC 55893 Lithocarpus chiungchungensis China OK339743 OK358504 OK358519
P. lobata CGMCC 3.23467 T Lithocarpus glaber China OR247976 OR361451 OR381051
P. lobata LC15843 Lithocarpus glaber China OR247977 OR361452 OR381052
P. loeiana MFLUCC 22–0123 T Dead leaves Thailand OP497988 OP737881 OP713769
P. longiappendiculata LC3013 Camellia sinensis China KX894939 KX895156 KX895271
P. lushanensis LC4344 T Camellia sp. China KX895005 KX895223 KX895337
P. lushanensis LC8182 Camellia sp. China KY464136 KY464146 KY464156
P. lushanensis LC8183 Camellia sp. China KY464137 KY464147 KY464157
P. lushanensis CFCC 54894 Quercus serrata China OM746282 OM840054 OM839955
P. macadamiae BRIP 63738b T Macadamia integrifolia Australia KX186588 KX186621 KX186680
P. macadamiae BRIP 63739b Macadamia integrifolia Australia KX186587 KX186620 KX186679
P. macadamiae BRIP 637441a Macadamia integrifolia Australia KX186586 KX186619 KX186678
P. machili CGMCC 3.23511 T Machilus sp. China OR248003 OR361478 OR381078
P . machiliana HJAUP C1790.221 T Machilus pauhoi China PP962355 PP952253 PP952214
P . machiliana HJAUP C1790.222 Machilus pauhoi China PP962356 PP952254 PP952215
P . machiliana HJAUP C1704.221 Rhododendron simsii China PP962276 PP952255 PP952211
P . machiliana HJAUP C1704.222 Rhododendron simsii China PP962277 PP952256 PP952212
P . machiliana HJAUP C1704.223 Rhododendron simsii China PP962278 PP952257 PP952213
P. malayana CBS 102220 Macaranga triloba Malaysia KM199306 KM199482 KM199411
P . mangifericola HJAUP C1639.221 T Mangifera indica China PP962272 PP952251 PP952217
P . mangifericola HJAUP C1639.222 Mangifera indica China PP962273 PP952250 PP952218
P. manyueyuanani NTUPPMCC 18-165 T Ophiocordyceps sp. China OR125060 OR126313 OR126306
P. manyueyuanani NTUPPMCC 22-012 Ophiocordyceps sp. China OR125061 OR126314 OR126307
P. menhaiensis YN3A1 T Camellia sinensis China KU252272 KU252401 KU252488
P. monochaeta CBS 144.97 T Quercus robur Netherlands KM199327 KM199479 KM199386
P. monochaeta CBS 440.83 Taxus baccata Netherlands KM199329 KM199480 KM199387
P. multiappendiculata CGMCC 3.23514 T NA China OR248008 OR361483 OR381083
P. multicolor CFCC59981 T Taxus chinensis China OQ626676 OQ714341 OQ714336
P. multicolor CFCC59982 Taxus chinensis China OQ771896 OQ779483 OQ779488
P. nanjingensis CSUFTCC20 Camellia oleifera China OK493603 OK507973 OK562378
P. nanjingensis CSUFTCC04 Camellia oleifera China OK493604 OK507974 OK562379
P. nanningensis CSUFTCC10 T Camellia oleifera China OK493596 OK507966 OK562371
P. nanningensis CSUFTCC11 Camellia oleifera China OK493597 OK507967 OK562372
P. nannuoensis SAUCC232203 T Unknown host China OR733504 OR912991 OR863909
P. nannuoensis SAUCC232204 Unknown host China OR733503 OR912992 OR863910
P. neglecta TAP1100 T Quercus myrsinaefolia Japan AB482220 LC311600 LC311599
P. neolitseae NTUCC 17–011 T Neolitsea villosa Taiwan MH809383 MH809391 MH809387
P. neolitseae CFCC 54590 Lithocarpus amygdalifolius China OK339744 OK358505 OK358520
P. novae-hollandiae CBS 130973 T Banksia grandis Australia KM199337 KM199511 KM199425
P. oryzae CBS 111522 Telopea sp. USA KM199294 KM199493 KM199394
P. oryzae CBS 171.26 NA Italy KM199304 KM199494 KM199397
P. oryzae CBS 353.69 T Oryza sativa Denmark KM199299 KM199496 KM199398
P. pallidotheae MAFF 240993 T Pieris japonica Japan AB482220 LC311585 LC311584
P. pandanicola MFLUCC 16–0255 T Pandanus sp. Thailand MH388361 MH388396 MH412723
P. papuana CBS 331.96 T Coastal soil Papua New Guinea KM199321 KM199491 KM199413
P. papuana CBS 887.96 Cocos nucifera Papua New Guinea KM199318 KM199492 KM199415
P. parva CBS 265.37 Delonix regia NA KM199312 KM199508 KM199404
P. parva CBS 278.35 T Leucothoe fontanesiana NA KM199313 KM199509 KM199405
P. photinicola GZCC 16–0028 T Photinia serrulata China KY092404 KY047662 KY047663
P. phyllostachydis ZHKUCC 23–0873 T NA China OR343210 OR367675 OR367676
P. pini MEAN 1092 T Pinus pinea Portugal MT374680 MT374693 MT374705
P. pinicola KUMCC 19–0183 T Pinus armandii China MN412636 MN417509 MN417507
P. piraubensis COAD 2165 T Psidium guajava Brazil MH627381 MH643774 MH643773
P. portugalica CBS 393.48 T NA Portugal KM199335 KM199510 KM199422
P. pruni CGMCC 3.23507 T Prunus cerasoides China OR248001 OR361476 OR381076
P. pruni LC15860 Prunus cerasoides China OR248002 OR361477 OR381077
P. rhaphiolepis SAUCC367701 T Rhaphiolepis indica China OR733502 OR912994 OR863906
P. rhaphiolepis SAUCC367702 Rhaphiolepis indica China OR733501 OR912995 OR863907
P. rhizophorae MFLUCC 17–0416 T Rhizophora mucronata Thailand MK764283 MK764327 MK764349
P. rhizophorae MFLUCC 17–0417 Rhizophora mucronata Thailand MK764284 MK764328 MK764350
P. rhododendri IFRDCC 2399 T Rhododendron sinogrande China KC537804 KC537811 KC537818
P. rhodomyrtus CFCC 54733 Quercus aliena China OM746310 OM840082 OM839983
P. rhodomyrtus CFCC 55052 Cyclobalanopsis augustinii China OM746311 OM840083 OM839984
P. rosarioides CGMCC 3.23549 T Rhododendron decorum China OP082430 OP185513 OP185520
P. rosea MFLUCC 12–0258 T Pinus sp. China JX399005 JX399069 JX399036
P. rubrae CGMCC 3.23499 T Quercus rubra China OR247997 OR361472 OR381072
P. rubrae LC8233 Plagiogyria glauca China OR248000 OR361475 OR381075
P. sabal ZHKUCC 22–0027 Sabal mexicana China ON180765 ON221523 ON221551
P. sabal ZHKUCC 22–0029 Sabal mexicana China ON180767 ON221525 ON221553
P. scoparia CBS 176.25 T Chamaecyparis sp. China KM199330 KM199478 KM199393
P. sequoiae MFLUCC 13–0399 T Sequoia sempervirens Italy KX572339 – –
P. shaanxiensis CFCC 54958 T Quercus variabilis China ON007026 ON005043 ON005054
P. shaanxiensis CFCC 57356 Quercus variabilis China ON007027 ON005044 ON005055
P. shandogensis JZB340038 T Robinia pseudoacacia China MN625275 MN626740 MN626729
P. shorea MFLUCC 12–0314 T Shorea obtusa Thailand KJ503811 KJ503817 KJ503814
P. sichuanensis SC3A21 T Camellia sinensis China KX146689 KX146748 KX146807
P. silvicola CFCC 55296 T Cyclobalanopsis kerrii China ON007032 ON005049 ON005060
P. silvicola CFCC 54915 Cyclobalanopsis kerrii China ON007033 ON005050 ON005061
P. silvicola CFCC 57363 Cyclobalanopsis kerrii China ON007034 ON005051 ON005062
P. smilacicola MFLUCC 22–0124 Smilax china Thailand OP497989 OP737879 OP762674
P. smilacicola MFLUCC 22–0125 T Dioscorea sp. Thailand OP497991 OP753376 OP762673
P. sonneratiae CFCC 57392 Sonneratia apetala China ON114182 ON086810 ON086814
P. sonneratiae CFCC 57394 T Sonneratia apetala China ON114184 ON086812 ON086816
P. sonneratiae CFCC 57395 Sonneratia apetala China ON114185 ON086813 ON086817
P. spathulata CBS 356.86 T Gevuina avellana Chile KM199338 KM199513 KM199423
P. spathuliappendiculata CBS 144035 T Phoenix canariensis Australia MH554172 MH554607 MH554845
P. suae CGMCC 3.23546 T Rhododendron delavayi China OP082428 OP185514 OP185521
P. taxicola CFCC59976 T Taxus chinensis China OQ626673 OQ714338 OQ714333
P. taxicola CFCC59978 Taxus chinensis China OQ771893 OQ779480 OQ779485
P. telopeae CBS 114137 Protea sp. Australia KM199301 KM199559 KM199469
P. telopeae CBS 114161 T Telopea sp. Australia KM199296 KM199500 KM199403
P. telopeae CBS 113606 Telopea sp. Australia KM199295 KM199498 KM199402
P. terricola CBS 141.69 T Soil Pacific Islands MH554004 MH554438 MH554680
P. thailandica MFLUCC 17–1616 T Rhizophora apiculata Thailand MK764286 MK764330 MK764352
P. thailandica MFLUCC 17–1617 Rhizophora apiculata Thailand MK764285 MK764329 MK764351
P. trachycarpicola OP068 T Trachycarpus fortunei China JQ845947 JQ845946 JQ845945
P. trachycarpicola IFRDCC 2403 Podocarpus macrophyllus China KC537809 KC537816 KC537823
P. trachycarpicola LC4523 Camellia sinensis China KX895011 KX895230 KX895344
P. tumida CFCC 55158 T Rosa chinensis China OK560610 OL814524 OM158174
P. tumida CFCC 55159 Rosa chinensis China OK560613 OL814527 OM158177
P. tumida CGMCC 3.23502 NA China OR247999 OR361474 OR381074
P. unicolor MFLUCC 12–0276 T Rhododendron sp. China JX398999 – JX399030
P. unicolor MFLUCC 12–0275 Unidentified tree China JX398998 JX399063 JX399029
P. verruculosa MFLUCC 12–0274 T Rhododendron sp. China JX398996 JX399061 –
P. wulichongensis CGMCC 3.23469 T Poaceae China OR247978 OR361453 OR381053
P. wulichongensis LC15846 Poaceae China OR247979 OR361454 OR381054
P. yanglingensis LC 4553 T Camellia sinensis China KX895012 KX895231 KX895345
P. yanglingensis LC 3412 Camellia sinensis China KX894980 KX895197 KX895312
P. yunnanensis HMAS 96359 T Podocarpus macrophyllus China AY373375 – –
Nonappendiculata quercina CBS 116061 T Quercus suber Italy MH553982 MH554400 MH554641
N. quercina CBS 270.82 Quercus pubescens Italy MH554025 MH554459 MH554701

T = ex–type culture. BRIP = Queensland Plant Pathology Herbarium, Brisbane, Australia; CAA = Culture collection of Artur Alves, housed at Department of Biology, University of Aveiro, Aveiro, Portugal; CBS = culture collection of the Westerdijk Fungal Biodiversity Institute, Utrecht, The Netherlands; CFCC = China Forestry Culture Collection Center, China; CGMCC = China General Microbiological Culture Collection Center, Beijing, China; ICMP = International Collection of Microorganisms from Plants, Auckland, New Zealand; CSUFTCC = Central South University of Forestry and Technology Culture Collection, Hunan, China; GZCC = Guizhou Academy of Agricultural Sciences Culture Collection, Guizhou, China; HGUP = Plant Pathology Herbarium of Guizhou University, Guizhou, China; HMAS = Mycological Herbarium, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China. HMJAU = Herbarium of Mycology of Jilin Agricultural University, Jilin, China; SAUCC = Shandong Agricultural University Culture Collection, Taian, Shandong, China; ICMP = International Collection of Microorganisms from Plants, Auckland, New Zealand; IFRDCC = International Fungal Research and Development Culture Collection, Kunming, Yunnan China; KNU = Kyungpook National University, Daegu, South Korea; KUMCC = Kunming Institute of Botany Culture Collection, Yunnan, China; LC = working collection of Lei Cai, housed at the Institute of Microbiology, Chinese Academy of Sciences, Beijing, China; MAFF = Ministry of Agriculture, Forestry and Fisheries, Tsukuba, Ibaraki, Japan; MEAN = Instituto Nacional de Investigação Agrária e Veterinária I. P.; MFLU = Mae Fah Luang University Herbarium, Thailand; MFLUCC = Mae Fah Luang University Culture Collection, Chiang Rai, Thailand; NCYUCC = The National Chiayi University Culture Collection, Jiayi, Taiwan; NOF = The Fungus Culture Collection of the Northern Forestry Centre, Alberta, Canada; NTUCC = The Department of Plant Pathology and Microbiology, National Taiwan University Culture Collection, Taipei, Taiwan China; TAP = Tamagawa University, Tokyo, Japan; ZHKUCC = the culture collection of Zhongkai University of Agriculture and Engineering, Guangzhou City, Guangdong, China; ITS = internal transcribed spacer; tub2 = β–tubulin; tef1-α = translation elongation factor1–α.

Results

Molecular phylogeny

To identify the isolated Pestalotiopsis strains, the ITS sequence data were used for initial identification in the present study. By the BLASTn analysis of ITS sequence, 24 strains were categorised into the genus Pestalotiopsis. Subsequently, based on maximum-likelihood (ML) and Bayesian inference (BI), the combined analysis of ITS, tef1-α and tub2 gene data was used to construct phylogenetic trees for further determination of the phylogenetic position of these strains. The phylogenetic results represented by the best-scoring ML consensus tree (lnL = –14416.332) are shown in Fig. 1. The 24 isolates obtained from different plants in our study nested within the known Pestalotiopsis species with reliable support values. In the multi-loci phylogenies of ITS, tef1-α and tub2, a total of 266 strains representing 147 accepted species were comprised in the final alignment matrix of Pestalotiopsis. Nonappendiculata quercina (CBS 116061) and N. quercina (CBS 270.82) served as outgroups. The combined data set (ITS: 1–510, tef1-α: 511–891 and tub2: 892–1284) was composed of 684 distinct patterns, 468 parsimony informative sites, 103 singleton sites, and 713 constant sites. A total of three single-locus data sets, ITS, tef1-α and tub2, contained 107, 181 and 180 parsimony informative sites, respectively. Combining morphological characteristics and molecular phylogenetic analyses, the 24 strains in this study were introduced as eight new species, namely Pestalotiopsis alpinicola, P. camelliicola, P. cyclosora, P. eriobotryae, P. gardeniae, P. hederae, P. machiliana and P. mangifericola.

Figure 1. 

Phylogenetic relationship of Pestalotiopsis based on concatenated sequences of ITS, tef1-α and tub2 sequence data. The ML and BI bootstrap support values above 80% and 0.80 are given above the nodes. Bar = 0.03 substitution per nucleotide position. The tree is rooted to Nonappendiculata quercina (CBS 116061) and N. quercina (CBS 270.82). The strains from the present study are marked in red. Some branches are shortened according to the indicated multipliers to fit the page size, and these are indicated by the symbol (//).

Taxonomy

Pestalotiopsis alpinicola X.X. Luo & Jian Ma, sp. nov.

Index Fungorum: IF902319
Fig. 2

Type

China • Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Mengla County, Menglun Town, Tropical Botanical Garden, on diseased leaves of Alpinia zerumbet, 23 June 2022, X.X. Luo (holotype HJAUP M1644.221; ex-type living culture HJAUP C1644.221).

Figure 2. 

Pestalotiopsis alpinicola (HJAUP C1644.221, ex-type) a, b leaf of host plant (front and reverse) c, d culture on PDA (front and reverse) e–g conidiogenous cells and conidia h–k conidiomata l–q conidia. Scale bars: 200 µm (j, k); 10 µm (e–g, l–q).

Etymology

Referring to the host genus, Alpinia from which it was collected.

Description

Leaf tip blight and irregular pallid leaf spots. Asexual morph on PDA: Conidiomata acervular, globose, 710–1110 μm diam., solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 18.1–21.8 × 4.7–5.9 μm (x̄ = 19.7 × 5.5 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 2.6–4.4 μm (x̄ = 3.6 μm) long, hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 3.6–6.2 μm (x̄ = 5.1 μm) long; three median cells doliiform to cylindrical, smooth, 10–13 μm (x̄ = 12 μm) long, concolorous or sometimes darker at the two upper cells, somewhat constricted at the septa, second cell from the base pale brown to brown, 3.5–4.5 µm (x̄ = 4.1 μm) long, third cell brown, 3.3–4.2 µm (x̄ = 3.8 μm) long, fourth cell pale brown to brown, 3.6–4.5 µm (x̄ = 4.1 μm) long; apical cell conical to acute, hyaline, smooth, thin-walled, 3.1–4.5 µm (x̄ = 3.6 μm) long, with 1–3 (mostly 2) filiform appendages, arising from the apical crest, unbranched, 13.1–20.9 µm long. Sexual morph not observed.

Culture characteristics

Colonies on PDA grow fast, flat and spreading, growing all over the Petri dish after 2 weeks at 25 °C in darkness, white, with flocculent aerial mycelium and entire edge, forming black conidiomata, and reverse pale straw.

Additional specimen examined

China • Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Mengla County, Menglun Town, Tropical Botanical Garden, 23 June 2022, X.X. Luo. On diseased leaves of Alpinia zerumbet; paratype HJAUP M1644.222, living culture HJAUP C1644.222.

Note

Two strains (HJAUP C1644.221 and HJAUP C1644.222) of Pestalotiopsis alpinicola isolated from leaf spots of Alpinia zerumbet clustered with P. lithocarpi (CFCC 55100 and CFCC 55893) with 95% ML/0.68 BI bootstrap support (Fig. 1). The ex-type strain HJAUP C1644.221 is closely related to P. lithocarpi (CFCC 55100) and comparisons of their nucleotides showed 20 bp differences (2%, including zero gap) nucleotide differences in three loci. Moreover, P. alpinicola is morphologically distinguished from P. lithocarpi Ning Jiang by its smaller conidia (4.7–5.9 μm vs. 6–7 μm) with shorter three median cells (10–13 μm vs. 12.5–14 μm) and fewer apical appendages (1–2 vs. 3–4) (Jiang et al. 2022).

Pestalotiopsis camelliicola X.X. Luo & Jian Ma, sp. nov.

Index Fungorum: IF902320
Fig. 3

Type

China • Jiangxi Province, Jingdezhen City, Changjiang District, Jingdezhen Botanical Garden, on diseased leaves of Camellia japonica, 3 November 2022, X.X. Luo (holotype HJAUP M1804.221; ex-type living culture HJAUP C1804.221).

Figure 3. 

Pestalotiopsis camelliicola (HJAUP C1804.221, ex-type) a, b leaf of host plant (front and reverse) c, d culture on PDA (front and reverse) e–g conidiomata h, i conidiogenous cells and conidia j–o conidia. Scale bars: 200 µm (f, g); 10 µm (h–o).

Etymology

Referring to the host genus from which it was collected, Camellia japonica.

Description

Regular leaf spots, grey white in the center, and brown to dark brown at the margin. Asexual morph on PDA: Conidiomata acervular, 470–1320 μm diam., superficial, solitary or aggregated in clusters, dark brown. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 14.9–22.2 × 5.4–7.6 μm (x̄ = 18.1 × 6.3 μm, n = 50), 4-septate, mostly with one minute guttules in each cell, slightly constricted at the septa; basal cell conical, 1.8–4 μm (x̄ = 2.8 μm), pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 1.7–5.2 μm (x̄ = 2.9 μm) long; three median cells doliiform to cylindrical, smooth, 11–14.4 μm (x̄ = 12.4 μm), concolorous, pale brown to brown, somewhat constricted at the septa, second cell from the base 3.8–5.3 µm (x̄ = 4.3 μm) long, third cell 3.6–4.7 µm (x̄ = 4.2 μm) long, fourth cell 3.2–5 µm (x̄ = 4 μm) long); apical cell conical to acute, hyaline, smooth, thin-walled, 2.2–3.8 µm (x̄ = 2.9 μm) long, with 2–4 (mostly 3) filiform appendages, arising from the apical crest, branched, 9.5–20.3 µm (x̄ = 12.4 μm) long. Sexual morph: not observed.

Culture characteristics

Colonies on PDA grow fast, filamentous, reaching 56–62 mm diam. after 5 days at 25 °C in darkness, white, with flocculent mycelium and entire edge, forming black, brown conidiomata, and reverse pale orange.

Additional specimen examined

China • Jiangxi Province, Jingdezhen City, Changjiang District, Jingdezhen Botanical Garden, 3 November 2022, X.X. Luo. On diseased leaves of Camellia japonica, paratype HJAUP M1804.222, living culture HJAUP C1804.222.

Note

Two strains (HJAUP C1804.221 and HJAUP C1804.222) of Pestalotiopsis camelliicola isolated from leaf spots of Camellia japonica formed a distinct clade sister to P. portugalica (CBS 393.48) with 100% ML/1.00 BI bootstrap support (Fig. 1). The ex-type strain HJAUP C1804.221 is closely related to P. portugalica (CBS 393.48) and comparisons of their nucleotides showed 20 bp differences (2%, including four gaps) nucleotide differences in three loci. Moreover, P. camelliicola is morphologically distinguished from P. portugalica Maharachch., K.D. Hyde & Crous in its solitary or scattered conidiomata and conidia with more apical filiform appendages (2–4 vs. 1–3). In addition, the conidia of P. camelliicola usually have one minute guttule at each cell, which are not observed in P. portugalica (Maharachchikumbura et al. 2014).

Pestalotiopsis cyclosora X.X. Luo & Jian Ma, sp. nov.

Index Fungorum: IF902321
Fig. 4

Type

China • Jiangxi Province, Xinyu City, Yushui District, Baoshi Park, on diseased leaves of Cyclosorus interruptus, 2 November 2022, X.X. Luo (holotype HJAUP M1724.221; ex-type living culture HJAUP C1724.221).

Figure 4. 

Pestalotiopsis cyclosora (HJAUP C1724.221) a, b leaf of host plant (front and reverse) c, d culture on PDA (front and reverse) e, f conidiogenous cells and conidia g–j conidiomata k–p conidia. Scale bars: 200 µm (i, j); 10 µm (e, f, k–p).

Etymology

Referring to the host genus, Cyclosorus from which it was collected.

Description

Regular leaf spots, yellowish to grey white in the center, and dark brown at the margin. Asexual morph on PDA: Conidiomata acervular, globose, 460–780 μm diam., solitary, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 16.3−26.1 × 5.4–7.1 μm (x̄ = 21.3 × 6.4 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 2.7–4.7 μm (x̄ = 3.5 μm), hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 4.1–10.6 μm (x̄ = 7.7 μm) long; three median cells doliiform to cylindrical, smooth, 11–17.1 μm (x̄ = 14.1 μm), concolorous or sometimes darker at the two upper cells, somewhat constricted at the septa, second cell from the base brown, 3.9–6.2 µm (x̄ = 4.8 μm) long, third cell brown to dark brown, 3.9−5.6 µm (x̄ = 4.7 μm) long, fourth cell brown, 3.8–5.7 µm (x̄ = 4.8 μm) long); apical cell conical to acute, hyaline, smooth, thin-walled, 2.6–4.2 µm (x̄ = 3.6 μm) long, with 1–4 (mostly 2 or 3) filiform appendages, arising from the apical crest, sometimes branched, 12.5–29.8 µm (x̄ = 20.1 μm) long. Sexual morph not observed.

Culture characteristics

Colonies on PDA grow fast, filamentous to circular, reaching 62–69 cm diam. after 5 days at 25 °C in darkness, regular edge, white, with filamentous aerial mycelium and entire edge, and reverse pale orange.

Additional specimen examined

China • Jiangxi Province, Xinyu City, Yushui District, Baoshi Park, 2 November 2022, X.X. Luo. On diseased leaves of Cyclosorus interruptus, paratype HJAUP M1724.222, living culture HJAUP C1724.222; on diseased leaves of Microlepia marginata, paratype HJAUP M1725.221, living culture HJAUP C1725.221; on diseased leaves of Microlepia marginata, paratype HJAUP M1725.222, living culture HJAUP C1725.222 • Yingtan City, Guixi County, Shangqing Town, Longhu Mountain National Forest Park, 3 November 2022, X.X. Luo. On diseased leaves of Punica granatum, paratype HJAUP M1726.221, living culture HJAUP C1726.221; on diseased leaves of Punica granatum, paratype HJAUP M1726.222, living culture HJAUP C1726.222.

Notes

Six strains (HJAUP C1724.221, HJAUP C1724.222, HJAUP C1725.221, HJAUP C1725.222, HJAUP C1726.221 and HJAUP C1726.222) of Pestalotiopsis cyclosora isolated from leaf spots of Cyclosorus interruptus, Microlepia marginata and Punica granatum clustered as a sister taxon to the clade containing P. ficicrescens (HGUP 861) and P. biciliata (CBS 124463 and CBS 236.38) with 90% ML/0.97 BI bootstrap support (Fig. 1). The ex-type strain HJAUP C1724.221 is closely related to P. ficicrescens (HGUP 861) and P. biciliata (CBS 124463), and comparisons of their nucleotides showed 18 bp differences (2%, including three gaps) and 12 bp differences (1%, including two gaps) nucleotide differences in three loci, respectively. Moreover, P. cyclosora is morphologically distinguished from P. ficicrescens Qi Yang & Yong Wang bis in its conidia with darker median cells and longer filiform appendages at both ends (apical appendages: 12.5–29.8 µm vs. 10.5–18 µm, basal appendage: 4.1–10.6 μm vs. 3.5–7 µm), and more apical appendages (1–4 vs. 2–3) in apical cell (Hyde et al. 2023). Pestalotiopsis cyclosora is also different from P. biciliata Maharachch., K.D. Hyde & Crous, which has verruculose conidia with concolourous, olivaceous median cells and longer basal cell (4–7 μm vs. 2.7–4.7 μm) bearing two appendages (Maharachchikumbura et al. 2014).

Pestalotiopsis eriobotryae X.X. Luo & Jian Ma, sp. nov.

Index Fungorum: IF902322
Fig. 5

Type

China • Jiangxi Province, Yingtan City, Guixi County, Shangqing Town, Longhu Mountain National Forest Park, on diseased leaves of Eriobotrya japonica, 3 November 2022, X.X. Luo (holotype HJAUP M1742.221; ex-type living culture HJAUP C1742.221).

Figure 5. 

Pestalotiopsis eriobotryae (HJAUP C1742.221, ex-type) a, b leaf of host plant (front and reverse) c–e conidiomata f, g culture on PDA (front and reverse) h–m conidia n–p immature conidia. Scale bars: 200 µm (d, e); 10 µm (h–p).

Etymology

Referring to the host genus, Eriobotrya from which it was collected.

Description

Regular leaf spots, grey white in the center with black-spotted acervuli, and dark brown at the margin with rusty halo. Asexual morph on PDA: Conidiomata acervular, globose, 839–2203 μm diam., solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 18.3–29.2 × 6.5–9 μm (x̄ = 23.7 × 7.7 μm, n = 50), 4-septate, slightly constricted at the septa, basal cell conical, 2.8–5.3 μm (x̄ = 4 μm), pale brown to subhyaline, smooth, thin-walled, with a single filiform appendage, unbranched, 4.1–11.5 μm (x̄ = 7.1 μm) long; three median cells doliiform to cylindrical, smooth, 12.1–18.6 μm (x̄ = 15.4 μm), concolorous or sometimes darker at the central cell or the two upper cells, somewhat constricted at the septa, second cell from the base pale brown, 3.4–6.9 µm (x̄ = 5 μm) long, third cell medium to dark brown, 3.7–6.2 µm (x̄ = 5.1 μm) long, fourth cell pale to medium brown, 4.4–6.5 µm (x̄ = 5.4 μm) long; apical cell conical, hyaline, smooth, thin-walled, 3.4–5.3 µm (x̄ = 4.2 μm) long, with 3–4 (mostly 3) filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 14.5–29.2 µm (x̄ = 18.9 μm) long. Sexual morph not observed.

Culture characteristics

Colonies on PDA grow fast, filamentous to circular, reaching 81–85 mm diam. after 5 days at 25 °C in darkness, white to buff, with flocculent mycelium and entire edge, forming black conidiomata, and reverse pale orange.

Additional specimen examined

China • Jiangxi Province, Yingtan City, Guixi County, Shangqing Town, Longhu Mountain National Forest Park, 3 November 2022, X.X. Luo. On diseased leaves of Eriobotrya japonica, paratype HJAUP M1742.222, living culture HJAUP C1742.222.

Note

Two strains (HJAUP C1742.221 and HJAUP C1742.222) of Pestalotiopsis eriobotryae isolated from leaf spots of Eriobotrya japonica formed a well-supported clade phylogenetically close to P. doitungensis (MFLUCC 14–0115) with 99% ML/0.95 BI bootstrap support (Fig. 1). The ex-type strain HJAUP C1742.221 is closely related to P. doitungensis (MFLUCC 14–0115) and comparisons of their nucleotides showed 17 bp differences (2%, including three gaps) nucleotide differences in three loci. Moreover, P. eriobotryae is morphologically distinguished from P. doitungensis X.Y. Ma, K.D. Hyde & J.C. Kang in its wider conidia (6.5–9.0 μm vs. 5.5–6.5 μm) with more and longer apical filiform appendages (3–4 vs. 2–3, 14.5–29.2 µm vs. 4–12 μm) (Ma et al. 2019).

Pestalotiopsis gardeniae X.X. Luo & Jian Ma, sp. nov.

Index Fungorum: IF902323
Fig. 6

Type

China • Jiangxi Province, Yingtan City, Guixi County, Shangqing Town, Longhu Mountain National Forest Park, on diseased leaves of Gardenia jasminoides, 23 June 2022, X.X. Luo (holotype HJAUP M1729.221; ex-type living culture HJAUP C1729.221).

Figure 6. 

Pestalotiopsis gardeniae (HJAUP C1729.221, ex-type) a, b leaf of host plant (front and reverse) c, d culture on PDA (front and reverse) e–g conidiomata h, i conidiogenous cells and conidia j–o conidia. Scale bars: 200 µm (f, g); 10 µm (h–o).

Description

Regular leaf spots, grey white in center, and pale brown at margin with yellowish halo. Asexual morph on PDA: Conidiomata acervular, globose or subglobular, 763–955 μm diam., solitary or aggregated, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 17.4–25.4 × 5.3–6.7 μm (x̄ = 21.9 × 6 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 3.4–6.4 μm (x̄ = 5.1 μm), pale brown to subhyaline, smooth, thin-walled, with a single filiform appendage, unbranched, 2.9–4.7 μm (x̄ = 3.9 μm) long; three median cells doliiform to cylindrical, 11–14.7 μm (x̄ = 13.2 μm), concolorous or sometimes darker at the central cell or the two upper cells, somewhat constricted at the septa, second cell from the base pale brown, 3.4–5.1 (x̄ = 4.3 μm) µm long, third cell medium to dark brown, 3.7–5.3 µm (x̄ = 4.4 μm) long, fourth cell pale to medium brown, 3.7–5.4 µm (x̄ = 4.5 μm) long; apical cell conical to acute, hyaline, smooth, thin-walled, 2.9–4.3 µm (x̄ = 3.6 μm) long, with 2–3 (mostly 3) filiform appendages, arising from the apical crest, unbranched, 10–20.6 µm (x̄ = 14.4 μm) long. Sexual morph not observed.

Culture characteristics

Colonies on PDA grow fast, filamentous to circular, reaching 70–75 mm diam. after 5 days at 25 °C in darkness, white, with flocculent aerial mycelium and entire edge, forming black conidiomata, and reverse pale orange.

Additional specimen examined

China • Jiangxi Province, Yingtan City, Guixi County, Shangqing Town, Longhu Mountain National Forest Park, 23 June 2022, X.X. Luo. On diseased leaves of Gardenia jasminoides, paratype HJAUP M1729.222, living culture HJAUP C1729.222; on diseased leaves of Gardenia jasminoides, paratype HJAUP M1729.223, living culture HJAUP C1729.223.

Note

Three strains (HJAUP C1729.221, HJAUP C1729.222 and HJAUP C1729.223) of Pestalotiopsis gardeniae isolated from leaf spots of Gardenia jasminoides formed a distinct clade sister to P. sichuanensis (SA3A21) with 100% ML/1.00 BI bootstrap support (Fig. 1). The ex-type strain HJAUP C1729.221 is closely related to P. sichuanensis (SA3A21) and comparisons of their nucleotides showed 3 bp differences (1%, including zero gap) nucleotide differences in three loci. Moreover, P. gardeniae is morphologically distinguished from P. sichuanensis Y.C. Wang, X.C. Wang & Y.J. Yang in its larger conidia (17.4–25.4 × 5.3–6.7 μm vs. 8.6–12.5 × 2.6–3.7 μm) with longer apical filiform appendages (10–20.6 μm vs. 2.6–9.2 μm) (Wang et al. 2019).

Pestalotiopsis hederae X.X. Luo & Jian Ma, sp. nov.

Index Fungorum: IF902324
Fig. 7

Type

China • Yunnan Province, Jinghong City, Menghan Town, Xishuangbanna Dai Nationality Garden; on diseased leaves of Hedera helix; 22 June 2022, X.X. Luo (holotype HJAUP M1638.221; ex-type living culture HJAUP C1638.221).

Figure 7. 

Pestalotiopsis hederae (HJAUP C1638.221, ex-type) a, b leaf of host plant (front and reverse) c, d culture on PDA (front and reverse) e–g conidiomata h conidiogenous cells and conidia i–k conidia. Scale bars: 200 µm (f, g); 10 µm (h–l).

Etymology

Referring to the host genus, Hedera from which it was collected.

Description

Regular leaf spots, grey-brown in the center and darkening to black brown at the margins. Asexual morph on PDA: Conidiomata acervular, globose, 660–1570 μm diam., solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 15.8–22.4 × 4.9–6.3 μm (x̄ = 18.0 × 5.7 μm, n = 50), 4-septate, slightly constricted at the septa, basal cell conical, 3.1–5.3 μm (x̄ = 4 μm), hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 3.4–5.9 μm (x̄ = 4.8 μm) long; three median cells doliiform to cylindrical, smooth, thick-walled, 11.1–15.5 μm (x̄ = 13.6 μm), pale brown to brown, concolorous, somewhat constricted at the septa, second cell from the base 3.7–5.3 μm (x̄ = 4.7 μm) long, third cell 4.3–5.6 μm (x̄ = 4.9 μm) long, fourth cell 4.2–5.6 μm (x̄ = 5 μm) long; apical cell conical to acute, hyaline, smooth, thin-walled, 3.3–5 µm (x̄ = 4.1 μm) long, with 2(–3) filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 10.8–19.6 µm (x̄ = 15.5 μm) long. Sexual morph not observed.

Culture characteristics

Colonies on PDA grow fast, filamentous to circular, growing all over the Petri dish at 25 °C in darkness, regular edge, white, sparse aerial mycelium on the surface, forming black conidiomata with black conidial masses, and reverse pale orange or white at the margin, dark brown at the center.

Additional specimen examined

China • Yunnan Province, Jinghong City, Menghan Town, Xishuangbanna Dai Nationality Garden, 22 June 2022, X.X. Luo. On diseased leaves of Hedera helix, paratype HJAUP M1638.222, living culture HJAUP C1638.222.

Note

Two strains (HJAUP C1638.221 and HJAUP C1638.222) of Pestalotiopsis hederae isolated from leaf spots of Hedera helix formed a distinct clade sister to P. hydei (MFLUCC 20–0135) with 94% ML/0.95 BI bootstrap support (Fig. 1). The ex-type strain HJAUP C1638.221 is closely related to P. hydei (MFLUCC 20–0135) and comparisons of their nucleotides showed 10 bp differences (1%, including two gaps) nucleotide differences in three loci, respectively. Moreover, P. hederae is morphologically distinguished from P. hydei Huanraluek & Jayaward., which has longer conidia (18–35 μm vs. 15.8–22.4 μm) with minutely verruculose three median cells and shorter apical appendages (3–12 µm vs. 10.8–19.6 µm) (Huanaluek et al. 2021).

Pestalotiopsis machiliana X.X. Luo and Jian Ma, sp. nov.

Index Fungorum: IF902325
Fig. 8

Type

China • Jiangxi Province, Jingdezhen City, Changjiang District, Jingdezhen Botanical Garden; on diseased leaves of Machilus pauhoi; 3 November 2022; X.X. Luo (holotype HJAUP M1790.221; ex-type living culture HJAUP C1790.221).

Figure 8. 

Pestalotiopsis machiliana (HJAUP C1790.221, ex-type) a, b leaf of host plant (front and reverse) c, d culture on PDA (front and reverse) e–g conidiomata h, i conidiogenous cells and conidia j–q conidia. Scale bars: 200 µm (f, g); 10 µm (h–q).

Etymology

Referring to the host genus, Machilus from which it was collected.

Description

Regular leaf spots, wheat in the center, a black stripe ring in the middle and dark brown at the margin. Asexual morph on PDA: Conidiomata acervular, globose, 646–1584 μm diam., solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 18.6–27.2 × 5.6–7.4 μm (x̄ = 22.5 × 6.5 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 3–5.2 μm (x̄ = 3.9 μm), hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 4.5–10.2 μm (x̄ = 8.1 μm) long; three median cells doliiform to cylindrical, smooth, 12.5–17.3 μm (x̄ = 14.7 μm), concolorous, brown, somewhat constricted at the septa, second cell from the base 3.6–6.7 µm (x̄ = 5.0 μm) long, third cell 3.8−5.5 µm (x̄ = 4.6 μm) long, fourth cell 4.1–6.4 µm (x̄ = 4.9 μm) long; apical cell conical to acute, hyaline, smooth, thin-walled, 3–4.8 µm (x̄ = 3.9 μm) long, with 2–3 filiform appendages, arising from the apex of the apical cell each at a different point, unbranched, 12.9–22.5 µm (x̄ = 14.7 μm) long. Sexual morph not observed.

Culture characteristics

Colonies on PDA grow fast, reaching 47–53 mm diam. after 5 days at 25 °C in darkness, white, with flocculent mycelium and entire edge, forming black conidiomata, and reverse buff.

Additional specimens examined

China, Jiangxi Province, Jingdezhen City • Changjiang District, Jingdezhen Botanical Garden, 3 November 2022, X.X. Luo. On diseased leaves of Machilus pauhoi, paratype HJAUP M1790.222, living culture HJAUP C1790.222 • Fuliang County, Jingdezhen National Forest Park, 2 November 2022, X.X. Luo, on diseased leaves of Rhododendron simsii, paratype HJAUP M1704.221, living culture HJAUP C1704.221; on diseased leaves of Rhododendron simsii, paratype HJAUP M1704.222, living culture HJAUP C1704.222; on diseased leaves of Rhododendron simsii, paratype HJAUP M1704.223, living culture HJAUP C1704.223.

Note

Five strains (HJAUP C1790.221, HJAUP C1790.222, HJAUP C1704.221, HJAUP C1704.222 and HJAUP C1704.223) of Pestalotiopsis machiliana isolated from leaf spots of Machilus pauhoi clustered as a sister taxon to P. chamaeropis (CFCC 54977, CFCC 55023, CFCC 55019 and CFCC 55122) with 99% ML/0.97 BI bootstrap support (Fig. 1). The ex-type strain HJAUP C1790.221 is closely related to P. chamaeropis (CBS 186.71) and comparisons of their nucleotides showed 8 bp differences (1%, including one gap) nucleotide differences in three loci. Moreover, P. machiliana is morphologically distinguished from P. chamaeropis Maharachch., K.D. Hyde & Crous, which has minutely verruculose, wider conidia (7–9 μm vs. 5.6–7.4 μm) with longer basal cell (5–6.5 μm vs. 3–5.2 μm) and apical cell (4–6 µm vs. 3–4.8 µm) (Maharachchikumbura et al. 2014).

Pestalotiopsis mangifericola X.X. Luo & Jian Ma, sp. nov.

Index Fungorum: IF902326
Fig. 9

Type

China • Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Mengla County, Menglun Town, Tropical Botanical Garden, on diseased leaves of Mangifera indica, 23 June 2022, X.X. Luo (holotype HJAUP M1639.221; ex-type living culture HJAUP C1639.221).

Figure 9. 

Pestalotiopsis mangifericola (HJAUP C1639.221, ex-type) a, b leaf of host plant (front and reverse) c, d culture on PDA (front and reverse) e–g conidiomata h conidiogenous cells and conidia i–l conidia. Scale bars: 200 µm (f, g); 10 µm (h–l).

Etymology

Referring to the host genus, Mangifera from which it was collected.

Description

Regular leaf spots, initially brown with a yellowish halo around the edges, later yellowish-white center with black edges. Asexual morph on PDA: Conidiomata acervular, subglobular, 426–786 μm diam, solitary or aggregated in clusters, black. Conidiophores indistinct and reduced to conidiogenous cells. Conidiogenous cells hyaline, smooth, cylindrical to ampulliform. Conidia fusiform, straight or slightly curved, 13.5–18 × 4.7–6 μm (x̄ = 15.2 × 5.4 μm, n = 50), 4-septate, slightly constricted at the septa; basal cell conical, 2.9–4.4 μm (x̄ = 3.6 μm), hyaline or sometimes pale brown, smooth, thin-walled, with a single filiform appendage, unbranched, 3.1–5.5 μm (x̄ = 4.2μm) long; three median cells doliiform to cylindrical, smooth, 10.8–12.3 μm (x̄ = 11.5 μm), concolorous or sometimes darker at the central cell or the two upper cells, somewhat constricted at the septa, second cell from the base pale brown, 3.3–4.6 µm (x̄ = 3.9 μm) long, third cell pale brown to brown, 3.6–4.5 µm (x̄ = 3.9 μm) long, fourth cell pale to medium brown, 3.5–5.1 µm (x̄ = 4.2 μm) long; apical cell conical to acute, hyaline, smooth, thin-walled, 2.5–4 µm (x̄ = 3.1 μm) long, with 2–3 filiform appendages, arising from the apical crest, unbranched, 7.2–11.6 µm (x̄ = 9.8 μm) long. Sexual morph not observed.

Culture characteristics

Colonies on PDA grow fast, filamentous to circular, growing all over the Petri dish (d = 8.5 cm) after 2 weeks at 25 °C in darkness, white, with flocculent aerial mycelium and entire edge, forming black conidiomata, and reverse pale orange.

Additional specimen examined

China • Yunnan Province, Xishuangbanna Dai Autonomous Prefecture, Mengla County, Menglun Town, Tropical Botanical Garden, 23 June 2022, X.X. Luo. On diseased leaves of Mangifera indica, paratype HJAUP M1639.222, living culture HJAUP C1639.222.

Note

Two strains (HJAUP C1639.221 and HJAUP C1639.222) of Pestalotiopsis mangifericola isolated from leaf spots of Mangifera indica formed a distinct clade sister to P. adusta (MFLUCC 10–146 and ICMP 6088) with 100% ML/0.90 BI bootstrap support (Fig. 1). The ex-type strain HJAUP C1639.221 is closely related to P. adusta (ICMP 6088) and comparisons of their nucleotides showed 4 bp differences (1%, including one gap) nucleotide differences in three loci. Moreover, P. mangifericola is morphologically distinguished from P. adusta (Ellis & Everh.) Steyaert in its smaller conidia (13.5–18 × 4.7–6 μm vs. 16–22 × 5–7 μm) with shorter three median cells (10.8–12.3 μm vs. 12–15 μm) (Steyaert 1953; Maharachchikumbura et al. 2012).

Discussion

The establishment of Pestalotiopsis was based on morphological studies. Members in the genus mainly occur in the asexual morph, and only 12 species have been linked with the sexual morphs (Maharachchikumbura et al. 2011). The generic concept of Pestalotiopsis is based on the characteristics of asexual morph and is mainly characterized by fusiform conidia and three pigmented median cells, each consisting of a hyaline basal cell and a hyaline apical cell with one or more simple or branched appendages (Steyaert 1949; Maharachchikumbura et al. 2014). These characters separate Pestalotiopsis from Pestalotia De Not. (with 6-celled conidia) and Truncatella Steyaert (with 4-celled conidia). Subsequently, Maharachchikumbura et al. (2014) revisited the genus Pestalotiopsis based on molecular evidence and the differences in the median cells of the conidia and proposed two segregated genera including Neopestalotiopsis and Pseudopestalotiopsis. Senanayake et al. (2015) treated Pestalotiopsis, Pseudopestalotiopsis, Neopestalotiopsis and other four genera in a new family, Pestalotiopsidaceae Maharachch. & K.D. Hyde, based on morphological similarities and sequence analysis.

To date, about 437 epithets for Pestalotiopsis have been listed in Index Fungorum (Index Fungorum 2024), but many species were introduced only based on morphological studies, and the excessive overlap of conidial features makes it difficult to identify Pestalotiopsis species only by morphology. Thus, there is presently a strong tendency to evaluate or clarify the taxonomic placements and phylogenetic relationships of Pestalotiopsis species by molecular methods. Maharachchikumbura et al. (2014) analyzed ten gene regions to resolve the bound species in Neopestalotiopsis and Pestalotiopsis, and finally screened three most applicable regions (ITS, tef1-α, and tub2). Since then, the number of Pestalotiopsis species is constantly being excavated and steadily increasing, and all described Pestalotiopsis species were identified based on the combined analyses of these three loci except for P. sequoia, P. bulbophylli and P. chiaroscuro using LSU, ITS, tef1-α and tub2 (Hyde et al. 2016; Wang et al. 2017; Crous et al. 2022). Our BLASTn analyses of these sequences showed a high similarity in some Pestalotiopsis species, such as ITS, tef1-α and tub2 of P. ficicrescens (MZ477311, MZ868328 and MZ868301) (Hyde et al. 2023) were 99.62, 99.79 and 98.56% similar to P. biciliata (KM199308, KM199505 and KM199399) (Maharachchikumbura et al. 2014); P. taxicola (OQ626673, OQ714338 and OQ714333) (Wang et al. 2024) were 100%, 99.25% and 100% similar to P. unicolor (JX398998, JX399063 and JX399029) (Maharachchikumbura et al. 2012); P. linguae (OP094104, OP186110 and OP186108) (Li et al. 2023) were 99.64, 98.74 and 98.26 similar to P. parva (KM199313, KM199509 and KM199405) (Maharachchikumbura et al. 2014), but the phylogenetic analyses conducted based on combined ITS, tef1-α and tub2 sequence data showed more powerful resolution in delineating Pestalotiopsis species and higher bootstrap support values for most clades. Based on previous studies, we also conducted phylogenetic analyses using ITS, tef1-α and tub2 sequences, and our newly obtained 24 strains nested within the genus Pestalotiopsis formed distinct clades with good support value, and can be recognized as eight new phylogenetic species.

Pestalotiopsis species are known worldwide as plant pathogens, endophytes, or saprophytes, and are widely distributed in tropical and temperate regions (Maharachchikumbura et al. 2014; Li et al. 2024; Zhao et al. 2024). In recent years, studies conducted on the alpha-taxonomy of Pestalotiopsis are mainly focused on the exploration of the hidden species diversity (Index Fungorum 2024). The leaves with typical spots diseased by Pestalotiopsis fungi are usually collected to obtain fungal isolates, and the strains are identified based on morphological and phylogenetic approaches, but little attention has been accorded to their pathogenicity. In our study, the survey of microfungi associated with plant diseased leaves from terrestrial habitat in Jiangxi and Yunnan provinces, China reveal eight new species, namely P. alpinicola, P. camelliicola, P. cyclosora, P. eriobotryae, P. gardeniae, P. hederae, P. machiliana and P. mangifericola. To our knowledge, P. alpinicola, P. cyclosora and P. machiliana are the first report that associated with the hosts Alpinia zerumbet, Cyclosorus interruptus, Machilus pauhoi and Microlepia marginata, which will broaden the host range of Pestalotiopsis species, and provide an important contribution to the field of plant pathology and fungal taxonomy. With the ongoing addition of Pestalotiopsis species, we believe that a comprehensive study of the genus will reveal more hidden Pestalotiopsis species from terrestrial plants.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was supported by the National Natural Science Foundation of China (Nos. 32160006, 31970018).

Author contributions

Sampling: X.X.L.; Fungal isolation: M.G.L.; Microscopy: X.X.L.; Description and phylogenetic analyses: X.X.L. and K.Z.; Writing – original draft preparation: X.X.L.; Writing – review and editing, R.F.C., Z.H.X. and J.M. All authors read and approved the final manuscript.

Author ORCIDs

Ming-Gen Liao https://orcid.org/0009-0001-9537-1773

Rafael F. Castañeda-Ruiz https://orcid.org/0000-0003-0063-3265

Jian Ma https://orcid.org/0000-0001-9783-1860

Zhao-Huan Xu https://orcid.org/0009-0008-2641-7783

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Barr ME (1990) Prodromus to nonlichenized, pyrenomycetous members of class Hymenoascomycetes. Mycotaxon 39: 43–184.
  • Bate-Smith EC, Metcalfe CR (1957) Leuco–anthocyanins. 3. The nature and systematic distribution of tannin in dicotyledonous plants. Journal of the Linnean Society of London, Botany 55(362): 669–705. https://doi.org/10.1111/j.1095-8339.1957.tb00030.x
  • Bhunjun CS, Niskanen T, Suwannarach N, Wannathes N, Chen YJ, McKenzie EHC, Maharachchikumbura SSN, Buyck B, Zhao CL, Fan YG, Zhang JY, Dissanayake AJ, Marasinghe DS, Jayawardena RS, Kumla J, Padamsee M, Chen YY, Liimatainen K, Ammirati JF, Phukhamsakda C, Liu JK, Phonrob W, Randrianjohany É, Hongsanan S, Cheewangkoon R, Bundhun D, Khuna S, Yu WJ, Deng LS, Lu YZ, Hyde KD, Lumyong S (2022) The numbers of fungi: Are the most speciose genera truly diverse? Fungal Diversity 114(1): 387–462. https://doi.org/10.1007/s13225-022-00501-4
  • Crous PW, Boers J, Holdom D, Osieck ER, Steinrucken TV, Tan YP, Vitelli JS, Shivas RG, Barrett M, Boxshall AG, Broadbridge J, Larsson E, Lebel T, Pinruan U, Sommai S, Alvarado P, Bonito G, Decock CA, De la Peña-Lastra S, Delgado G, Houbraken J, Maciá-Vicente JG, Raja HA, Rigueiro-Rodríguez A, Rodríguez A, Wingfield MJ, Adams SJ, Akulov A, Al-Hidmi T, Antonín V, Arauzo S, Arenas F, Armada F, Aylward J, Bellanger JM, Berraf-Tebbal A, Bidaud A, Boccardo F, Cabero J, Calledda F, Corriol G, Crane JL, Dearnaley JDW, Dima B, Dovana F, Eichmeier A, Esteve-Raventós F, Fine M, Ganzert L, García D, Torres-Garcia D, Gené J, Gutiérrez A, Iglesias P, Istel Ł, Jangsantear P, Jansen GM, Jeppson M, Karun NC, Karich A, Khamsuntorn P, Kokkonen K, Kolařík M, Kubátová A, Labuda R, Lagashetti AC, Lifshitz N, Linde C, Loizides M, Luangsa-Ard JJ, Lueangjaroenkit P, Mahadevakumar S, Mahamedi AE, Malloch DW, Marincowitz S, Mateos A, Moreau PA, Miller AN, Molia A, Morte A, Navarro-Ródenas A, Nebesářová J, Nigrone E, Nuthan BR, Oberlies NH, Pepori AL, Rämä T, Rapley D, Reschke K, Robicheau BM, Roets F, Roux J, Saavedra M, Sakolrak B, Santini A, Ševčíková H, Singh PN, Singh SK, Somrithipol S, Spetik M, Sridhar KR, Starink-Willemse M, Taylor VA, van Iperen AL, Vauras J, Walker AK, Wingfield BD, Yarden O, Cooke AW, Manners AG, Pegg KG, Groenewald JZ (2022) Fungal Planet description sheets: 1383–1435. Persoonia 48(1): 261–371. https://doi.org/10.3767/persoonia.2022.48.08
  • Glass NL, Donaldson GC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from Filamentous Ascomycetes. Applied and Environmental Microbiology 61(4): 1323–1330. https://doi.org/10.1128/aem.61.4.1323-1330.1995
  • Guba EF (1961) Monograph of Monochaetia and Pestalotia. Harvard University Press, Cambridge.
  • Hsu SY, Xu YC, Lin YC, Chuang WY, Lin SR, Stadler M, Tangthirasunun N, Cheewangkoon R, AL-Shwaiman HA, Elgorban AM, Ariyawansa HA (2024) Hidden diversity of Pestalotiopsis and Neopestalotiopsis (Amphisphaeriales, Sporocadaceae) species allied with the stromata of entomopathogenic fungi in Taiwan. MycoKeys 101: 275–312. https://doi.org/10.3897/mycokeys.101.113090
  • Huanaluek N, Jayawardena RS, Maharachchikumbura SS, Harishchandra DL (2021) Additions to pestalotioid fungi in Thailand: Neopestalotiopsis hydeana sp. nov. and Pestalotiopsis hydei sp. nov. Phytotaxa 479(1): 23–43. https://doi.org/10.11646/phytotaxa.479.1.2
  • Hyde KD, Hongsanan S, Jeewon R, Bhat DJ, McKenzie EH, Jones EB, Phookamsak R, Ariyawansa HA, Boonmee S, Zhao Q, Abdel-Aziz FA, Abdel-Wahab MA, Banmai S, Chomnunti P, Cui B, Daranagama DA, Das K, Dayarathne MC, de Silva N, Dissanayake AJ, Doilom M, Ekanayaka AH, Gibertoni TB, Góes-Neto A, Huang S, Jayasiri SC, Jayawardena RS, Konta S, Lee HB, Li W, Lin C, Liu J, Lu Y, Luo Z, Manawasinghe IS, Manimohan P, Mapook A, Niskanen T, Norphanphoun C, Papizadeh M, Perera RH, Phukhamsakda C, Richter C et al. (2016) Fungal diversity notes 367–490: Taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 80: 1–270. https://doi.org/10.1007/s13225-016-0373-x
  • Hyde KD, Suwannarach N, Jayawardena RS, Manawasinghe IS, Liao CF, Doilom M, Cai L, Zhao P, Buyck B, Phukhamsakda C, Su WX, Fu YP, Li Y, Zhao RL, He MQ, Li JX, Tibpromma S, Lu L, Tang X, Kang JC, Ren GC, Gui H, Hofstetter V, Ryoo R, Antonín V, Hurdeal VG, Gentikaki E, Zhang JY, Lu YZ, Senanayake IC, Yu FM, Zhao Q, Bao DF (2021) Mycosphere notes 325–344 – Novel species and records of fungal taxa from around the world. Mycosphere: Journal of Fungal Biology 12(1): 1101–1156. https://doi.org/10.5943/mycosphere/12/1/14
  • Hyde KD, Norphanphoun C, Ma J, Yang HD, Zhang JY, Du TY, Gao Y, Gomes de Farias AR, He S, He YK, Li CJ, Li JY, Liu XF, Lu L, Su HL, Tang X, Tian XG, Wang SY, Wei DP, Xu RF, Xu RJ, Yang YY, Zhang F, Zhang Q, Bahkali AH, Boonmee S, Chethana KWT, Jayawardena RS, Lu YZ, Karunarathna SC, Tibpromma S, Wang Y, Zhao Q (2023) Mycosphere notes 387–412 – novel species of fungal taxa from around the world. Mycosphere: Journal of Fungal Biology 14(1): 663–744. https://doi.org/10.5943/mycosphere/14/1/8
  • Jiang N, Voglmayr H, Xue H, Piao CG, Li Y (2022) Morphology and phylogeny of Pestalotiopsis (Sporocadaceae, Amphisphaeriales) from Fagaceae Leaves in China. Microbiology Spectrum 10(6): e03272–e22. https://doi.org/10.1128/spectrum.03272-22
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Kang JC, Kong RYC, Hyde KD (1998) Studies on the Amphisphaeriales I. Amphisphaeriaceae (sensu stricto) and its phylogenetic relationships inferred from 5.8 S rDNA and ITS2 sequences. Fungal Diversity 1: 147–157.
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Li H, Manawasinghe IS, Zhang YX, Senanayake IC (2023) Taxonomic and hylogenic appraisal of Pestalotiopsis linguae sp. nov., and a new record of P. nanjingensis from Pyrrosia lingua (Polypodiaceae) in Southern China. Phytotaxa 587(3): 229–250. https://doi.org/10.11646/phytotaxa.587.3.3
  • Li H, Peng BY, Xie JY, Bai YQ, Li DW, Zhu LH (2024) Pestalotiopsis jiangsuensis sp. nov. causing needle blight on Pinus massoniana in China. Journal of Fungi (Basel, Switzerland) 10(3): 230. https://doi.org/10.3390/jof10030230
  • Ma XY, Maharachchikumbura SSN, Chen BW, Hyde KD, McKenzie EHC, Chomnunti P, Kang JC (2019) Endophytic pestalotiod taxa in Dendrobium orchids. Phytotaxa 419(3): 268–286. https://doi.org/10.11646/phytotaxa.419.3.2
  • Maharachchikumbura SSN, Guo LD, Chukeatirote E, Bahkali AH, Hyde KD (2011) Pestalotiopsis-morphology, phylogeny, biochemistry and diversity. Fungal Diversity 50(1): 167–187. https://doi.org/10.1007/s13225-011-0125-x
  • Maharachchikumbura SSN, Guo LD, Cai L, Chukeatirote E, Wu WP, Sun X, Crous PW, Bhat DJ, McKenzie EHC, Bahkali AH, Hyde KD (2012) A multi-locus backbone tree for Pestalotiopsis, with a polyphasic characterization of 14 new species. Fungal Diversity 56(1): 95–129. https://doi.org/10.1007/s13225-012-0198-1
  • Minh BQ, Nguyen MAT, von Haeseler A (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30(5): 1188–1195. https://doi.org/10.1093/molbev/mst024
  • Monden Y, Yamamoto S, Yamakawa R, Sunada A, Asari S, Makimura K, Inoue Y (2013) First case of fungal keratitis caused by Pestalotiopsis clavispora. Clinical Ophthalmology (Auckland, N.Z. ) 7: 2261–2264. https://doi.org/10.2147/OPTH.S48732
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schimann H, Bach C, Lengelle J, Louisanna E, Barantal S, Murat C, Buée M (2017) Diversity and structure of fungal communities in neotropical rainforest soils: The effect of host recurrence. Microbial Ecology 73(2): 310–320. https://doi.org/10.1007/s00248-016-0839-0
  • Senanayake IC, Maharachchikumbura SSN, Hyde KD, Jayarama Bhat D, Gareth Jones EB, McKenzie EHC, Dai DQ, Daranagama DA, Dayarathne MC, Goonasekara ID, Konta S, Li WJ, Shang QJ, Stadler M, Wijayawardene NN, Xiao YP, Norphanphoun C, Li Q, Liu XZ, Bahkali AH, Kang JC, Wang Y, Wen TC, Wendt L, Xu JC, Camporesi E (2015) Towards unraveling relationships in Xylariomycetidae (Sordariomycetes). Fungal Diversity 73(1): 73–144. https://doi.org/10.1007/s13225-015-0340-y
  • Steyaert RL (1949) Contribution à l’étude monographique de Pestalotia de Not. et Monochaetia Sacc. (Truncatella gen. nov. et Pestalotiopsis gen. nov.). Bulletin du Jardin botanique de l’État à Bruxelles 19(3): 285−354. https://doi.org/10.2307/3666710
  • Steyaert RL (1963) Complementary informations concerning Pestalotiopsis guepini (Desmazieres) Steyaert and designation of its lectotype. Bulletin du Jardin botanique de l’État à Bruxelles 33(3): 369–373. https://doi.org/10.2307/3667200
  • Wang Y, Ran SF, Maharachchikumbura SSN, Al-Sadi AM, Hyde KD, Wang HL, Wang T, Wang YX (2017) A novel Pestalotiopsis species isolated from bulbophyllum thouars in Guangxi Province, China. Phytotaxa 306(1): 96–100. https://doi.org/10.11646/phytotaxa.306.1.9
  • Wang YC, Xiong F, Lu QH, Hao XY, Zheng MX, Wang L, Li NN, Ding CQ, Wang XC, Yang YJ (2019) Diversity of Pestalotiopsis-like species causing gray blight disease of tea plants (Camellia sinensis) in China, including two novel Pestalotiopsis species, and analysis of their pathogenicity. Plant Disease 103(10): 2548–2558. https://doi.org/10.1094/PDIS-02-19-0264-RE
  • Wang YF, Tsui KM, Chen SM, You CJ (2024) Diversity, pathogenicity and two new species of Pestalotioid fungi (Amphisphaeriales) associated with Chinese Yew in Guangxi, China. MycoKeys 102: 201–224. https://doi.org/10.3897/mycokeys.102.113696
  • White TJ, Bruns TD, Lee SB, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications. Academic Press, New York, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Wu F, Dai SJ, Vlasák J, Spirin V, Dai YC (2019) Phylogeny and global diversity of Porodaedalea, a genus of gymnosperm pathogens in the Hymenochaetales. Mycologia 111(1): 40–53. https://doi.org/10.1080/00275514.2018.1526618
  • Zhang D, Gao F, Jakovli’c I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096

Supplementary material

Supplementary material 1 

The concatenated ITS, tef1-α and tub2 sequences

Xing-Xing Luo, Ming-Gen Liao, Kai Zhang, Rafael F. Castañeda-Ruíz, Jian Ma, Zhao-Huan Xu

Data type: fas

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (344.56 kb)
login to comment