Research Article
Print
Research Article
Three new taxa of the lichen genus Lobothallia (Megasporaceae, Ascomycota) from China
expand article infoYanyun Zhang‡, Lun Wang‡, Xinmeng Yu‡, Su Cheng‡, Junlan Liu‡, Xinyu Wang§
‡ Anhui Normal University, Wuhu, China
§ Kunming Institute of Botany, Kunming, China

Corresponding author: Xinyu Wang ( wangxinyu@mail.kib.ac.cn )

Academic editor: Pradeep Divakar
© 2024 Yanyun Zhang, Lun Wang, Xinmeng Yu, Su Cheng, Junlan Liu, Xinyu Wang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Zhang Y, Wang L, Yu X, Cheng S, Liu J, Wang X (2024) Three new taxa of the lichen genus Lobothallia (Megasporaceae, Ascomycota) from China. MycoKeys 108: 351-369. https://doi.org/10.3897/mycokeys.108.126994
Open Access

Abstract

Two new species; Lobothallia crenulata Lun Wang & Y. Y. Zhang, L. lobulata Lun Wang & Y. Y. Zhang and one new variety; L. subdiffracta var. rimosa Lun Wang & Y. Y. Zhang, are reported from China and described, based on morphological, chemical and molecular characters. Phylogenetic analyses showed that these new taxa form monophyletic groups. Lobothallia crenulata and L. lobulata, together with L. hydrocharis, L. radiosa and L. recedens, form a well-supported clade, whereas L. subdiffracta var. rimosa is nested within the samples of L. subdiffracta. Lobothallia crenulata is characterised by its placodioid thallus, thickly pruinose upper surface with a rimose appearance, aspicilioid to lecanorine apothecia with a crenate thalline margin and concave, black and pruinose discs. Lobothallia lobulata is characterised by its placodioid thallus, pruinose upper surface with lobules, aspicilioid when immature, lecanorine to zeorine apothecia at maturity and concave to plane, dark brown, shiny and epruinose discs. Lobothallia subdiffracta var. rimosa is characterised by its areolate thallus, rimose and pruinose upper surface, lecanorine apothecia and slightly concave to plane, black and pruinose discs. Secondary metabolites were not detected in the two new species nor the new variety. A key is provided for the species of Lobothallia in China.

Key words

New species, new variety, Qinghai-Tibetan Plateau, saxicolous lichen, taxonomy

Introduction

Lobothallia (Clauzade & Cl. Roux) Hafellner was originally established as a subgenus within Aspicilia A. Massal. (Clauzade and Roux 1984), then later treated as a distinct genus by Hafellner (1991). The genus Lobothallia is characterised by its immersed to adnate, or constrictively sessile apothecia, an epihymenium N– reaction to slightly greenish, an algal layer below the hypothecium, a non-amyloid ascus tholus (Aspicilia-type), with shorter ascospores (< 18 µm) and conidia (< 8 µm) compared to other genera of the family Megasporaceae (Nordin et al. 2010; Kou et al. 2013; Paukov et al. 2019).

Initially, Lobothallia was established to accommodate four marginally lobate species; including L. alphoplaca (Wahlenb.) Hafellner, L. melanaspis (Ach.) Hafellner, L. praeradiosa (Nyl.) Hafellner and L. radiosa (Hoffm.) Hafellner (Hafellner 1991). Subsequently, multiple species were transferred into Lobothallia, based on their phylogeny and taxonomy. These additions included lobate species: Aspicilia hydrocharis Poelt & Nimis, Lecanora hedinii H. Magn., L. platycarpa J. Steiner (Nimis 2016; Paukov et al. 2019; Zulfiqar et al. 2022) and non-lobate or vaguely lobate species, such as Aspicilia farinosa (Flörke) Flagey, A. recedens (Taylor) Arnold and Lecanora subdiffracta H. Magn. (Nordin et al. 2010; Paukov et al. 2019). To date, the genus includes 28 species worldwide (https://www.indexfungorum.org/).

Ten species of Lobothallia have been reported from China: L. alphoplaca, L. cheresina (Müll. Arg.) A. Nordin, Cl. Roux & Sohrabi, L. crassimarginata Kou & Q. Ren, L. hedinii (H. Magn.) Paukov, A. Nordin & Sohrabi, L. praeradiosa, L. pruinosa Kou & Q. Ren, L. radiosa, L. semisterilis (H. Magn.) Y. Y. Zhang, L. subdiffracta (H. Magn.) Paukov and L. zogtii Paukov & Davydov (Magnusson 1940, 1944; Reyim et al. 2012; Kou et al. 2013; Paukov et al. 2019; Wei 2020; Zhang et al. 2020). Secondary metabolites have been reported for all of these species except, L. subdiffracta. From 2014 to 2022, we conducted several field surveys of lichen across the Qinghai-Tibetan Plateau Region, during which, ca. 100 specimens were collected of the genus Lobothallia. Several of these specimens differed from the known species in their morphology, molecular phylogeny and absence of secondary metabolites. Here, we describe two new species and one new variety within the genus Lobothallia.

Materials and methods

Morphological and chemical examination

In this study, 108 specimens were examined and deposited in the following Herbaria: Anhui Normal University (AHUB), Lichen Herbarium, Kunming Institute of Botany, Chinese Academy of Sciences (KUN-L) and Shandong Normal University (SDNU). The external morphological characters of air-dried material were studied under a stereomicroscope (OLYMPUS SZ61TR). Anatomical features were studied using a light microscope (OLYMPUS BX43) on transverse sections of apothecia and thalli, prepared manually with a razor blade and mounted in water or lactophenol cotton blue (LCB). Spore measurements were presented as: (minimum–) (x̄ - SD) – x̄ – (x̄ + SD) (–maximum), where x̄ is the arithmetic mean and SD is the standard deviation (values were rounded to the nearest 0.5 µm), followed by the number of measurements (n) (Li et al. 2023). Lugol’s solvent (I) was used to examine the apical structure of asci. Crystals in apothecia and thallus were observed in polarised light (POL) and their solubility was assessed in 10% potassium hydroxide (KOH) (K). Spot tests were conducted using K and a saturated aqueous solution of sodium hypochlorite (NaClO) (C). Secondary metabolites were analysed using thin layer chromatography (TLC) with the solvent C (Orange et al. 2001).

DNA extraction, PCR and sequencing

Genomic DNA was extracted from dry or fresh specimens using the DNAsecure Plant Kit (Tiangen, China), according to the manufacturer’s instructions. The fungal internal transcribed spacer (ITS) region and mitochondrial small subunit (mtSSU) of rDNA were amplified using the primers, ITS1F (5′ CTTGGTCATTTAGAGGAAGTAA 3′) (Gardes and Bruns 1993), ITS4a (5′ CGCCGTTACTGGGGCAATCCCTG 3′) (Larena et al. 1999), mrSSU1 (5′ AGCAGTGAGGAATATTGGTC 3′) and mrSSU3r (5′ ATGTGGCACGTCTATAGCCC 3′) (Zoller et al. 1999). Amplifications were performed in a 25 μl volume containing 12.5 μl 2 × Trio Taq Master Mix (Monad Anhui), 1 μl of each primer, 9.5 μl ddH2O and 1 μl DNA. PCR-cycle conditions were: initial denaturation at 94 °C for 5 min, followed by 30 cycles of 94 °C for 15 s, 53 °C for 15 s and 72 °C for 1 min and a final extension at 72 °C for 10 min. The PCR products were visualised on 1% agarose gels. The PCR products were sequenced by GENERAL Biosystems (Chuzhou, China) using the amplification primers.

Phylogenetic analyses

The raw sequences were initially checked with the BLAST tool on the NCBI online service (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to confirm the lichen affinity. Geneious v.8.0. was used to assemble and edit the raw sequences and generate a single matrix for nrITS and mtSSU. Each matrix was aligned using the MAFFT v.7 online server (https://mafft.cbrc.jp/alignment/server/). Before concatenating the single-gene matrices of nrITS and mtSSU, we tested for potential incongruity using IQ-TREE with 1000 ultrafast bootstrap replicates. No well supported conflict was detected. SequenceMatrix 1.7.8 (Vaidya et al. 2011) was used to concatenate the nrITS and mtSSU genes and produce a 2-locus dataset. PartitionFinder v.2.0 (Lanfear et al. 2017) was used to estimate the best schemes and nucleotide substitution models for Maximum Likelihood (ML) and Bayesian Inference (BI) analyses. The best-fit models for ITS1, 5.8S, ITS2 and mtSSU were GTR+G.

Phylogenetic relationships were inferred using Bayesian Inference and Maximum Likelihood. The Bayesian method was performed with MrBayes 3.2.7 (Ronquist et al. 2012), using four Markov chains running for 12 million generations. Trees were sampled every 100 generations and the first 25% were discarded as burn-in. Subset rates were modelled as fixed and equal. We used the default distributions for priors. The average standard deviation of split frequencies fell below 0.01 by the end of the analysis. Tracer v.1.7 (Rambaut et al. 2018) was used to assess chain convergence by checking the effective sampling size (ESS > 200). ML analyses were performed with RaxmlGUI (Silvestro and Michalak 2012) using the general time reversible model of nucleotide substitution with the gamma model of rate heterogeneity (GTRGAMMA). All trees were visualised using Mega v.7.0 (Kumar et al. 2016) and edited using PowerPoint. Bayesian posterior probabilities ≥ 0.95 and ML bootstrap values ≥ 70% were presented on the ML tree.

Results and discussion

The nrITS-mtSSU data matrix encompassed a total of 91 sequences (61 nrITS, 30 mtSSU, including 49 downloaded from GenBank and 42 newly generated) from 61 samples of 22 taxa (Table 1). The length of the final aligned dataset was 1342 nucleotides. Three species, Aspicilia cinerea (L.) Körb., Circinaria esculenta (Pall.) Sohrabi and C. fruticulosa (Eversm.) Sohrabi were chosen as the outgroup, following previous phylogenetic studies (Nordin et al. 2010; Paukov et al. 2019).

Table 1.
Download as
CSV
XLSX

Sequences used in the phylogenetic analyses in this study, with specimen information and GenBank accession numbers. Newly-obtained sequences are in bold font. “na” indicates that there is no sequence available.

Species Country Voucher specimens GeneBank accession number Reference
nrITS mtSSU
Aspicilia cinerea Sweden: Dalarna Hermansson 13275 (UPS) EU057899 HM060695 Nordin et al. (2010)
Circinaria fruticulosa Russia: Chelyabinsk Paukov 3074 (UFU) MK347508 MK348227 Paukov et al. (2019)
C. esculenta Kazakhstan: Kyzylorda UFU L-1743 MK347507 MK348226 Paukov et al. (2019)
Lobothallia alphoplaca Norway O-L-200411 MK812484 na Marthinsen et al. (2019)
L. alphoplaca Ukraine: Donetzk SK A20 KT456207 KT456211 Kondratyuk et al. (2015)
L. alphoplaca China: Inner Mongolia Tong 20117616 (SDNU) JX499233 na Kou et al. (2013)
L. brachyloba Russia: Republic of Altai Frolov 357 (UFU) Holotype MK347506 MK348228 Paukov et al. (2019)
L. crenulata China: Xizang ZYY22-331 (AHUB) PP663141 PP663164 This paper
L. crenulata China: Xizang ZYY22-301 (KUN-L) Holotype PP663142 PP663165 This paper
L. cheresina Greece Sipman & Raus 63224 (B) MN172423 na Unpublished
L. crassimarginata China: Inner Mongolia Wang 20122565 (SDNU) Holotype JX476026 na Kou et al. (2013)
L. crassimarginata China: Inner Mongolia Tong 20122583 (SDNU) KC007439 na Kou et al. (2013)
L. densipruinosa Pakistan LAH 36790 Holotype MZ871507 na Ashraf et al. (2022)
L. densipruinosa Pakistan LAH 36951 MZ871515 na Ashraf et al. (2022)
L. elobulata Pakistan LAH 37153 Holotype ON384441 na Zulfiqar et al. (2022)
L. elobulata Pakistan LAH 37154 ON428667 na Zulfiqar et al. (2022)
L. epiadelpha Russia: Orenburg Paukov 1881 (UFU) Holotype MK347505 MK348232 Paukov et al. (2019)
“L. helanensis” China: Inner Mongolia Tong 20122517 (SDNU) Holotype JX476030 na Kou et al. (2013)
“L. helanensis” China: Inner Mongolia Tong 20122791 (SDNU) JX476031 na Kou et al. (2013)
L. hydrocharis Italy: Sardinia JN72085b (BOLO) OQ073922 na Nascimbene et al. (2023)
L. hydrocharis Italy: Sardinia SMNS-STU-F-0002807 (STU) OQ073923 na Nascimbene et al. (2023)
L. iqbalii Pakistan LAH 37149 Holotype ON384444 na Zulfiqar et al. (2022)
L. iqbalii Pakistan LAH 37150 ON384445 na Zulfiqar et al. (2022)
L. lobulata China: Sichuan ZYY22-819 (KUN-L) Holotype PP663143 PP663166 This paper
L. lobulata China: Sichuan ZYY22-822 (AHUB) PP663144 PP663167 This paper
L. lobulata China: Sichuan Wang et al. 22-73395 (KUN-L) PP663145 PP663168 This paper
L. lobulata China: Sichuan Wang et al. 22-73396 (KUN-L) PP663146 PP663169 This paper
L. lobulata China: Sichuan ZYY22-829 (AHUB) PP663147 PP663170 This paper
L. lobulata China: Sichuan ZYY22-824 (AHUB) PP663148 PP663171 This paper
L. melanaspis Sweden: Jämtland Nordin 6622 (UPS) HQ259272 HM060688 Nordin et al. (2011)
L. melanaspis Norway Owe-Larsson 8943a (UPS) JF825524 na Valadbeigi et al. (2011)
L. pakistanica Pakistan LAH 37137 Holotype ON392718 na Zulfiqar et al. (2022)
L. pakistanica Pakistan LAH 37139 ON392720 na Zulfiqar et al. (2022)
L. praeradiosa Russia: Orenburg UFU L-1264 MK347501 MK348229 Paukov et al. (2019)
L. praeradiosa China: Xinjiang Huang 20126355 (SDNU) JX499230 na Kou et al. (2013)
L. praeradiosa China: Xinjiang Wang et al. 22-71753 (KUN-L) PP663149 na This paper
L. praeradiosa China: Xinjiang ZYY22-596 (AHUB) PP663150 PP663172 This paper
L. praeradiosa China: Xinjiang ZYY22-570 (AHUB) PP663151 PP663173 This paper
L. pruinosa China: Inner Mongolia Wang 20123630 (SDNU) JX476027 na Kou et al. (2013)
L. pruinosa China: Inner Mongolia Wang 20123278 (SDNU) Holotype JX476028 na Kou et al. (2013)
L. pruinosa China: Inner Mongolia Wang 20123575 (SDNU) PP663152 na This paper
L. pruinosa China: Inner Mongolia Wang 20122917 (SDNU) PP663153 na This paper
L. pruinosa China: Inner Mongolia Dong 20123276 (SDNU) PP663154 na This paper
L. radiosa Czech Republic: South Moravia Malicek 9968 ON707068 ON715664 Unpublished
L. radiosa Greece Sipman & Raus 63229 (B) MN172452 na Unpublished
L. radiosa Sweden Nordin 5889 (UPS) JF703124 na Roux et al. (2011)
L. recedens Sweden Nordin 6035 (UPS) HQ406807 na Owe-Larsson et al. (2011)
L. recedens Portugal Sipman 62857 MN586980 na Sipman and Aptroot (2020)
L. subdiffracta var. rimosa China: Xinjiang Wang et al. 22-72975 (KUN-L) PP663155 PP663174 This paper
L. subdiffracta var. rimosa China: Xinjiang ZYY22-647 (KUN-L) Holotype PP663156 PP663175 This paper
L. semisterilis China: Qinghai Wang et al. 18-59322 (KUN-L) MK778039 na Zhang et al. (2020)
L. semisterilis China: Qinghai Wang et al. 18-59345 (KUN-L) MK778042 na Zhang et al. (2020)
L. semisterilis China: Gansu Wang et al. 22-73123T (KUN-L) PP663157 PP663176 This paper
L. semisterilis China: Gansu Wang et al. 22-73079A (KUN-L) PP663158 PP663177 This paper
L. semisterilis China: Gansu ZYY22-715 (AHUB) PP663159 PP663178 This paper
L. semisterilis China: Gansu ZYY22-719 (AHUB) PP663160 PP663179 This paper
L. semisterilis China: Gansu ZYY22-704 (AHUB) PP663161 PP663180 This paper
L. subdiffracta Russia: Republic of Altai Frolov 178-1 (UFU) MK347503 MK348233 Paukov et al. (2019)
L. subdiffracta Russia: Republic of Altai Frolov 178-2 (UFU) MK347504 MK348235 Paukov et al. (2019)
L. subdiffracta China: Xinjiang ZYY22-628 (AHUB) PP663162 PP663181 This paper
L. subdiffracta China: Xinjiang Yin A. C. & Chen H. X. 22-72347 (KUN-L) PP663163 PP663182 This paper

The two-locus phylogenetic tree showed that species of the genus Lobothallia fell into three main clades (Fig. 1). Our two new species, Lobothallia crenulata and L. lobulata, formed highly supported monophyletic clades, which belonged to Clade I. Lobothallia cheresina is the basal species of this clade, differing from other species of this clade by its non-lobate thallus with definite cracks up to the margins and aspicilioid apothecia without prominent margin (Müller 1880; Paukov et al. 2019; Zulfiqar et al. 2022). Lobothallia lobulata and L. crenulata, together with the species of L. hydrocharis (Poelt & Nimis) Sohrabi & Nimis, L. radiosa and L. recedens (Taylor) A. Nordin, Savić & Tibell formed a monophyletic subclade. Species of this subclade had no secondary metabolites, with the exceptions of L. radiosa, which has three chemotypes: chemotype parasitica (stictic acid), chemotype subcircinata (norstictic acid) and chemotype radiosa (without norstictic or with trace amount of norstictic acid) (Nimis and Poelt 1987; Ryan 2004; Paukov et al. 2019; Zulfiqar et al. 2022). Lobothallia crenulata is the basal species of this subclade and differs from the other species by its thickly pruinose thallus with rimose upper surface and its crenate thalline margin. Lobothallia lobulata is sister to a subclade formed by L. hydrocharis and L. radiosa, but differs in the presence of lobules at the upper surface and its lecanorine to zeorine apothecia at maturity.

Figure 1. 

Phylogenetic tree generated from Maximum Likelihood (ML) analysis, based on the concatenated nrITS and mtSSU dataset. ML bootstrap values ≥ 70% (left) and Bayesian posterior probabilities ≥ 0.95 (right) are displayed along the branches of the tree. Newly-generated sequences are indicated in bold. The three new taxa are marked by triangles.

Clade II comprises a single species, Lobothallia elobulata Zulfiqar, Khalid & Paukov, which is easily recognised by its black prothallus, non-lobate thallus with a smooth and epruinose upper surface, lecanorine apothecia with thinly pruinose disc and the absence of secondary metabolites (Zulfiqar et al. 2022). Further research is required regarding the phylogenetic position of this clade.

Clade III consisted of several subclades and species lineages. Species of this clade were mainly distributed in Asia. Our new variety; Lobothallia subdiffracta var. rimosa, together with samples of “L. helanensis” formed a sister group to L. subdiffracta, which was nested within Clade III. These taxa differ from other species of this clade by their non-lobate, thick and areolate thallus, rimose upper surface and absence of secondary metabolites (Magnusson 1944; Kou et al. 2013; Paukov et al. 2019). The species “Lobothallia helanensis” was synonymised to L. subdiffracta by Paukov et al. (2019). Lobothallia subdiffracta var. rimosa differs from L. subdiffracta by its lecanorine apothecia with permanent thalline margin and pruinose discs.

Nine out of the 28 species within the genus Lobothallia have no available gene sequences. Amongst these, secondary metabolites are only absent for Lobothallia chadefaudiana (Cl. Roux) A. Nordin, Cl. Roux & Sohrabi. Lobothallia chadefaudiana can be distinguished from our new taxa by the non-lobate thallus, with rough yellowish granules on the upper surface and immersed apothecia (Roux 1977; Paukov et al. 2019). Lobothallia cernohorskyana (Clauzade & Vězda) A. Nordin, Cl. Roux & Sohrabi, L. controversa Cl. Roux & A. Nordin, L. gangwondoana S.Y. Kondr., J.J. Woo & Hur and L. lacteola (Oxner) Şenkard., Paukov, Davydov & Sohrabi differ from the two new species by their non-lobate thallus, aspicilioid apothecia and the presence of norstictic acid (Clauzade and Vězda 1970; Roux et al. 2016; Paukov et al. 2019; Kondratyuk et al. 2020). Lobothallia zogtii is characterised by the brown thallus, white bordered squamules and the presence of stictic acid complex (Paukov et al. 2019). Lobothallia platycarpa shares whitish-grey and lobate thallus with the new species of L. crenulata, but differs in its immersed apothecia and the presence of norstictic acid (Zulfiqar et al. 2022). Lobothallia hedinii could potentially be confused with L. lobulata, but differs by its brown thallus, straight and parallel lobes and presence of norstictic acid (Magnusson 1940; Paukov et al. 2019).

Taxonomy

Lobothallia crenulata Lun Wang & Y. Y. Zhang, sp. nov.

Fungal Names: FN 571927
Fig. 2A–J

Type

China • Xizang Autonomous Region: Shigatse Ci., Sa′gya Co.; 29°12′01.28″N; 88°23′09.65″E; 3924 m elev.; on schist rock in a desert environment; 14 June 2022; ZYY22-301 (Holotype: KUN-L0081882!, Isotype: AHUB-00157!).

Diagnosis

Lobothallia crenulata is characterised by its placodioid, thickly pruinose thallus, rimose upper surface, aspicilioid to lecanorine apothecia with a crenate thalline margin, concave, black and pruinose disc and the absence of secondary metabolites.

Etymology

The epithet refers to the crenate thalline margin of the apothecia.

Description

Thallus placodioid, circular to irregular in outline, up to 2 cm in diameter; central areoles contiguous, angular to rounded, flat to slightly convex, 0.5–2 mm wide; marginal lobes closely attached, 0.5–2 mm long, 0.2–1 mm wide, with an irregularly arranged and divided apex. Upper surface white to light grey, covered with white, thick and discontinuous pruina (see Fig. 2D). Upper cortex paraplectenchymatous, hyaline, 20–50 μm thick; epinecral layer 20–70 μm thick, consisting of dark granules (POL+, insoluble in K); algal layer discontinuous, interrupted by fungal tissue, forming separated groups, 50–150 μm high, diffuse dark granules (soluble in K), algae ca. 10–20 μm in diam.; medulla with dark brown granules (POL+, insoluble in K). Lower cortex absent.

Figure 2. 

Lobothallia crenulata A thallus and apothecia B apothecia C marginal lobes D cross-section of thallus (LCB) E cross-section of thallus under polarised light (LCB) F vertical section of apothecia G, H ascus I ascospores J conidia. All sections were mounted in water, except where otherwise stated. Scale bars: 1 mm (A, C); 0.4 mm (B); 100 µm (D, E); 20 µm (F); 5 µm (G, H, I, J).

Apothecia aspicilioid to lecanorine, numerous, 1–2 per areole, dispersed to crowded, rounded to flexuous, 0.1–1.25 mm in diam.; disc concave, black and thinly pruinose; thalline margin crenate, concolorous with the thallus, 0.05–0.125 mm wide; proper exciple inconspicuous. Hymenium hyaline, 75–120 µm high, I + blue; epihymenium 10–20 µm high, with inspersed pale brown (insoluble in K) and brown (soluble in K) granules and coarse hyaline plate-like crystals (insoluble in K); paraphyses simple, submoniliform at upper part, with 2–4 apical cells, apex thickened, 3–5 µm wide; hypothecium 30–60 μm high, hyaline, I+ blue; asci 8-spored, clavate, Aspicilia-type, 70–80 × 20–30 µm; ascospores hyaline, simple, broadly ellipsoid to ellipsoid, (8.0–)11.0–13.0–14.5(–17.0) × (7.0–)8.5–9.0–10.0(–11.0) µm (n = 56), wall ca. 1.0 µm. Pycnidia uncommon; conidia bacilliform, 5–6 × 1–1.5 µm.

Chemistry

K–, C–, KC–. No substances were detected by TLC.

Distribution and ecology

This new species grows on calcareous schist rocks at elevations of 3924–4304 m in Xizang Autonomous Region, China.

Notes

The new species is similar to Lobothallia iqbalii Zulfiqar, Khalid & Paukov and L. pakistanica Razzaq, Fayyaz, Khalid & Afshan in its placodioid thallus, white to light grey upper surface and the absence of secondary metabolites. Lobothallia iqbalii differs in its lecanorine apothecia with plane to convex disc and an entire and thick thalline margin (Zulfiqar et al. 2022). Lobothallia pakistanica differs in its rarely cracked central areoles, thinner epinecral layer (8–16 µm), slightly concave to flat, rarely pruinose disc and the absence of thalline margin (Zulfiqar et al. 2022). Lobothallia subdiffracta shares some features with L. crenulata: rimose and pruinose thallus. However, L. subdiffracta differs in its grey thallus with thinner and uneven pruina and its non-lobate thallus (Magnusson 1944; Kou et al. 2013; Paukov et al. 2019). Another taxon, Lobothallia pruinosa, also has a placodioid and pruinose thallus and pruinose discs, but differs from L. crenulata in its entire thalline margin and the presence of norstictic and constictic acids (Kou et al. 2013).

Additional specimens examined

China • Xizang Autonomous Region: Shigatse Ci., Dingri Co., along road G219; 28°35′10.03″N, 87°3′42.56″E; 4304 m elev.; on weathered schist rock; 16 June 2022; ZYY22-331 (KUN-L0081892, AHUB-00187).

Lobothallia lobulata Lun Wang & Y. Y. Zhang, sp. nov.

Fungal Names: FN 571928
Fig. 3A–K

Type

China • Sichuan Prov.: Ganzi Tibetan Autonomous Prefecture, Xinlong County, along road G227; 31°25′52.77″N, 100°8′52.04″E; 3296 m elev.; on rock; 11 July 2022; ZYY22-819 (Holotype: KUN-L0082392!; Isotype: AHUB-00673!).

Diagnosis

The species Lobothallia lobulata is characterised by its conspicuously radiate marginal lobes, pruinose upper surface with lobules, the aspicilioid apothecia when immature, lecanorine to zeorine at maturity with epruinose, shiny discs and the absence of secondary metabolites.

Etymology

The epithet refers to its lobules along the upper surface.

Description

Thallus placodioid, circular in outline, up to 3 cm in diameter, tightly adnate to the substratum; central areoles contiguous, angular to irregular, plane to slightly convex, 0.3–1 mm across; marginal lobes radiate, plane, 1–5 mm long, 0.5–1 mm wide, ca. 0.3 mm thick, apex rounded, irregularly divided, usually with a black rim. Upper surface light grey to greyish-olive, lightly and discontinuously pruinose, pruina on the apex of lobes thicker than the centre. Lobules common, 0.1–0.3 mm, divided, heavily pruinose. Upper cortex paraplectenchymatous, even, ca. 30 μm thick, filled with pale brown (insoluble in K) and dark brown (partly soluble in K) granules; epinecral layer 10–20 μm thick, containing dark granules when pruina is present (POL+, insoluble in K); algal layer discontinuous, interrupted by fungal tissue, forming separated groups, 50–150 μm high, containing black substance (soluble in K), algae cells ca. 5–10 μm in diam.; medulla filled with black substance (POL+, insoluble in K). Lower cortex absent.

Apothecia aspicilioid when immature, lecanorine to zeorine at maturity, common, initially 1–2 per areole, usually one per areole, scattered to slightly grouped, adnate, rounded, 0.5–1 mm in diam.; disc brown to brownish-black, shiny, epruinose, concave at first, plane at maturity; thalline margin entire, ca. 0.1 mm wide, slightly pruinose or epruinose, cortex identical with upper cortex (POL–), 30–50 μm thick; proper exciple conspicuous in mature apothecia, 20–150 μm thick. Hymenium hyaline, I+ blue, 100–120 μm high; epihymenium 5–10 μm thick, with pale brown (insoluble in K) and brown (soluble in K) granules; paraphyses simple, moniliform at upper part, with 3–6 cells, apex thickened, 4–6 µm wide; hypothecium 25–50 μm thick, hyaline, I+ blue; asci 8-spored, clavate, Aspicilia-type, 70–80 × 15–20 µm; ascospores hyaline, simple, broadly ellipsoid, (9.0–)10.5–11.5–12.5(–13.0) × (7.0–)8.0–8.5–9.5(–10.0) µm (n = 64), wall ca. 1.0 µm. Pycnidia common, convex, ostioles dark brown, shiny; conidia hyaline, bacilliform, 5–6 × ca. 1 μm.

Figure 3. 

Lobothallia lobulata A thallus and apothecia B apothecia C lobules D cross-section of thallus E cross-section of thallus under polarised light F vertical section of apothecia G vertical section of apothecia under polarised light H, I ascus J ascospores K conidia. All sections were mounted in water, except where otherwise stated. Scale bars: 2 mm (A); 0.4 mm (B); 1 mm (C); 20 µm (D, E); 50 µm (F, G); 5 µm (H, I, J, K).

Chemistry

K–, C–, KC–. No substances were detected by TLC.

Distribution and ecology

This new species grows on exposed calcareous rocks at elevations of 3262–3296 m elev. in Sichuan Province, China.

Notes

This species shares morphological features with the closely-related Lobothallia radiosa: both have placodioid thallus, areolate in central parts and conspicuously radiate marginal lobes. Lobothallia radiosa has three chemotypes: parasitica with stictic acid, subcircinata with norstictic acid and radiosa with or without a trace amount of norstictic acid (Ryan 2004; Reyim et al. 2012; Paukov et al. 2019). The new species shares the chemotype of some specimens of radiosa, but differs in the presence of lobules, the aspicilioid apothecia when immature, lecanorine to zeorine at maturity and in its phylogenetic position. Lobothallia hydrocharis also has a placodioid thallus with secondary metabolites absent, but differs by its aspicilioid apothecia with black and matt discs and its distribution, which is restricted to Sardinia, Italy (Nimis and Poelt 1987; Nimis 2016; Nascimbene et al. 2023).

Additional specimens examined

China • Sichuan Prov.: Xinlong Co., along road G227; 31°25′53″N, 100°8′53″E; 3282–3296 m elev.; on rock; 11 July 2022; ZYY22-822 (KUN-L0082395, AHUB-00676), ZYY22-824 (KUN-L0082397, AHUB-00678), ZYY22-829 (KUN-L0082402, AHUB-00683) • Shadui Vi.; 31°25′52″N, 100°8′54″E; 3262–3263 m elev.; on limestone rock; 11 July 2022; Li S. Wang et al.; 22-73395 (KUN-L0087873), 22-73396 (KUN-L0087874).

Lobothallia subdiffracta var. rimosa Lun Wang & Y. Y. Zhang, var. nov.

Fungal Names: FN 571929
Fig. 4 A–J

Type

China • Xinjiang Uygur Autonomous Region: Hami Ci., Balikun Co.; 43°41′39″N, 92°17′48″E; 2031 m elev.; on rock; 04 July 2022; ZYY22-647 (Holotype: KUN-L0082221!, isotype: AHUB00501!).

Diagnosis

Lobothallia subdiffracta var. rimosa is characterised by its areolate thallus with slightly radiated marginal areoles, rimose and white pruinose upper surface, lecanorine apothecia with black and pruinose discs, its crenate thalline margin when immature and entire at maturity and the absence of secondary metabolites.

Etymology

The epithet refers to the rimose upper surface.

Description

Thallus areolate, usually circular in outline, up to 4 cm in diam., 2–5 mm thick, central areoles continuous, angular and slightly convex, 0.5–2.5 mm across, marginal areoles slightly radiate with a rounded apex. Upper surface greyish to clay coloured, rimose and pruinose. Upper cortex paraplectenchymatous, uneven, (25.0–)36.5–53.5–70.5(–85.0) μm (n = 20) thick, upper part brownish, insoluble in K; epinecral layer uneven, (10.0–)21.5–45.5–69.0(–95.0) μm (n = 30) thick, containing dark brown granules (POL+, insoluble in K); algal layer discontinuous, interrupted by fungal tissue, forming algal stacks, 100–200 μm high, with dark granules (partly soluble in K), algae 8–15 μm in diam.; medulla containing black substance (POL+, insoluble in K). Lower cortex absent.

Figure 4. 

Lobothallia subdiffracta var. rimosa A thallus and apothecia B thalline margin crenate when immature and entire at maturity C slightly radiate arrangement of marginal areoles D cross-section of thallus E cross-section of thallus under polarised light F vertical section of apothecia G ascus H ascus (Lugol’s solution) I ascospores J conidia. All sections were mounted in water except where otherwise stated. Scale bars: 2 mm (A); 1 mm (B, C); 100 µm (D, E); 20 µm (F); 5 µm (G, H, I, J).

Apothecia lecanorine, numerous, initially 1–2 per areole, then one per areole, dispersed to grouped, rounded, (0.2–)0.7–1.5(–2) mm in diam.; disc slightly concave to plane, matt, black, pruinose; thalline margin 0.1–0.15 mm wide, crenate when young, entire with age, pruinose, concolorous with upper surface, cortex identical with upper cortex (POL+), 40–75 μm thick; proper exciple inconspicuous. Hymenium hyaline, I+ blue, 100–125 μm high; epihymenium 5–15 μm thick, with pale brown (insoluble in K), brown (soluble in K) granules and hyaline plate-like crystals (insoluble in K); paraphyses simple to rarely anastomosed, submoniliform to moniliform at the upper part, with 3–5 cells, apex thickened, 4–6 µm wide; hypothecium 50–60 μm thick, hyaline, I+ blue; asci 8-spored, clavate, Aspicilia-type, 60–80 × 20–30 µm; ascospores hyaline, simple, broadly ellipsoid, (8.0–)10.0–11.0–12.5(–13.0) × (7.0–)7.0–8.0–9.0(–10.0) µm (n = 50), wall ca. 1.0 µm. Pycnidia common, with punctiform ostiole, dark brown; conidia hyaline, bacilliform, 5–7(–8) × ca. 1 μm.

Chemistry

K–, C–, KC–. No substances were detected by TLC.

Distribution and ecology

This species grows on exposed calcareous rocks at elevations of approximately 2000 m in Xinjiang Uygur Autonomous Region, China.

Notes

Lobothallia subdiffracta var. rimosa, L. subdiffracta var. subdiffracta and “L. helanensis” were sympatric in north-western China and neighbouring regions and also phylogenetically closely interrelated (Kou et al. 2013; Paukov et al. 2019). “Lobothallia helanensis” was previously synonymised with L. subdiffracta, because both shared the morphological characters of non-lobate thallus and apothecia with incised margins, with similar sequences in the ITS and mtSSU regions (Paukov et al. 2019). Our materials differ from both var. subdiffracta and “L. helanensis” by their characters of lecanorine apothecia, permanent thalline margin, pruinose discs and the slightly radiate marginal areoles. Therefore, we treat these specimens as a new variety within Lobothallia subdiffracta. Table 2 presents a brief comparison of these taxa. Another taxon Lobothallia recedens may be confused with L. subdiffracta var. rimosa due to its thick, areolate, non-lobate thallus and the absence of secondary metabolites. However, the former differs in its densely clustered apothecia (3–6 per areole) and its shorter conidia 3–5 × ca. 1 μm (Paukov et al. 2019; Cannon et al. 2023; Martellos et al. 2023).

Table 2.
Download as
CSV
XLSX

Comparison between Lobothallia var. subdiffracta, “L. helanensis” and L. var. rimosa.

Character L. var. subdiffracta “L. helanensis” L. var. rimosa
Thallus form areolate areolate areolate, marginal areoles slightly elongate
Apothecia form and size (mm) aspicilioid, disc 0.2–0.4(–1.5 in our newly collected materials) in diam. aspicilioid, 0.5–1.3(–2) in diam. lecanorine, (0.2–)0.7–1.5(–2) in diam.
Disc epruinose epruinose pruinose
Habit (substratum) siliceous rock calcareous rock calcareous rock
References Magnusson (1944); Paukov et al. (2019) Kou et al. (2013) This paper

Additional specimens examined

Lobothallia subdiffracta var. rimosa. China • Xinjiang Uygur Autonomous Region: Hami Ci., Balikun Co., along road G335, 43°41′35.55″N, 92°17′46.81″E, 2036 m elev., on limestone rock, 04 July 2022, Li S. Wang et al. 22-72975 (KUN-L0087453).

Lobothallia subdiffracta var. subdiffracta. China • Xinjiang Uygur Autonomous Region: Fukang Ci., Chengguan Vi.; 44°09′36.52″N, 87°58′42.00″E; 500–600 m elev.; on sandstone; 04 July 2022; Yin A. C. & Chen H. X.; 22-72347 (KUN-L0086973) • Turpan Ci., Tuokexun Co.; 43°06′15.85″N, 87°34′52.51″E; 2473 m elev.; on rock; 02 July 2022; ZYY22-628 (KUN-L0082202, AHUB-00482).

“Lobothallia helanensis”. China • Inner Mongolia: Bayan Hot Vi., Helan Mountain; 1500–2000 m elev.; on rock; 19 Aug 2011; Wang H. Y. 20122708; Kou X. R. 20123833, Wang P. M. 20123198, Dong D. B. 20123040 (SDUN).

Key to the species of Lobothallia in China

1 Thallus areolate, margins not lobate 2
– Thallus placodioid, margins distinctly lobate 4
2 Thallus whitish with grey tinge, upper surface not farinose, with definite cracks up to the margin. Orbicular specimens with marginally radially elongated cracks, given the thallus a placodioid-like appearance. Apothecia without prominent thalline margin. Secondary metabolites absent or stictic/norstictic acid present Lobothallia cheresina
– Thallus pruinose and rimose, not cracked. Apothecia with prominent thalline margin. Secondary metabolites absent 3
3 Thallus light to dark grey to olive grey. Apothecia aspicilioid to lecanorine, with an epruinose disc Lobothallia subdiffracta var. subdiffracta
– Thallus greyish to clay coloured. Apothecia lecanorine, with a pruinose disc Lobothallia subdiffracta var. rimosa
4 Terricolous, pycnidia prominent, sometimes protruding apothecia-like Lobothallia semisterilis
– Saxicolous, pycnidia immersed to slightly convex with depressed or punctiform ostiole 5
5 Secondary metabolites absent 6
– Secondary metabolites present 7
6 Lobules present at the upper surface, discs shiny and epruinose, thalline margin entire Lobothallia lobulata
– Lobules absent, discs matt and pruinose, thalline margin crenate Lobothallia crenulata
7 Norstictic acid present 8
– Norstictic acid absent, but stictic acid present. Thallus brown, lobes with definite deep cracks forming a reticulate pattern in exposed habitat Lobothallia zogtii
8 Thallus epruinose 9
– Thallus pruinose 11
9 Thallus loosely attached to the substratum (sometimes removable intact). Central areoles strongly swollen, bullate. Lobes often strongly convex to almost cylindrical Lobothallia alphoplaca
– Thallus closely attached to the substratum. Central areoles plane to convex or uneven, not bullate. Lobes plane to moderately convex 10
10 Lobes 1–2 mm long, closely attached, not overlapping. Upper surface grey, sometimes tinted ochraceous or rosy. Apothecia with thick thalline margin, 0.2–0.5 mm wide. On calcareous rocks Lobothallia crassimarginata
– Lobes 3–6 mm long, loosely attached, overlapping. Upper surface green grey to orange brown. Apothecia with narrower thalline margin (less than 0.3 mm wide). On siliceous rocks Lobothallia praeradiosa
11 Thallus brown, lobes strongly convex, simple to dichotomous, with straight and parallel margins Lobothallia hedinii
– Thallus whitish-grey to brownish-grey or grey, lobes flat or moderately convex 12
12 Lobes flat, 1–3 mm long. Constictic acid present Lobothallia pruinosa
– Lobes moderately convex, 3–5 mm long, with darkened tips. Constictic acid absent Lobothallia radiosa

Acknowledgements

The authors thank Dr. Lulu Zhang from Shandong Normal University and the curator Dr. Xinyu Wang of KUN-L for loaning specimens and permitting DNA extraction. We thank Dr. Fiona Ruth Worthy from Kunming Institute of Botany, CAS, for English-language revision.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was funded by the Anhui Provincial Education Department (no. 2022AH050207), the Second Tibetan Plateau Scientific Expedition and Research Program (STEP) (no. 2019QZKK0503), the National Training Program of Innovation and Entrepreneurship for Undergraduates from Anhui Normal University (S202310370581) and the Yunnan Fundamental Research Project (202401AT070196).

Author contributions

Yanyun Zhang performed specimen collection, data analysis, draft writing and provided funding; Lun Wang performed experimental work, data analysis and draft writing; Xinmeng Yu, Su Cheng and Junlan Liu conducted part of the molecular and chemical experiments. Xinyu Wang designed the project and supervised this research, revised the manuscript and provided funding.

Author ORCIDs

Yanyun Zhang https://orcid.org/0000-0002-0902-5066

Xinyu Wang https://orcid.org/0000-0003-2166-6111

Data availability

All of the data that support the findings of this study are available in the main text.

References

  • Ashraf A, Habib K, Khalid AN (2022) A new pruinose lichen species in genus Lobothallia (Megasporaceae, lichen forming Ascomycota) from Pakistan. Acta Botanica Brasilica 36: e2021abb0225.
  • Cannon P, Nordin A, Coppins B, Aptroot A, Sanderson N, Simkin J (2023) Pertusariales: Megasporaceae, including the genera Aspicilia, Aspiciliella, Circinaria, Lobothallia, Megaspora and Sagedia. Revisions of British and Irish Lichens 34: 1–15.
  • Clauzade G, Roux C (1984) Les genres Aspicilia Massal. et Bellemerea Hafellner et Roux. Bulletin de la Société Botanique de Centre-Ouest, Nouvelle Série 15: 127–141.
  • Clauzade G, Vězda A (1970) Lecanora cernohorskyana Clauzade et Vězda sp. n. Preslia 42: 215–219.
  • Hafellner J (1991) Die Gattung Aspicilia, ihre Ableitungen nebst Bemerkungen über cryptolecanorine Ascocarporganisation bei anderen Genera der Lecanorales (Ascomycetes lichenisati). Acta Botanica Malacitana 16: 133–140. https://doi.org/10.24310/abm.v16i.9153
  • Kondratyuk SY, Gromakova AB, Khodosovtsev AY, Kim JA, Kondratiuk AS, Hur J-S (2015) Agrestia zerovii (Megasporaceae, Lichen-forming ascomycetes), a new species from South Eastern Europe proved by alternative phylogenetic analysis. Studia Botanica Hungarica 46(2): 69–94. https://doi.org/10.17110/StudBot.2015.46.2.69
  • Kondratyuk SY, Upreti DK, Mishra GK, Nayaka S, Ingle KK, Orlov OO, Kondratiuk AS, Lőkös L, Farkas E, Woo JJ, Hur JS (2020) New and noteworthy lichen-forming and lichenicolous fungi 10. Acta Botanica Hungarica 62(1–2): 81–84. https://doi.org/10.1556/034.62.2020.1-2.6
  • Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. https://doi.org/10.1093/molbev/msw260
  • Larena I, Salazar O, González V, Julián MC, Rubio V (1999) Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for Ascomycetes. Journal of Biotechnology 75(2–3): 187–194. https://doi.org/10.1016/S0168-1656(99)00154-6
  • Li L, Zhang Y, Printzen C (2023) Phylogeny, morphology and chemistry reveal two new multispored species in the Lecanora subfusca group (Lecanoraceae, Ascomycota). MycoKeys 99: 27–28. https://doi.org/10.3897/mycokeys.99.108462
  • Magnusson AH (1940) Lichens from central Asia I. In reports from the scientific expedition to the NorthWestern Provinces of China under the leadership of Dr. Sven Hedin (the Sino-Swedish expedition). Publication 13, XI. Botany: 98–99. [Stockholm: Aktiebolaget Thule.]
  • Magnusson AH (1944) Lichens from central Asia II. In reports from the scientific expedition to the NorthWestern Provinces of China under the leadership of Dr. Sven Hedin (the Sino-Swedish expedition). Publication 22, XI. Botany: 40–41. [Stockholm: Aktiebolaget Thule.]
  • Martellos S, Conti M, Nimis PL (2023) Aggregation of Italian lichen data in ITALIC 7.0. Journal of Fungi (Basel, Switzerland) 9(5): 556. https://doi.org/10.3390/jof9050556
  • Müller J (1880) Enumeration lichenum Aegyptiacum. Revue mycologique, Toulouse 2(2): 75.
  • Nascimbene J, Nimis PL, Klüßendorf J, Thüs H (2023) Freshwater lichens, including new species in the genera Verrucaria, Placopyrenium and Circinaria, associated with Lobothallia hydrocharis (Poelt & Nimis) Sohrabi & Nimis from Watercourses of Sardinia. Journal of Fungi (Basel, Switzerland) 9(3): 380. https://doi.org/10.3390/jof9030380
  • Nimis PL (2016) The lichens of Italy, A second annotated catalogue. EUT-Edizioni Università di Trieste, Trieste, 288–290.
  • Nimis PL, Poelt J (1987) The lichens and lichenicolous fungi of Sardinia (Italy). Studia Geobotanica 7: 44–45.
  • Nordin A, Savić S, Tibell L (2010) Phylogeny and taxonomy of Aspicilia and Megasporaceae. Mycologia 102(6): 1339–1349. https://doi.org/10.3852/09-266
  • Orange A, James PW, White FJ (2001) Microchemical methods for the identification of lichens. British Lichen Society, London.
  • Owe-Larsson B, Nordin A, Tibell L, Sohrabi M (2011) Circinaria arida sp. nova and the ‘Aspicilia desertorum’ complex. Bibliotheca Lichenologica 106: 235–246.
  • Paukov AG, Davydov EA, Nordin A, Roux C, Şenkardeşler A, Sohrabi M, Vondrák J, Frolov IV, Teptina AY, Shiryaeva AS (2019) Three new species, new combinations and a key to known species of Lobothallia (Megasporaceae). Lichenologist (London, England) 51(4): 301–322. https://doi.org/10.1017/S0024282919000264
  • Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA (2018) Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology 67(5): 901–904. https://doi.org/10.1093/sysbio/syy032
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model selection across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Roux C (1977) Aspicilia chadefaudiana Cl. Roux, sp. nov. et remarques sur le genre Aspicilia. Revue Bryologique et Lichénologique 43(2): 159–172(57–70).
  • Roux C, Nordin A, Tibell L, Sohrabi M (2011) Some poorly known or new Aspicilia species from Pyrenees-Orientales (France). Bulletin de la Société Linnéenne de Provence 14: 177–227.
  • Roux C, Nordin A, Bertrand M (2016) Lobothallia controversa Cl. Roux & A. Nordin sp. nov., correspondant au Lecanora farinosa sensu Nyl. non (Flörke) Nyl. Herzogia 29(2): 586–595. https://doi.org/10.13158/heia.29.2.2016.586
  • Ryan BD (2004) Lobothallia. In: Nash III TH, Ryan BD, Diederich P, Gries C, Bungartz F (Eds) Lichen Flora of the Greater Sonoran Desert Region, Vol. II. Lichens Unlimited, Arizona State University, Tempe, Arizona, 352–357.
  • Sipman HJ, Aptroot A (2020) Ikaeria serusiauxii, a new Caloplaca-like lichen from Macaronesia and mainland Portugal, with a lichen checklist for Porto Santo. Plant and Fungal Systematics 65(1): 126. https://doi.org/10.35535/pfsyst-2020-0006
  • Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27(2): 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
  • Valadbeigi T, Nordin A, Tibell L (2011) Megaspora rimisorediata (Pertusariales, Megasporaceae), a new sorediate species from Iran and its affinities with Aspicilia sensu lato. Lichenologist (London, England) 43(4): 285–291. https://doi.org/10.1017/S0024282911000211
  • Wei JC (2020) The Enumeration of Lichenized Fungi in China. China Forestry Publishing House, Beijing, 134–135.
  • Zhang YY, Wang XY, Li LJ, Printzen C, Timdal E, Niu DL, Yin AC, Wang SQ, Wang LS (2020) Squamarina (lichenised fungi) species described from China belong to at least three unrelated genera. MycoKeys 66: 135–157. https://doi.org/10.3897/mycokeys.66.39057
  • Zoller S, Scheidegger C, Sperisen C (1999) PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming ascomycetes. Lichenologist (London, England) 31(5): 511–516. https://doi.org/10.1006/lich.1999.0220
  • Zulfiqar R, Razzaq F, Afshan NUS, Fayyaz I, Habib K, Khalid AN, Paukov AG (2022) Three new species of Lobothallia (Megasporaceae, Pertusariales, Ascomycota) from Pakistan and a new combination in the genus. Mycological Progress 21(9): 80. https://doi.org/10.1007/s11557-022-01830-z

1Yanyun Zhang and Lun Wang contributed equally to this work.
login to comment