Phylogeny and taxonomy of two new species in Dictyosporiaceae (Pleosporales, Dothideomycetes) from Guizhou, China

Yao Feng; Zuo-Yi Liu; Xiao-Fang Chen; Mi-Lian Yang; Zhi-Yuan Zhang; Ya-Ya Chen

doi:10.3897/mycokeys.106.125693

Abstract

Two novel species within the family Dictyosporiaceae are described and illustrated from terrestrial habitats on dead culms of bamboo and an unidentified plant, respectively. Through morphological comparisons and the multi-locus phylogenetic analyses of combined LSU, ITS, SSU, and tef1-α sequence dataset, two species, Gregarithecium bambusicola, Pseudocoleophoma paraphysoidea are identified. Phylogenetically, both species clustered into a monophyletic clade with strong bootstrap support. Gregarithecium bambusicola sp. nov. can be distinguished from other species within the genus based on its almost straight ascospores. Pseudocoleophoma paraphysoidea sp. nov. differs from other species in its conidiogenous cells intermixed with paraphyses, longer conidiogenous cells and larger conidia. The identification of this lineage contributes to our understanding of the classification of Dictyosporiaceae.

Key words

2 new species, Gregarithecium, multi-locus, new taxa, Pseudocoleophoma, taxonomy

Introduction

Boonmee et al. (2016) established the family Dictyosporiaceae, with the type genus Dictyosporium, based on morphology and multi-locus phylogenetic analysis. Members of Dictyosporiaceae are mostly saprobic, globally distributed and commonly found in terrestrial and aquatic habitats (Boonmee et al. 2016, 2021). The main diagnostic criteria of Dictyosporiaceae are immersed to erumpent or superficial, subglobose to globose, dark brown to black ascomata, bitunicate asci with septate, hyaline, sheathed ascospores; the asexual morphs are cheirosporous hyphomycetes (Boonmee et al. 2016; Tennakoon et al. 2019; Hongsanan et al. 2020). Currently, Dictyosporiaceae comprises 18 genera (Hongsanan et al. 2020; Tian et al. 2022; Wijayawardene et al. 2022).

Tanaka et al. (2015) erected the genus Gregarithecium and Pseudocoleophoma within Dictyosporiaceae, with Gregarithecium curvisporum and Pseudocoleophoma calamagrostidis as the type species, respectively. Gregarithecium is characterized by immersed to erumpent, grouped ascomata with fissitunicate, cylindrical, short-stalked asci, broadly fusiform, hyaline ascospore with a median septum, surrounded by an entire sheath (Tanaka et al. 2015; Tennakoon et al. 2019; Lu et al. 2022). Pseudocoleophoma is characterized by ostiolar ascomata; brown and polygonal to rectangular cells of peridium; cylindrical to clavate and fissitunicate asci with numerous pseudoparaphyses; fusiform, and septate ascospores, with an apparent sheath (Tanaka et al. 2015; Lu et al. 2022). The asexual morph of Pseudocoleophoma is pycnidial, which is characterized by subglobose conidiomata, doliiform and phialidic conidiogenous cells, and cylindrical or oblong, hyaline, aseptate, smooth-walled conidia (Jiang et al. 2021). Currently, only one species is accepted in the genus Gregarithecium, while Pseudocoleophoma has 13 records listed in Index Fungorum.

In this study, we introduce two new taxa (Gregarithecium bambusicola and Pseudocoleophoma paraphysoidea) belonging to Dictyosporiaceae, collected from landscape plants in Guizhou Province, China. Morphological observations and phylogenetic analyses were conducted to clarify the classification of these species and their evolutionary relationships with closely related species. Detailed descriptions of the morphological features of these species along with their molecular characterization are provided.

Materials and methods

Sample collection, Fungal isolation and morphological studies

Fresh fungal specimens were collected in Guizhou Province, China. The specimens were examined by using a stereomicroscope (Motic SMZ 168). Freehand sections of ascomata and other fungal structures were photographed using a Nikon ECLIPSE Ni compound microscope fitted with a Nikon DS-Ri2 digital camera. Measurements for all structural components were made with Tarosoft Image FrameWork software (IFW 0.97 version) (Liu et al. 2010). Single spore isolations were carried out following the approaches in Chomnunti et al. (2014). Type specimens were deposited in the herbarium of Guizhou Academy of Agriculture sciences (GZAAS), Guiyang, China. All living cultures were stored in a metabolically inactive state (i.e., kept in sterile 30% glycerol in a –80 °C freezer), which were deposited in Guizhou Culture Collection (GZCC), Guiyang, China. Facesoffungi (http://www.facesoffungi.org/) numbers were obtained as in Jayasiri et al. (2015). The new species are registered in Index Fungorum (2024, http://www.indexfungorum.org/).

DNA extraction, PCR amplification and sequencing

Fungal mycelia were scraped with a surgical knife from the pure culture which was growing on potato dextrose agar (PDA) for one week at 25 °C in dark. The total genomic DNA was conducted by using Ezup Column Fungi Genomic DNA Purification Kit (Sangon Biotech, China) from fresh fungal mycelia. Four gene regions, internal transcribed spacer (ITS), large subunit rDNA (LSU), small subunit rDNA (SSU) and the translation elongation factor 1-alpha (tef1-α) were amplified and sequenced using primers listed in Table 1. Polymerase chain reaction (PCR) was carried out in a 25 μL reaction volume, which contained 12.5 μL 2 × PCR Master Mix (Sangon Biotech, China), 8.5 μL ddH₂O, 1 μL of each primer and 2 μL DNA template. The amplification conditions for all four loci consisted of initial denaturation at 95 °C for 5 min; followed by 35 cycles of 1 min at 94 °C, 1 min at 52 °C, and 1.5 min at 72 °C, and a final extension period of 10 min at 72 °C. PCR products were analyzed using 1.2% agarose electrophoresis gel stained with ethidium bromide and sequenced by Sangon Biotech (Shanghai) Co., Ltd, China. New generated nucleotide sequences were submitted in GenBank (Table 2).

Table 1.

Download as

CSV

XLSX

Sequences of primers used in this study.

Molecular marker	Primer name	Primer sequence (5´–3´)	Reference
SSU	NS1	GTAGTCATATGCTTGTCTC	White et al. 1990
SSU	NS4	CTTCCGTCAATTCCTTTAAG	White et al. 1990
ITS	ITS1 (Gregarithecium)	TCCGTAGGTGAACCTGCG	White et al. 1990
	ITS4	TCCTCCGCTTATTGATATGC	White et al. 1990
	ITS5 (Pseudocoleophoma)	GGAAGTAAAAGTCGTAACAAGG	White et al. 1990
LSU	LR5	ATCCTGAGGGAAACTTC	Vilgalys and Hester 1990
LSU	LR0R	ACCCGCTGAACTTAAGC	Vilgalys and Hester 1990
tef1-α	983F	GCYCCYGGHCAYCGTGAYTTYAT	Rehner and Buckley 2005
tef1-α	2218R	ATGACACCRACRGCRACRGTYTG	Rehner and Buckley 2005

Table 2.

Download as

CSV

XLSX

GenBank accession numbers of the sequences used in this study.

Taxa	Voucher/Culture	GenBank accession numbers
Taxa	Voucher/Culture	LSU	ITS	SSU	tef1-α
Aquadictyospora clematidis	MFLUCC 17-2080	MT214545	MT310592	MT226664	MT394727
Aquadictyospora lignicola	MFLUCC 17-1318 T	MF948629	MF948621	–	MF953164
Aquaticheirospora lignicola	HKUCC 10304	AY736378	AY864770	AY736377	–
Cheirosporium triseriale	HMAS 180703 T	EU413954	EU413953	–	–
Dendryphiella fasciculata	MFLUCC 17-1074 T	MF399214	MF399213	–	–
Dendryphiella paravinosa	CBS 141286 T	KX228309	KX228257	–	–
Dictyocheirospora bannica	KH 332	AB807513	LC014543	–	AB808489
Dictyocheirospora pseudomusae	yone 234	AB807520	LC014550	AB797230	AB808496
Dictyocheirospora rotunda	MFLUCC 14-0293 T	KU179100	KU179099	KU179101	–
Dictyosporium appendiculatum	KUMCC 17-0311	MH376715	MH388343	–	–
Dictyosporium digitatum	KUMCC 17-0269	MH376716	MH388344	MH388311	MH388378
Dictyosporium guttulatum	KUMCC 17-0288	MH376717	MH388345	MH388312	MH388379
Dictyosporium hongkongensis	KUMCC 17-0268	MH376718	MH388346	MH388313	MH388380
Digitodesmium chiangmaiense	KUN-HKAS 102163	MK571766	–	MK571775	–
Digitodesmium polybrachiatum	CoAD 3175	MW879317	MW879319	MW879326	–
Digitodesmium polybrachiatum	COAD 3174	MW879316	MW879318	MW879325	–
*Gregarithecium bambusicola*	GZCC 21-0713 T	PP639379	PP639375	PP661224	PP624323
*Gregarithecium bambusicola*	GZCC 21-1120	PP639380	PP639376	PP661225	PP624324
Gregarithecium curvisporum	KT 922 T	AB807547	AB809644	AB797257	AB808523
Immotthia bambusae	KUNHKAS 112012 T	MW489450	MW489455	MW489461	MW504646
Jalapriya pulchra	MFLUCC 15-0348 T	KU179109	KU179108	KU179110	–
Jalapriya pulchra	MFLUCC 17-1683	MF948636	MF948628	–	MF953171
Murilentithecium clematidis	MFLUCC 14-0561	KM408758	KM408756	–	KM454444
Murilentithecium clematidis	MFLUCC 14-0562 T	KM408759	KM408757	NG_061185	KM454445
Neodendryphiella mali	CBS 139.95 T	LT906657	LT906655	–	–
Neodigitodesmium cheirosporum	UESTCC 22.0020	ON595713	ON595714	ON595712	ON595700
Pseudocoleophoma bauhiniae	MFLUCC 17-2580	MK347952	MK347735	MK347843	MK360075
Pseudocoleophoma bauhiniae	MFLUCC 17-2586 T	MK347953	MK347736	MK347844	MK360076
Pseudocoleophoma calamagrostidis	KT 3284 T	LC014609	LC014592	LC014604	LC014614
Pseudocoleophoma clematidis	MFLUCC 17-2177 T	NG_073844	MT310596	MT226667	MT394730
Pseudocoleophoma flavescens	CBS 178.93	GU238075	–	GU238216	–
Pseudocoleophoma guizhouensis	MFLU 18-2262	OP099522	OR225073	OR134444	OR140434
Pseudocoleophoma heteropanacicola	ZHKUCC 23-0880 T	OR365486	OR365486	–	OR700204
*Pseudocoleophoma paraphysoidea*	GZCC 21-0711 T	PP639377	PP639373	PP661222	PP624321
*Pseudocoleophoma paraphysoidea*	GZCC 21-0712	PP639378	PP639374	PP661223	PP624322
Pseudocoleophoma polygonicola	KT 731 T	AB807546	AB809634	AB797256	–
Pseudocoleophoma puerensis	ZHKUCC 22-0204 T	OP297769	OP297799	OP297783	OP321568
Pseudocoleophoma puerensis	ZHKUCC 22-0205	OP297770	OP297800	OP297784	OP321569
Pseudocoleophoma rhapidis	ZHKUCC 21-0124 T	ON244661	ON244664	ON244667	–
Pseudocoleophoma rusci	MFLU 16-0292	MT183514	MT185549	MT214983	–
Pseudocoleophoma rusci	MFLUCC 16-1444 T	NG_073840	NR_170045	NG_070346	–
Pseudocoleophoma typhicola	MFLUCC 16-0123 T	KX576656	KX576655	–	–
Pseudocoleophoma yunnanensis	ZHKUCC 22-0200 T	OP297765	OP297795	OP297779	OP321564
Pseudocoleophoma yunnanensis	ZHKUCC 22-0201	OP297766	OP297796	OP297780	OP321565
Pseudocoleophoma zingiberacearum	NCYUCC 19-0054 T	MN616755	MN615941	–	MN629283
Pseudoconiothyrium broussonetiae	CPC 33570	NG_066331	NR_163377	–	–
Pseudodictyosporium thailandica	MFLUCC 16-0029 T	KX259522	KX259520	–	KX259526
Pseudodictyosporium wauense	NBRC 30078	DQ018105	DQ018098	–	–
Pseudodictyosporium wauense	DLUCC 0801	MF948630	MF948622	–	MF953165
Verrucoccum coppinsii	SPO 2343	MT918765	MT918780	MT918773	–
Verrucoccum hymeniicola	CBS 845.96	AB807567	LC014586	AB797277	AB808543
Vikalpa australiensis	HKUCC 8797 T	–	DQ018092	–	–

Phylogenetic analyses

Phylogenetic analyses of Dictyosporiaceae were performed based on ITS, LSU, SSU, and tef1-α sequence data. The representative taxa of Dictyosporiaceae (Table 2) were referred to BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) result and relevant publications (Lu et al. 2022; Tian et al. 2022). Sequences were aligned using MAFFT v. 7 (Katoh and Standley 2013). Manual adjustments were performed when it is necessary using BioEdit v. 7.0 (Hall 1999). Phylogenetic analyses of maximum likelihood (ML) and Bayesian inference (BI) were conducted based on combined datasets.

ML analysis was performed with raxmlGUI v. 1.3 (Silvestro and Michalak 2012) and the topology was evaluated using 1,000 ultrafast bootstrap replicates. The phylogenetic analyses were performed for Bayesian inference in MrBayes 3.2.6. The model of evolution was estimated by ModelTest 2. The Markov chain Monte Carlo (MCMC) sampling in MrBayes 3.2.6 was used to determine the posterior probabilities (PP). Every 100^th generation was sampled as a tree with 1,000,000 generations running for six MCMC chains (Huelsenbeck and Ronquist 2001; Zhaxybayeva and Gogarten 2002; Nylander 2004). Phylogenetic trees were viewed with FigTree v1.4.2 (Rambaut 2012) and edited using Adobe Illustrator 2021 (2.6.0.44) and Adobe Photoshop CS6 software (Adobe Systems, USA).

Results

Phylogenetic analyses

To determine the phylogenetic placement of the new taxa within the family Dictyosporiaceae, a dataset consisting of combined LSU, ITS, SSU, and tef1-α sequences was analyzed, including a total of 52 taxa. Murilentithecium clematidis (MFLUCC 14-0561 and MFLUCC 14-0562) was used as the outgroup taxa for the analysis. The concatenated alignment comprises 3,376 characters (LSU: 1–803; ITS: 804–1,340; SSU: 1,341–2,338; tef1-α: 2,339–3,376) including gaps. Maximum likelihood and Bayesian analyses were performed, respectively, and presented consistent topologies. Bayesian posterior probabilities were calculated with a final average standard deviation of split frequencies of less than 0.01. The best scoring RAxML tree (Fig. 1) was built with a final likelihood value of -18784.512555. Estimated base frequencies were as follows: A = 0.236875, C = 0.246782, G = 0.270789, T = 0.245554; substitution rates AC = 1.688035, AG = 3.527408, AT = 2.540885, CG = 1.033994, CT = 9.137618, GT = 1.000000. The gamma distribution shape parameter alpha is equal to 0.178657 and the Tree-Length equal to 2.160218.

Figure 1.

Phylogram based on the maximum likelihood (ML) analysis using the LSU, ITS, SSU, and tef1-α sequences of Dictyosporiaceae. Bootstrap support values for ML equal to or greater than 75% and the Bayesian posterior probabilities equal to or higher than 0.95 PP are indicated above the nodes as ML/PP. Ex-type strains are in black bold and the new taxa are highlighted in bold and red.

Taxonomy

Gregarithecium bambusicola Y. Feng & Z. Y. Liu, sp. nov.

Index Fungorum: IF901991

Facesoffungi Number: FoF15871

Fig. 2

Etymology

The epithet refers to the species inhabiting on bamboo.

Holotype

GZAAS 21-0199.

Diagnosis

Saprobic on dead bamboo culms, the surface of the host has a withered spot with a central protrusion. Sexual morph: Ascomata 386–658 × 129–237 μm (av. 487 × 169 μm, n= 10), scattered to gregarious, immersed with only ostiolar necks visible on the host surface or erumpent, globose to hemispherical with flattened base in section. Peridium composed of several layers of hyaline to dark brown cells of textura angularis. Hamathecium comprising dense, hyaline, branched and anastomosed, septate pseudoparaphyses. Asci 75–104 µm × 17–26 µm (av. 91 × 20 μm, n = 10), 8- spored, cylindrical, fissitunicate, rounded at the apex with a shallow ocular chamber, small stalk at the base. Ascospores 25–27 × 5–7 μm (av. 26 × 6 μm, n = 10), biseriate, fusiform, hyaline, mostly straight, septum and constricted, smooth, guttulate, with a distinct gelatinous sheath. Asexual morph: undetermined.

Figure 2.

Morphology of Gregarithecium bambusicola (GZAAS 21-0199, holotype) A, B appearance of ascomata on host C vertical section of ascoma D peridium E pseudoparaphyses F–I asci J–M ascospores. Scale bars: 50 μm (C); 30 μm (D); 20 μm (F–I); 10 μm (E, J−M).

Culture characteristics

Ascospores germinating on WA within 12 h. Colonies slow growing on PDA at 25 °C, reaching 2 cm diam. in 1 week at 25 °C. Colonies irregular circular, entire edge, white, off-white in reverse.

Material examined

China, Guizhou Province, Xingyi City, on dead culms of bamboo, 2 May 2019, Yao Feng, XY-40 (holotype GZAAS 21-0401, ex-type living culture GZCC 21-1120), ibid., XY-40b (isotype GZAAS21-0401, living culture GZCC21-1120).

Notes

The genus Gregarithecium comprises a single species, G. curvisporum, which was collected from the culms of Sasa sp. (Tanaka et al. 2015). In this study, two new strains clustered in a single clade with high support value (98/1.00), and were closely related to G. curvisporum (Fig. 1). Gregarithecium bambusicola resembles the type species in having cylindrical asci and transparent fusiform, guttulate ascospores surrounded by an entire sheath (Tanaka et al. 2015). However, unlike the curved ascospores observed in G. curvisporum, G. bambusicola has predominantly straight ascospores (Tanaka et al. 2015). Furthermore, the ascospores of G. curvisporum have three septa after maturation, which is not seen in G. bambusicola (Tanaka et al. 2015). In addition, they can be distinguished by their low sequence similarities. In a comparison of LSU, ITS, SSU, and tef1-α nucleotides, G. bambusicola (Type strain GZCC 21-0713) has 98%, 87%, 99% and 94% similarity, in LSU (782/800 bp, 2 gaps), ITS (420/484 bp, 5 gaps), SSU (527/534 bp, no gap), and tef1-α (780/834 bp, no gap), which is different from G. curvisporum (Type strain KT 922).

Pseudocoleophoma paraphysoidea Y. Feng & Z. Y. Liu, sp. nov.

Index Fungorum: IF901990

Facesoffungi Number: FoF15872

Fig. 3

Etymology

The epithet refers to the species having paraphyses.

Holotype

GZAAS 21-0197.

Diagnosis

Saprobic on decaying wood in terrestrial habitats, and immersed in host epidermis. At maturity, the fruiting body breaks through host epidermis. Sexual morph: undetermined. Asexual morph: Conidiomata dark brown to black, pycnidial, solitary to gregarious, globose to subglobose, apapillate, ostiolate. Conidiomatal wall comprising several layers of cells of textura angularis, with inner layers comprising hyaline to dark brown and outer layers composed of dark brown to black cells. Conidiogenous cells 11–27 × 3–5 μm (av. 21 × 4 μm, n = 20), hyaline, enteroblastic, phialidic, with minute collarette, doliiform, ampulliform, arising from the innermost layer of the pycnidial wall, intermixed with hyaline, filamentous, septate paraphyses. Conidia 12–15 (−23) × 2–4 μm (av. 14 × 3 μm, n = 30), hyaline, smooth, cylindrical to subcylindrical or fusiform, straight or slightly curved, aseptate, guttulate at both ends.

Culture characteristics

Conidia germinating on WA within 12 h and germ tubes produced from the basal end. After transfer to the PDA, the colonies grew rapidly, reaching 5 cm diam. in 1 week at 25 °C. Part of the mycelia grew on the surface of the medium, compact, violet, with a light-colored rim, and part of the mycelia remained immersed in the medium. The central area of the colony on the back was reddish-brown, the middle white, and the edge light-colored.

Figure 3.

Morphology of Pseudocoleophoma paraphysoidea (GZAAS 21-0197, holotype) A, B appearance of pycnidia on host C peridium D germinating conidium E paraphyses F, G culture H, I conidiogenous cells and conidia J–M conidia. Scale bars: 20 μm (C); 10 μm (D, H, I); 5 μm (J–M).

Material examined

China, Guizhou Province, Guiyang City, Guizhou Academy of Agricultural Sciences, on dead culms of an unidentified plant, 18 June 2018, Zuo-Peng Liu, NK-1 (holotype GZAAS 21-0197, ex-type living culture GZCC 21-0711). China, Guizhou Province, Xingyi City, on dead culms of an unidentified plant, 7 August 2019, Yao Feng XY19-13 (paratype GZAAS 21-0198, living culture GZCC 21-0712).

Notes

The multi-locus phylogenetic analyses showed that the new isolates GZCC 21-0711 and GZCC 21-0711 (Pseudocoleophoma paraphysoidea) formed a single clade and clustered together with high support value 81/0.94 (Fig. 1). Pseudocoleophoma paraphysoidea differs from P. bauhiniae in its conidiogenous cells intermixed with paraphyses, longer conidiogenous cells (11–27 × 3–5 μm vs. 2.5–5.5 × 2–3 µm) and larger conidia (12–15 × 2–4 μm vs. 7.5–11 × 2–3 µm) (Jayasiri et al. 2019). In addition, they can be distinguished by their low sequence similarities. In a comparison of LSU, ITS, SSU, and tef1-α nucleotides, P. paraphysoidea (type strain GZCC 21-0711) has 99%, 97%, 99% and 93% similarity, in LSU (789/795 bp, no gap), ITS (490/503 bp, 2 gaps), SSU (1008/1010 bp, one gap), and tef1-α (815/878 bp, no gap), which is different from P. bauhiniae (Type strain MLFUCC 17-2586).

Key to the genus Pseudocoleophoma

1	Asexual and sexual morph produced	2
–	Asexual or sexual morph produced	3
2	Ascospores 1-septate, with sheath	4
–	Ascospores 1–3-septate, without sheath	*P. bauhiniae*
3	Asexual morph produced	5
–	Sexual morph produced	6
4	Ascomata 160–220 × 140–200 µm, scattered	*P. calamagrostidis*
–	Ascomata 280–350 × 230–310 µm, scattered to 2–4-gregarious	*P. polygonicola*
5	Conidia aseptate	7
–	Conidia 1-euseptate	*P. typhicola*
6	Ascospores fusiform	8
–	Ascospores narrowly ellipsoid or oblong	*P. puerensis*
7	Conidiomata ostiolate	9
–	Conidiomata apapillate, ostiole	10
8	Ascospores 1-septate	11
–	Ascospores 3-septate	*P. heteropanacicola*
9	Conidia 20–25 × 10–15 µm, oblong to obovoid	*P. rhapidis*
–	Conidia 8–14 × 3–6 µm, cylindrical to subcylindrical or fusiform	*P. rusci*
10	Conidiomata solitary to gregarious	12
–	Conidiomata solitary	*P. zingiberacearum*
11	Ascomata gregarious, scattered; Asci clavate	*P. guizhouensis*
–	Ascomata solitary or scattered; Asci clavate to cylindrical, fissitunicate	*P. yunnanensis*
12	Conidiogenous cells globose to doliiform; conidia ellipsoidal *P. flavescens*
–	Conidiogenous cells doliiform, ampulliform; conidia cylindrical to subcylindrical or fusiform	*P. paraphysoidea*

Discussion

In this study, Gregarithecium bambusicola and Pseudocoleophoma paraphysoidea are described as two new species in Dictyosporiaceae based on phylogenetic analysis and morphological features. The phylogenetic analysis revealed their distinct genetic relationships and their placement within the family Dictyosporiaceae. Dictyosporiaceae has a diverse species distribution in dead leaves of Alauraceous tree, leaves of Citrus sinensis, submerged wood, soil and other hosts. The discovery of the new species is of great significance to the species diversity, classification and geographical distribution of Dictyosporiaceae.

The genus Pseudocoleophoma has 13 species in Index Fungorum. Among these species, four species were described based on the sexual morph (viz. P. guizhouensis, P. heteropanacicola, P. puerensis, and P. yunnanensis), five species were based on asexual morph (viz. P. flavescens, P. typhicola, P. rhapidis, P. rusci, and P. zingiberacearum), only three species have been reported for both the holomorphs (viz. P. bauhiniae, P. calamagrostidis, and P. polygonicola) (Tanaka et al. 2015; Jayasiri et al. 2019; Jiang et al. 2021). Jiang et al. (2021) synonymized Pseudocoleophoma clematidis as Pseudocyclothyriella clematidis based on phylogenetic analysis, and transferred Immotthia from Teichosporaceae to Dictyosporiaceae.

In our phylogenetic analysis, Pseudocoleophoma was divided into three clades (Fig. 1). Clade I comprised ten species (including P. paraphysoidea), but with lower support in the phylogenetic tree. Clade II comprises two isolates (ZHKUCC 22-0205 and ZHKUCC 22-0204) of P. puerensis and closely related to Pseudoconiothyrium (Fig. 1). Furthermore, Clade III is composed of P. typhicola and P. guizhouensis (Fig. 1). The confusing relationship of these three clades to Immotthia, Verrucoccum, Pseudoconiothyrium, and Pseudocyclothyriella demonstrates that Pseudocoleophoma is polyphyletic, which are consistent with previous studies (Dong et al. 2023; Zhang et al. 2023).

Morphologically, the species in clade I had morphological features typical of Pseudocoleophoma. Clade II includes only one species, P. puerensis, which has been reported to have a sexual morphology that is distinct from members of Pseudocoleophoma due to its brown spores (Lu et al. 2022). Pseudocoleophoma typhicola in clade III is different from members of Pseudocoleophoma in its septate conidia (Hyde et al. 2016), but P. guizhouensis, a sister clade, has been reported as a sexual morph, which are consistent with Pseudocoleophoma. Further research is needed to elucidate the relationship among Pseudocoleophoma, Immotthia, Verrucoccum, Pseudoconiothyrium, and Pseudocyclothyriella.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was financially supported by the Science Research Youth Program in Colleges and Universities (Qiankeji [2022]153), the Foundation of Guizhou in University for Doctoral Research Start-up Project (GZMUZK[2024]QD49), the Bijie Technology Innovation Platform and talent Team (Bikehe [2023] No. 66), the Guizhou Provincial Science and Technology Projects (ZK[2024] 541) and the Funded Project of Guizhou Minzu University (No.GZMUZK[2022]YB16).

Author contributions

The individual contributions are as follows: Yao Feng, Zhi-Yuan Zhang and Ya-Ya Chen conceptualized the study, performed microscopical examinations of fungal specimens, wrote, edited, and reviewed the manuscript. Yao Feng and Zhi-Yuan Zhang conducted phylogenetic studies. Yao Feng wrote, reviewed, and edited the manuscript. Xiao-Fang Chen and Mi-Lian Yang prepared figures. Ya-Ya Chen and Zuo-Yi Liu reviewed the manuscript and provided funding. All authors have read and agreed to the published version of the manuscript.

Author ORCIDs

Yao Feng https://orcid.org/0000-0002-0888-8775

Zuo-Yi Liu https://orcid.org/0000-0001-5348-8458

Xiao-Fang Chen https://orcid.org/0009-0000-9962-7644

Mi-Lian Yang https://orcid.org/0000-0003-3511-3630

Zhi-Yuan Zhang https://orcid.org/0000-0003-2031-7518

Ya-Ya Chen https://orcid.org/0000-0002-8293-168X

Data availability

All of the data that support the findings of this study are available in the main text.

References

Boonmee S, D’souza MJ, Luo ZL, Pinruan U, Tanaka K, Su H, Bhat DJ, McKenzie EHC, Jones EBG, Taylor JE, Phillips AJL, Hirayama K, Eungwanichayapant PD, Hyde KD (2016) Dictyosporiaceae fam. nov. Fungal Diversity 80(1): 457–482. https://doi.org/10.1007/s13225-016-0363-z

Boonmee S, Wanasinghe DN, Calabon MS, Huanraluek N, Chandrasiri SKU, Jones GEB, Rossi W, Leonardi M, Singh SK, Rana S, Singh PN, Maurya DK, Lagashetti AC, Choudhary D, Dai YC, Zhao CL, Mu YH, Yuan HS, He SH, Phookamsak R, Jiang HB, Martín MP, Dueñas M, Telleria MT, Kałucka IL, Jagodziński AM, Liimatainen K, Pereira DS, Phillips AJL, Suwannarach N, Kumla J, Khuna S, Lumyong S, Potter TB, Shivas RG, Sparks AH, Vaghefi N, Abdel-Wahab MA, Abdel-Aziz FA, Li GJ, Lin WF, Singh U, Bhatt RP, Lee HB, Nguyen TTT, Kirk PM, Dutta AK, Acharya K, Sarma VV, Niranjan M, Rajeshkumar KC, Ashtekar N, Lad S, Wijayawardene NN, Bhat DJ, Xu RJ, Wijesinghe SN, Shen HW, Luo ZL, Zhang JY, Sysouphanthong P, Thongklang N, Bao DF, Aluthmuhandiram JVS, Abdollahzadeh J, Javadi A, Dovana F, Usman M, Khalid AN, Dissanayake AJ, Telagathoti A, Probst M, Peintner U, Garrido-Benavent I, Bóna L, Merényi Z, Boros L, Zoltán B, Stielow JB, Jiang N, Tian CM, Shams E, Dehghanizadeh F, Pordel A, Javan-Nikkhah M, Denchev TT, Denchev CM, Kemler M, Begerow D, Deng CY, Harrower E, Bozorov T, Kholmuradova T, Gafforov Y, Abdurazakov A, Xu JC, Mortimer PE, Ren GC, Jeewon R, Maharachchikumbura SSN, Phukhamsakda C, Mapook A, Hyde KD (2021) Fungal diversity notes 1387–1511: Taxonomic and phylogenetic contributions on genera and species of fungal taxa. Fungal Diversity 111(1): 1–335. https://doi.org/10.1007/s13225-021-00489-3

Chomnunti P, Hongsanan S, Aguirre-Hudson B, Tian Q, Peršohm D, Dhami MK, Alias AS, Xu JC, Liu XZ, Stadler M, Hyde KD (2014) The sooty moulds. Fungal Diversity 66(1): 1–36. https://doi.org/10.1007/s13225-014-0278-5

Dong W, Hyde KD, Jeewon R, Liao CF, Zhao HJ, Kularathnage ND, Li H, Yang YH, Pem D, Shu YX, Gafforov Y, Manawasinghe IS, Doilom M (2023) Mycosphere notes 449–468: Saprobic and endophytic fungi in China, Thailand, and Uzbekistan. Mycosphere: Journal of Fungal Biology 14(1): 2208–2262. https://doi.org/10.5943/mycosphere/14/1/26

Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.

Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Boonmee S, Lücking R, Bhat DJ, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang SH, Jones EBG, Phillips AJL, Manawasinghe IS, Tibpromma S, Jayasiri SC, Sandamali DS, Jayawardena RS, Wijayawardene NN, Ekanayaka AH, Jeewon R, Lu YZ, Dissanayake AJ, Zeng XY, Luo ZL, Tian Q, Phukhamsakda C, Thambugala KM, Dai DQ, Chethana KWT, Samarakoon MC, Ertz D, Bao DF, Doilom M, Liu JK, Pérez-Ortega S, Suija A, Senwanna C, Wijesinghe SN, Konta S, Niranjan M, Zhang SN, Ariyawansa HA, Jiang HB, Zhang JF, Norphanphoun C, de Silva NI, Thiyagaraja V, Zhang H, Bezerra JDP, Miranda-González R, Aptroot A, Kashiwadani H, Harishchandra D, Sérusiaux E, Aluthmuhandiram JVS, Abeywickrama PD, Devadatha B, Wu HX, Moon KH, Gueidan C, Schumm F, Bundhun D, Mapook A, Monkai J, Chomnunti P, Suetrong S, Chaiwan N, Dayarathne MC, Yang J, Rathnayaka AR, Bhunjun CS, Xu JC, Zheng JS, Liu G, Feng Y, Xie N (2020) Refined families of Dothideomycetes: Dothideomycetidae and Pleosporomycetidae. Mycosphere: Journal of Fungal Biology 11(1): 1553–2107. https://doi.org/10.5943/mycosphere/11/1/13

Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics (Oxford, England) 17(8): 754–755. https://doi.org/10.1093/bioinformatics/17.8.754

Hyde KD, Hongsanan S, Jeewon R, Bhat DJ, McKenzie EHC, Jones EBG, Phookamsak R, Ariyawansa HA, Boonmee S, Zhao Q, Abdel-Aziz FA, Abdel-Wahab MA, Banmai S, Chomnunti P, Cui BK, Daranagama DA, Das K, Dayarathne MC, de Silva NI, Dissanayake AJ, Doilom M, Ekanayaka AH, Gibertoni TB, Goes Neto A, Huang SK, Jayasiri SC, Jayawardena RS, Konta S, Lee HB, Li WJ, Lin CG, Liu JK, Lu YZ, Luo ZL, Manawasinghe IS, Manimohan P, Mapook A, Niskanen T, Norphanphoun C, Papizadeh M, Perera RH, Phukhamsakda C, Richter C, de Santiago ALCM, Drechsler-Santos ER, Senanayake IC, Tanaka K, Tennakoon TMDS, Thambugala KM, Tian Q, Tibpromma S, Thongbai B, Vizzini A, Wanasinghe DN, Wijayawardene NN, Wu HX, Yang J, Zeng XY, Zhang H, Zhang JF, Bulgakov TS, Camporesi E, Bahkali AH, Amoozegar MA, Araujo-Neta LS, Ammirati JF, Baghela A, Bhatt RP, Bojantchev D, Buyck B, de Silva GA, de Lima CLF, de Oliveira RJV, de Souza CAF, Dai YC, Dima B, Duong TT, Ercole E, Mafalda-Freire F, Ghosh A, Hashimoto A, Kamolhan S, Kang JC, Karunarathna SC, Kirk PM, Kytovuori I, Lantieri A, Liimatainen K, Liu ZY, Liu XZ, Lucking R, Medardi G, Mortimer PE, Nguyen TTT, Promputtha I, Raj KNA, Reck MA, Lumyong S, Shahzadeh-Fazeli SA, Stadler M, Soudi MR, Su HY, Takahashi T, Tangthirasunun N, Uniyal P, Wang Y, Wen TC, Xu JC, Zhang ZK, Zhao YC, Zhou JL, Zhu L (2016) Fungal diversity notes 367–490: Taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 80: 1–270. https://doi.org/10.1007/s13225-016-0373-x

Jayasiri SC, Hyde KD, Ariyawansa HA, Bhat DJ, Buyck B, Cai L, Dai YC, Abd-Elsalam KA, Ertz D, Hidayat I, Jeewon R, Jones EBG, Bahkali AH, Karunarathna SC, Liu JK, Luangsa-ard JJ, Lumbsch HT, Maharachchikumbura SSN, McKenzie EHC, Moncalvo JM, Ghobad-Nejhad M, Nilsson H, Pang K, Pereira OL, Phillips AJL, Raspé O, Rollins AW, Romero AI, Etayo J, Selçuk F, Stephenson SL, Suetrong S, Taylor JE, Tsui CKM, Vizzini A, Abdel-Wahab MA, Wen TC, Boonmee S, Dai DQ, Daranagama DA, Dissanayake AJ, Ekanayaka AH, Fryar SC, Hongsanan S, Jayawardena RS, Li WJ, Perera RH, Phookamsak R, De Silva NI, Thambugala KM, Tian Q, Wijayawardene NN, Zhao RL, Zhao Q, Kang JC, Promputtha I (2015) The Faces of Fungi database: Fungal names linked with morphology, phylogeny and human impacts. Fungal Diversity 74(1): 3–18. https://doi.org/10.1007/s13225-015-0351-8

Jayasiri SC, Hyde KD, Jones EBG, McKenzie EHC, Jeewon R, Phillips AJL, Bhat DJ, Wanasinghe DN, Liu JK, Lu YZ, Kang JC, Xu J, Karunarathna SC (2019) Diversity, morphology and molecular phylogeny of Dothideomycetes on decaying wild seed pods and fruits. Mycosphere: Journal of Fungal Biology 10(1): 1–186. https://doi.org/10.5943/mycosphere/10/1/1

Jiang HB, Jeewon R, Karunarathna SC, Phukhamsakda C, Doilom M, Kakumyan P, Suwannarach N, Phookamsak R, Lumyong S (2021) Reappraisal of Immotthia in Dictyosporiaceae, Pleosporales: Introducing Immotthia bambusae sp. nov. and Pseudocyclothyriella clematidis comb. et gen. nov. based on morphology and phylogeny. Frontiers in Microbiology 12: 656235. https://doi.org/10.3389/fmicb.2021.656235

Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010

Liu JK, Chomnunti P, Cai L, Phookamsak R, Chukeatirote E, Jones EBG, Moslem M, Hyde KD (2010) Phylogeny and morphology of Neodeightonia palmicola sp. nov. from palms. Sydowia 62(2): 261–276. https://doi.org/10.1016/j.riam.2010.07.001

Lu L, Karunarathna SC, Dai D-Q, Xiong Y-R, Suwannarach N, Stephenson SL, Elgorban AM, Al-Rejaie S, Jayawardena RS, Tibpromma S (2022) Description of four novel species in Pleosporales associated with coffee in Yunnan, China. Journal of Fungi (Basel, Switzerland) 8(10): 1113. https://doi.org/10.3390/jof8101113

Nylander JAA (2004) MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.

Rambaut A (2012) FigTree, version 1.4. 2. University of Edinburgh, Edinburgh.

Rehner SA, Buckley E (2005) A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97(1): 84–98. https://doi.org/10.3852/mycologia.97.1.84

Silvestro D, Michalak I (2012) raxmlGUI: A graphical front-end for RAxML. Organisms, Diversity & Evolution 12(4): 335–337. https://doi.org/10.1007/s13127-011-0056-0

Tanaka K, Hirayama K, Yonezawa H, Sato G, Toriyabe A, Kudo H, Hashimoto A, Matsumura M, Harada Y, Kurihara Y, Shirouzu T, Hosoya T (2015) Revision of the Massarineae (Pleosporales, Dothideomycetes). Studies in Mycology 82(1): 75–136. https://doi.org/10.1016/j.simyco.2015.10.002

Tennakoon D, Bhat D, Kuo C, Hyde KD (2019) Leaf litter saprobic Dictyosporiaceae (Pleosporales, Dothideomycetes): Pseudocoleophoma zingiberacearum sp. nov. from Hedychium coronarium. Kavaka 53: 1–7. https://doi.org/10.36460/Kavaka/53/2019/1-7

Tian WH, Chen YP, Sajeewa Maharachchikumbura S (2022) Neodigitodesmium, a novel genus of family Dictyosporiaceae from Sichuan Province, China. Phytotaxa 559(2): 176–184. https://doi.org/10.11646/phytotaxa.559.2.6

Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8): 4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990

White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR protocols: a guide to methods and applications, Academic Press, San Diego, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1

Wijayawardene N, Hyde KD, Dai D, Sánchez-García M, Goto B, Saxena R, Erdogdu M, Selçuk F, Rajeshkumar K, Aptroot A, Błaszkowski J, Boonyuen N, da Silva GA, de Souza FA, Dong W, Ertz D, Haelewaters D, Jones EBG, Karunarathna SC, Kirk PM, Kukwa M, Kumla J, Leontyev DV, Lumbsch HT, Maharachchikumbura SSN, Marguno F, Martínez-Rodríguez P, Mešić A, Monteiro JS, Oehl F, Pawłowska J, Pem D, Pfliegler WP, Phillips AJL, Pošta A, He MQ, Li JX, Raza M, Sruthi OP, Suetrong S, Suwannarach N, Tedersoo L, Thiyagaraja V, Tibpromma S, Tkalčec Z, Tokarev YS, Wanasinghe DN, Wijesundara DSA, Wimalaseana SDMK, Madrid H, Zhang GQ, Gao Y, Sánchez-Castro I, Tang LZ, Stadler M, Yurkov A, Thines M (2022) Outline of Fungi and fungus-like taxa – 2021. Mycosphere: Journal of Fungal Biology 13(1): 53–453. https://doi.org/10.5943/mycosphere/13/1/2

Zhang JF, Liu JK, Hyde KD, Chen YY, Ran HY, Liu ZY (2023) Ascomycetes from karst landscapes of Guizhou Province, China. Fungal Diversity 122(1): 1–160. https://doi.org/10.1007/s13225-023-00524-5

Zhaxybayeva O, Gogarten JP (2002) Bootstrap, Bayesian probability and maximum likelihood mapping: Exploring new tools for comparative genome analyses. BMC Genomics 3(1): 4. https://doi.org/10.1186/1471-2164-3-4

﻿Abstract

Key words

﻿Introduction

﻿Materials and methods

﻿Sample collection, Fungal isolation and morphological studies

﻿DNA extraction, PCR amplification and sequencing

﻿Phylogenetic analyses

﻿Results

﻿Phylogenetic analyses

﻿Taxonomy

﻿ Gregarithecium bambusicola Y. Feng & Z. Y. Liu, sp. nov.

Etymology

Holotype

Diagnosis

Culture characteristics

Material examined

Notes

﻿ Pseudocoleophoma paraphysoidea Y. Feng & Z. Y. Liu, sp. nov.

Etymology

Holotype

Diagnosis

Culture characteristics

Material examined

Notes

﻿Key to the genus Pseudocoleophoma

﻿Discussion

﻿Additional information

Conflict of interest

Ethical statement

Funding

Author contributions

Author ORCIDs

Data availability

﻿References

Abstract

Introduction

Materials and methods

Sample collection, Fungal isolation and morphological studies

DNA extraction, PCR amplification and sequencing

Phylogenetic analyses

Results

Phylogenetic analyses

Taxonomy

Gregarithecium bambusicola Y. Feng & Z. Y. Liu, sp. nov.

Pseudocoleophoma paraphysoidea Y. Feng & Z. Y. Liu, sp. nov.

Key to the genus Pseudocoleophoma

Discussion

Additional information

References