Research Article |
|
Corresponding author: Nalin N. Wijayawardene ( nalinwijayawardene@yahoo.com ) Corresponding author: Dong-Qin Dai ( cicidaidongqin@gmail.com ) Academic editor: Chitrabhanu Sharma Bhunjun
© 2024 Gui-Qing Zhang, Nalin N. Wijayawardene, Li-Hong Han, Jaturong Kumla, Nakarin Suwannarach, Qiang Li, Abdallah M. Elgorban, Ihab M. Moussa, Claudia Coleine, Dong-Qin Dai.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Zhang G-Q, Wijayawardene NN, Han L-H, Kumla J, Suwannarach N, Li Q, Elgorban AM, Moussa IM, Coleine C, Dai D-Q (2024) Three novel woody litter inhabiting fungi in Didymosphaeriaceae, Phaeoseptaceae and Synnemasporellaceae from Zhujiangyuan Nature Reserve, Yunnan Province, P.R. China. MycoKeys 106: 173-200. https://doi.org/10.3897/mycokeys.106.123105
|
Zhujiangyuan Nature Reserve, located in Qujing City, Yunnan Province, China, is reported with high fauna and floral diversity, while the fungal diversity of the region is poorly documented. During the summer season in 2023, decaying wood-inhabiting microfungi were collected from different microhabitats. The novel species were identified based on morphological characteristics and phylogenetic analyses (based on combined datasets of ITS, LSU, SSU, tef1-α, and rpb2 regions). Two species belong to Dothideomycetes (viz., Spegazzinia zhujiangyuanensis sp. nov. and Phaeoseptum zhujiangyuanense sp. nov. in Pleosporales) while the other one resides in Sordariomycetes (Synnemasporella fanii sp. nov. in Diaporthales). The results are in conformity with the earlier studies that predicted higher fungal diversity in this region.
Morpho-molecular, new fungal species, phylogeny, taxonomy, woody fungi
Fungi have a worldwide distribution and underpin nearly all life on the Earth (
The Zhujiangyuan Nature Reserve harbours abundant plant resources, with forest coverage of more than 95% and exceeding 1,000 species of plants (
Zhujiang is the third longest river in China, which covers about 450,000 km2, and flows through most cities in Southern China and a wide range of areas in Northern Vietnam (
During the summer of 2023 (July–September), we collected samples of microfungi associated with decaying wood litter in the North-east gate of Zhujiangyuan Nature Reserve. From the collected samples, we introduce three novel species belonging to Spegazzinia Sacc. (i.e. S. zhujiangyuanensis in Didymosphaeriaceae Munk, Pleosporales, Dothideomycetes O.E. Erikss. & Winka), Phaeoseptum Ying Zhang, J. Fourn. & K.D. Hyde (i.e. P. zhujiangyuanense in Phaeoseptaceae Boonmee, Thambugala & K.D. Hyde, Pleosporales, Dothideomycetes) and Synnemasporella X.L. Fan & J.D.P. Bezerra (i.e. S. fanii in Synnemasporellaceae X.L. Fan & J.D.P. Bezerra, Diaporthales Nannf., Sordariomycetes O.E. Erikss. & Winka) based on morpho-molecular analyses. The new taxa are provided with illustrations and morphological descriptions.
With prior permission of the management of Zhujiangyuan Nature Reserve, located in Qujing City, Yunnan Province, China, decaying wood litter samples were collected in the terrestrial habitats. The samples were stored in separate zip-lock plastic bags and transported to the microbiology laboratory of Qujing Normal University. Geographical information and sample information were recorded. Collections were maintained at room temperature (25 °C) and the samples were examined within 3–5 days.
Fruiting bodies were examined using a Leica S8AP0 stereomicroscope with an HDMI 200C camera (Leica Corporation, Germany). Micro-morphological characters were photographed using an Olympus BX53 compound microscope (Olympus Corporation, Japan) with differential interference contrast (Olympus BX53 DIC compound microscope with an Olympus DP74 camera, Japan). Ascomata and conidiomata were sectioned by hand using a razor blade to obtain thin sections (
Single spore isolation was performed to obtain pure cultures following the methods described in
Dried herbarium specimens and living cultures were preserved at the Mycological Herbarium of Zhongkai University of Agriculture and Engineering (MHZU) and Zhongkai University of Agriculture and Engineering (ZHKUCC), China. Duplicates of holotypes and type cultures were deposited at the Herbarium of Guizhou Medical University, Guiyang, China (GMB) and Guizhou Medical University Culture Collection (GMBCC) in Guiyang, China. Index Fungorum identifiers (2023) were obtained for the newly introduced taxa.
In the text, the following abbreviations are used: n = a number of ascospores/asci/conidiogenous cells/conidiophores/conidia measured from a given number of specimens, x̄¯ = arithmetical average of sizes of all ascospores/asci/conidiogenous cells/conidia.
Fresh cultures were grown on PDA in the dark at 27 °C for 15–30 days. The genomic DNA of the fungus was extracted from fresh cultures according to the specifications of the Biospin Fungal Genomic DNA Extraction Kit (bioflux ®). Both forward and reverse primers were used for the amplification of internal transcribed spacers (ITS), large subunit rDNA (LSU), small subunit rDNA (SSU), translation elongation factor 1-α (tef1-α) and RNA polymerase II second largest subunit (rpb2) regions are listed in Table
Forward and reverse primers information of ITS, LSU, SSU, tef1-α and rpb2 regions.
| Locus | Primers | Reference |
|---|---|---|
| ITS | Forward: ITS5 TCCTCCGCTTATTGATATGC |
|
| Reverse: ITS4 GGAAGTAAAAGTCGTAACAAGG | ||
| LSU | Forward: LROR GTACCCGCTGAACTTAAGC |
|
| Reverse: LR5 ATCCTGAGGGAAACTTC | ||
| SSU | Forward: NS1 GTAGTCATATGCTTGTCTC |
|
| Reverse: NS4 CTTCCGTCAATTCCTTTAAG | ||
| tef1-α | Forward: EF1-983F |
|
| GCYCCYGGHCAYCGTGAYTTYAT | ||
| Reverse: EF1-2218R | ||
| ATGACACCRACRGCRACRGTYTG | ||
| rpb2 | Forward: fRPB2-5f GAYGAYMGWGATCAYTTYGG |
|
| Reverse: fRPB2-7cr CCCATRGCTTGTYYRCCCAT |
The PCR thermal cycling procedure for amplifying ITS, LSU, SSU, tef1-α, and rpb2 regions.
| ITS, LSU, SSU and tef1-α | Initial denaturation 95 °C for 5 min. Followed by 35 cycles, denaturation at 95 °C for 30 s, annealing at 55 °C for 50 s, elongation at 72 °C for 90 s. Final extension at 72 °C for 10 min |
|
| rpb2 | Initial denaturation 95 °C for 3 min. Follow by 35 cycles, elongation at 94 °C for 1 min, annealing at 52 °C for 50 s, elongation at 72 °C for 1 min. Final extension at 72 °C for 10 min |
|
Based on blast similarity and related publications, closely related sequences were downloaded from GenBank (Table
Names, strain numbers, and corresponding GenBank accession numbers of taxa were used in this study.
| Taxon | Strain Number | GenBank Accession Numbers | |||
| ITS | LSU | SSU | tef1-α | ||
| Didymosphaeriaceae | |||||
| Alloconiothyrium aptrootii | CBS 980.95T | JX496121 | JX496234 | N/A | N/A |
| A. aptrootii | CBS 981.95 | JX496122 | JX496235 | N/A | N/A |
| A. encephalarti | CPC: 35980 | MN562102 | MN567610 | N/A | N/A |
| Austropleospora archidendri | MFLUCC 17-2429 | MK347757 | MK347974 | MK347863 | MK360044 |
| A. archidendri | MFLU 22-0042 | OP058964 | OP059055 | OP059006 | OP135941 |
| Bambusistroma didymosporum | MFLU 15-0057T | KP761733 | KP761730 | KP761737 | KP761727 |
| B. didymosporum | MFLU 15-0058 | KP761734 | KP761731 | KP761738 | KP761728 |
| Bimuria novae-zelandiae | CBS 107.79T | MH861181 | AY016356 | AY016338 | DQ471087 |
| Chromolaenicola nanensis | MFLUCC 17-1473T | MN325015 | MN325003 | MN325009 | MN335648 |
| C. nanensis | MFLUCC 17-1477 | MN325014 | MN325002 | MN325008 | MN335647 |
| C. sapindi | KUMCC 21-0564T | OP058967 | OP059058 | OP059009 | OP135943 |
| Cylindroaseptospora leucaenae | MFLUCC 17-2424T | NR_163333 | NG_066310 | MK347856 | MK360047 |
| C. siamensis | MFLUCC 17-2527T | MK347760 | MK347976 | MK347866 | MK360048 |
| Deniquelata barringtoniae | MFLUCC 11-0422T | NR_111779 | NG_042696 | JX254656 | N/A |
| Dictyoarthrinium vittalii | NFCCI4249T | MF406218 | MF182395 | MF622059 | MF182398 |
| D. hydei | SQUCC 13296 T | MW077145 | N/A | MW077161 | MW075771 |
| D. musae | MFLUCC 20-0105T | MT482323 | MT482320 | MT482326 | MT495602 |
| D. musae | MFLUCC 20-0106 | MT482324 | MT482321 | MT482327 | MT495603 |
| D. sacchari | MFLUCC 20-0107 | MT482325 | MT482322 | MT482328 | N/A |
| D. sacchari | CBS 529.73 | N/A | MH872479 | N/A | N/A |
| D. thailandicum | KUMCC 21-0664T | OP058965 | OP059056 | OP059007 | N/A |
| D. thailandicum | KUMCC 21-0665 | OP058966 | OP059057 | OP059008 | OP135942 |
| Didymocrea sadasivanii | CBS 438.65T | MH858658 | DQ384103 | N/A | N/A |
| Didymosphaeria rubi-ulmifolii | MFLUCC 14-0023T | N/A | KJ436586 | NG_063557 | N/A |
| D. rubi-ulmifolii | MFLUCC 14-0024 | N/A | KJ436585 | KJ436587 | N/A |
| Kalmusia italica | MFLUCC 14-0560T | KP325440 | KP325441 | KP325442 | N/A |
| K. variispora | CBS 121517T | MH863113 | MH874668 | N/A | N/A |
| K. ebuli | CBS 123120T | KF796674 | JN644073 | JN851818 | N/A |
| Kalmusibambusa triseptata | MFLUCC 13-0232T | KY682697 | KY682695 | KY682696 | N/A |
| Karstenula lancangensis | KUMCC 21-0670T | OP058969 | OP059060 | OP059011 | N/A |
| K. lancangensis | KUMCC 21-0677 | OP058970 | OP059061 | OP059012 | N/A |
| Laburnicola hawksworthii | MFLUCC 13-0602T | KU743194 | KU743195 | KU743196 | N/A |
| L. muriformis | MFLUCC 14-0921T | KU743200 | KU743201 | KU743202 | N/A |
| Letendraea cordylinicola | MFLUCC 11-0150 | KM213996 | KM213999 | KM214002 | N/A |
| L. cordylinicola | MFLUCC 11-0148T | NR_154118 | NG_059530 | KM214001 | N/A |
| Montagnula donacina | KUMCC 21-0653 | OP058961 | OP059052 | OP059003 | OP135938 |
| M. thailandica | MFLUCC 17-1508T | MT214352 | NG070949 | NG070158 | MT235774 |
| Neokalmusia brevispora | KT 1466T | LC014573 | AB524600 | AB524459 | AB539112 |
| N. scabrispora | KT 1023 | LC014575 | AB524593 | AB524452 | AB539106 |
| Neptunomyces aureus | CMG12T | MK912121 | N/A | N/A | MK948000 |
| Paracamarosporium fagi | CPC 24890 | KR611886 | KR611904 | N/A | N/A |
| P. fagi | CPC 24892T | KR611887 | KR611905 | N/A | N/A |
| P. anthostomoides | MFLU 16-0172T | KU743206 | KU743207 | KU743208 | N/A |
| Paraphaeosphaeria rosae | MFLUCC 17-2547 | MG828935 | MG829044 | MG829150 | MG829222 |
| P. rosae | MFLUCC 17-2549T | MG828937 | MG829046 | MG829152 | MG829223 |
| Phaeodothis winteri | CBS 182.58 | N/A | GU301857 | GU296183 | N/A |
| Pseudocamarosporium propinquum | MFLUCC 13-0544 | KJ747049 | KJ813280 | KJ819949 | N/A |
| P. pteleae | MFLUCC 17-0724T | NR_157536 | MG829061 | MG829166 | MG829233 |
| Pseudopithomyces entadae | MFLUCC 17-0917T | N/A | NG_066305 | MK347835 | MK360083 |
| P. rosae | MFLUCC 15-0035T | MG828953 | MG829064 | MG829168 | N/A |
| Septofusispora thailandica | KUMCC 21-0647T | OP058971 | OP059062 | OP059013 | OP135945 |
| S. thailandica | KUMCC 21-0652 | OP058972 | OP059063 | OP059014 | N/A |
| Spegazzinia bromeliacearum | URM 8084T | MK804501 | MK809513 | N/A | N/A |
| S. camelliae | WNA03 | MZ538526 | MZ538560 | N/A | MZ567102 |
| S. camelliae | CMU328T | MH734522 | MH734521 | MH734523 | MH734524 |
| S. deightonii | MFLUCC 20-0002T | MN956768 | MN956772 | MN956770 | MN927133 |
| S. intermedia | CBS 249.89T | MH862171 | MH873861 | N/A | N/A |
| S. jinghaensis | KUMCC 21-0495T | OP058973 | OP059064 | OP059015 | OP135946 |
| S. jinghaensis | KUMCC 21-0496 | OP058974 | OP059065 | OP059016 | OP135947 |
| S. lobulata | CBS 361.58T | MH857812 | MH869344 | N/A | N/A |
| S. musae | MFLUCC 20-0001T | MN930512 | MN930514 | MN930513 | MN927132 |
| S. neosundara | MFLUCC 15-0456T | KX965728 | KX954397 | KX986341 | N/A |
| S. radermacherae | MFLUCC 17-2285T | MK347740 | MK347957 | MK347848 | MK360088 |
| S. tessarthra | SH 287 | JQ673429 | AB807584 | AB797294 | AB808560 |
| S. zhujiangyuanensis | ZHKUCC 23-1020T | PP060498 | PP060512 | PP060504 | PP035539 |
| S. zhujiangyuanensis | GMBCC1002 | PP067151 | PP067156 | PP066043 | PP068812 |
| Tremateia arundicola | MFLU 16-1275T | KX274241 | KX274248 | KX274254 | KX284706 |
| T. guiyangensis | GZAAS01T | KX274240 | KX274247 | KX274253 | KX284705 |
| T. murispora | GZCC 18-2787T | NR_165916 | MK972751 | MK972750 | MK986482 |
| Verrucoconiothyrium nitidae | CBS 119209 | EU552112 | EU552112 | N/A | N/A |
| Xenocamarosporium acaciae | CBS 139895T | NR_137982 | NG_058163 | N/A | N/A |
| X. acaciae | MFLUCC 17-2432 | MK347766 | MK347983 | MK347873 | MK360093 |
| Phaeoseptaceae | |||||
| Alfoldia vorosii | CBS 145501T | JN859336 | MK589354 | MK589346 | MK599320 |
| Amorocoelophoma cassiae | MFLUCC 17-2283T | NR_163330 | NG_066307 | NG_065775 | MK360041 |
| Angustimassarina acerina | MFLUCC 14-0505T | NR_138406 | KP888637 | NG_063573 | KR075168 |
| A. populi | MFLUCC 13-0034T | KP899137 | KP888642 | NG_061204 | KR075164 |
| A. quercicola | MFLUCC 14-0506T | KP899133 | KP888638 | NG_063574 | KR075169 |
| Crassiclypeus aquaticus | CBS 143643T | LC312501 | LC312530 | LC312472 | LC312559 |
| Decaisnella formosa | BCC 25616 | N/A | GQ925846 | GQ925833 | GU479851 |
| D. formosa | BCC 25617 | N/A | GQ925847 | GQ925834 | GU479850 |
| Forliomyces uniseptata | MFLUCC 15-0765T | NR_154006 | NG_059659 | NG_061234 | KU727897 |
| Gloniopsis praelonga | CBS 112415 | N/A | FJ161173 | FJ161134 | FJ161090 |
| Guttulispora crataegi | MFLUCC 13-0442T | KP899134 | KP888639 | KP899125 | KR075161 |
| Halotthia posidoniae | BBH 22481 | N/A | GU479786 | GU479752 | N/A |
| Hysterium angustatum | MFLUCC 16-0623 | N/A | FJ161180 | GU397359 | FJ161096 |
| Lignosphaeria fusispora | MFLUCC 11-0377T | NR_164233 | KP888646 | N/A | N/A |
| Mauritiana rhizophorae | BCC 28866 | N/A | GU371824 | GU371832 | GU371817 |
| Misturatosphaeria aurantiacinotata | GKM 1238T | N/A | NG_059927 | N/A | GU327761 |
| Phaeoseptum aquaticum | CBS 123113T | KY940803 | JN644072 | N/A | N/A |
| P. carolshearerianum | NFCCI-4221T | MK307810 | MK307813 | MK307816 | MK309874 |
| P. carolshearerianum | NFCCI-4384 | MK307812 | MK307815 | MK307818 | MK309876 |
| P. hydei | MFLUCC 17-0801T | MT240622 | MT240623 | MT240624 | MT241506 |
| P. mali | MFLUCC 17-2108T | MK659580 | MK625197 | N/A | MK647990 |
| P. manglicola | NFCCI-4666T | MK307811 | MK307814 | MK307817 | MK309875 |
| P. terricola | MFLUCC 10-0102T | MH105778 | MH105779 | MH105780 | MH105781 |
| P. thailandicum | MFLU 19-2136 | OM293749 | OR211590 | OM293755 | OM305059 |
| P. thailandicum | HKAS 106993 | OM293750 | OM293745 | OM293756 | OM305060 |
| P. zhujiangyuanense | ZHKUCC 23-1022T | PP060500 | PP060514 | PP060506 | PP035541 |
| P. zhujiangyuanense | GMBCC1003 | PP067152 | PP067157 | PP066044 | PP068813 |
| Platystomum crataegi | MFLUCC 14-0925T | KT026117 | KT026109 | KT026113 | KT026121 |
| Pleopunctum ellipsoideum | MFLUCC 19-0390T | MK804512 | MK804517 | MK804514 | MK828510 |
| P. pseudoellipsoideum | MFLUCC 19-0391T | MK804513 | MK804518 | N/A | MK828511 |
| Pseudoaurantiascoma kenyense | GKM 1195T | N/A | NG_059928 | N/A | GU327767 |
| P. cornisporum | CBS 143654T | LC312515 | LC312544 | LC312486 | LC312573 |
| Ramusculicola thailandica | MFLUCC 13-0284T | KP899141 | KP888647 | KP899131 | KR075167 |
| Sporormurispora atraphaxidis | MFLUCC 17-0742T | NR_157546 | NG_059880 | NG_061296 | N/A |
| Sulcosporium thailandicum | MFLUCC 12-0004T | MG520958 | KT426563 | KT426564 | N/A |
| Teichospora melanommoides | CBS 140733T | NR_154632 | KU601585 | N/A | KU601610 |
| T. pusilla | CBS 140731T | NR_154633 | KU601586 | N/A | KU601605 |
| T. rubriostiolata | CBS 140734T | NR_154634 | KU601590 | N/A | KU601609 |
| Thyridaria macrostomoides | GKM 1033 | N/A | GU385190 | N/A | GU327776 |
| T. macrostomoides | GKM 1159 | N/A | GU385185 | N/A | GU327778 |
| T. macrostomoides | GKM 224N | N/A | GU385191 | N/A | GU327777 |
| Vaginatispora appendiculata | MFLUCC 16-0314T | KU743217 | KU743218 | KU743219 | KU743220 |
| Westerdykella ornata | CBS 379.55 | AY943045 | GU301880 | GU296208 | GU349021 |
| Synnemasporellaceae | |||||
| Apiosporopsis carpinea | CBS 771.79 | N/A | AF277130 | N/A | N/A |
| Apiosporopsis sp. | Masuya 11Af2-1 | N/A | AB669034 | N/A | N/A |
| Apoharknessia insueta | CBS 111377T | JQ706083 | AY720814 | N/A | N/A |
| A. insueta | CBS 114575 | N/A | AY720813 | N/A | N/A |
| A. asterospermum | CBS 112404 | N/A | AB553745 | N/A | N/A |
| A. asterospermum | KT2138 | N/A | AB553744 | N/A | N/A |
| Auratiopycnidiella tristaniopsidis | CBS 132180 | JQ685516 | JQ685522 | N/A | N/A |
| Cainiella johansonii | Kruys 731 | N/A | JF701920 | N/A | N/A |
| Chapeckia nigrospora | AR 3809 | JF681957 | EU683068 | N/A | N/A |
| Chiangraiomyces bauhiniae | MFLUCC 17-1669T | MF190118 | MF190064 | N/A | MF377604 |
| C. bauhiniae | MFLUCC 17-1670 | MF190119 | MF190065 | N/A | MF377603 |
| Chrysocrypta corymbiae | CBS 132528 | JX069867 | JX069851 | N/A | N/A |
| C. koreana | CBS 143.97 | KX833584 | AF408378 | KX833684 | KX833490 |
| C. straminea | CBS 149.22 | AY339348 | AF362569 | KX833704 | KX833506 |
| C. wangiensis | CBS 132530 | JX069873 | JX069857 | KX833705 | KX833509 |
| Coryneum umbonatum | AR 3541 | N/A | EU683072 | N/A | N/A |
| C. umbonatum | MFLUCC 15-1110 | MF190121 | MF190067 | N/A | MF377610 |
| C. umbonatum | MFLUCC 13-0658T | MF190120 | MF190066 | N/A | MF377609 |
| Cryphonectria macrospora | CBS 109764 | EU199182 | AF408340 | N/A | EU220029 |
| C. parasitica | ATCC 38755 | AY141856 | EU199123 | EU222014 | DQ862017 |
| Cryptodiaporthe aesculi | CBS 109765 | DQ323530 | AF408342 | GU354004 | EU199138.2 |
| C. aesculi | CBS 121905 | EU254994 | EU255164 | DQ313558 | EU219269 |
| C. betulae | CBS 109763 | EU199180 | AF408375 | EU221884 | EU199139 |
| C. hypodermia | AR 3552 | EU199181 | AF408346 | N/A | EU199140 |
| C. suffusa | CBS 109750 | EU199207 | AF408376 | EU221945 | EU199163 |
| Cytospora elaeagni | CFCC 89633 | KF765677 | KF765693 | KU710919 | KU710956 |
| C. leucostoma | CFCC 50468 | KT732949 | KT732968 | N/A | N/A |
| Dendrostoma mali | CFCC 52102T | MG682072 | MG682012 | MG682052 | MG682032 |
| D. osmanthi | CFCC 52106T | MG682073 | MG682013 | MG682053 | MG682033 |
| D. quercinum | CFCC 52103T | MG682077 | MG682017 | MG682057 | MG682037 |
| Diaporthe decedens | CBS 109772 | KC343059 | AF408348 | N/A | N/A |
| D. detrusa | CBS 109770 | KC343061 | AF408349 | KC343787 | N/A |
| D. eres | CBS 109767 | KC343075 | AF408350 | KC343801 | N/A |
| Diaporthella corylina | CBS 121124 | KC343004 | N/A | N/A | N/A |
| Diaporthella sp. | CN 5 | KP205483 | N/A | N/A | N/A |
| Diaporthella sp. | CN13 | KP205484 | N/A | N/A | N/A |
| Diaporthosporella cercidicola | CFCC 51994T | KY852492 | KY852515 | N/A | N/A |
| D. cercidicola | CFCC 51995 | KY852493 | KY852516 | N/A | N/A |
| Diaporthostoma machili | CFCC 52100T | MG682080 | MG682020 | MG682060 | MG682040 |
| D. machili | CFCC 52101 | MG682081 | MG682021 | MG682061 | MG682041 |
| Disculoides eucalypti | CPC 17650 | JQ685517 | JQ685523 | N/A | N/A |
| D. eucalyptorum | CBS 132184 | NR_120090 | JQ685524 | N/A | N/A |
| Ditopella ditopa | CBS 109748 | EU199187 | EU199126 | N/A | EU199145 |
| Erythrogloeum hymenaeae | CPC 18819 | JQ685519 | JQ685525 | N/A | N/A |
| G. gnomon | CBS 199.53 | AY818956 | AF408361 | EU221885 | EU219295 |
| Harknessia eucalypti | CBS 342.97 | AY720745 | AF408363 | N/A | N/A |
| Hercospora tiliae | AR 3526 | N/A | AF408365 | N/A | N/A |
| Hyaliappendispora galii | MFLUCC 16-1208 | MF190149 | MF190095 | N/A | N/A |
| Juglanconis appendiculata | D96 | KY427139 | KY427139 | KY427208 | KY427189 |
| J. juglandina | ME23 | KY427150 | KY427150 | KY427219 | KY427200 |
| J. oblonga | ME14 | KY427151 | KY427151 | KY427220 | KY427201 |
| J. pterocaryae | ME20 | KY427155 | KY427155 | KY427224 | KY427205 |
| Lamproconium desmazieri | MFLUCC 14-1047 | KX430132 | KX430133 | MF377592 | N/A |
| L. desmazieri | MFLUCC 15-0870 | KX430134 | KX430135 | MF377591 | MF377605 |
| Lasmenia sp. | CBS 124123 | GU797406 | JF838338 | N/A | N/A |
| Lasmenia sp. | CBS 124124 | JF838336 | JF838341 | N/A | N/A |
| Luteocirrhus shearii | CBS 130776 | NR_120254 | NG_042770 | N/A | N/A |
| Macrohilum eucalypti | CPC 19421T | KR873244 | KR873275 | N/A | N/A |
| Melanconiella ellisii | BPI 878343 | JQ926271 | JQ926271 | JQ926406 | JQ926339 |
| M. spodiaea | MSH | JQ926298 | JQ926298 | JQ926431 | JQ926364 |
| Melanconis betulae | CFCC 50471 | KT732952 | KT732971 | KT733001 | KT732986 |
| M. itoana | CFCC 50474 | KT732955 | KT732974 | KT733004 | KT732987 |
| M. marginalis | CBS 109744 | EU199197 | AF408373 | EU221991 | EU219301 |
| M. stilbostoma | CFCC 50475 | KT732956 | KT732975 | KT733005 | KT732988 |
| Nakataea oryzae | CBS 243.76 | KM484861 | DQ341498 | N/A | N/A |
| Ophiodiaporthe cyatheae | YMJ1364 | JX570889 | JX570891 | N/A | JX570893 |
| Pachytrype princeps | Rogers S | N/A | FJ532382 | N/A | N/A |
| P. rimosa | FF1066 | N/A | FJ532381 | N/A | N/A |
| Paradiaporthe artemisiae | MFLUCC 14-0850 | MF190155 | MF190100 | N/A | N/A |
| P. artemisiae | MFLUCC 17-1663 | MF190156 | MF190101 | N/A | N/A |
| Phaeoappendispora thailandensis | MFLUCC 13-0161 | MF190157 | MF190102 | N/A | MF377613 |
| Phaeodiaporthe appendiculata | CBS 123821 | KF570156 | KF570156 | N/A | N/A |
| Phragmoporthe conformis | CBS 109783 | DQ323527 | AF408377 | N/A | N/A |
| Plagiostoma euphorbiae | CBS 340.78 | EU199198 | AF408382 | N/A | DQ368643 |
| P. salicellum | CBS 109775 | DQ323529 | AF408345 | EU221916 | EU199141 |
| Prosopidicola mexicana | CBS 113530 | AY720710 | N/A | N/A | N/A |
| P. mexicana | CBS 113529T | AY720709 | KX228354 | N/A | N/A |
| Pseudomelanconis caryae | CFCC 52110T | MG682082 | MG682022 | MG682062 | MG682042 |
| P. caryae | CFCC 52111 | MG682083 | MG682023 | MG682063 | MG682043 |
| Pseudoplagiostoma eucalypti | CBS 124807 | GU973512 | GU973606 | N/A | N/A |
| P. eucalypti | CBS 116382 | GU973514 | GU973608 | N/A | N/A |
| Pyricularia grisea | Ina168 | AB026819 | AB026819 | N/A | N/A |
| Rossmania ukurunduensis | AR 3484 | N/A | EU683075 | N/A | N/A |
| Sillia ferruginea | CBS 126567 | JF681959 | EU683076 | N/A | N/A |
| Stegonsporium pyriforme | CBS 124487 | KF570160 | KF570160 | N/A | KF570190 |
| Stilbospora macrosperma | CBS 121883 | JX517290 | JX517299 | N/A | KF570196 |
| Sydowiella fenestrans | CBS 125530 | JF681956 | EU683078 | N/A | N/A |
| Synnemasporella aculeans | CFCC 52094 | MG682086 | MG682026 | MG682066 | MG682046 |
| S. aculeans | CFCC 52095 | MG682087 | MG682027 | MG682067 | MG682047 |
| S. fanii | ZHKUCC 23-1018T | PP060496 | PP060510 | PP035537 | PP035545 |
| S. fanii | GMBCC1001 | PP067150 | PP067155 | PP068811 | PP084097 |
| S. toxicodendri | CFCC 52097T | MG682089 | MG682029 | MG682069 | MG682049 |
| S. toxicodendri | CFCC 52098 | MG682090 | MG682030 | MG682070 | MG682050 |
Maximum-likelihood (ML) analysis was carried out via the online portal CIPRES Science Gateway v. 3.3 (
Bayesian analysis was performed by MrBayes v. 3.0b4 (
Figtree v. 1.4.0 (http://tree.bio.ed.ac.uksoftware/figtree/) (
Phylogenetic analyses of Spegazzinia
The concatenated dataset (ITS, LSU, SSU, and tef1-α regions) contained 74 strains in the sequence analysis, which comprise 2988 characters with gaps. Single gene analysis was carried out and compared with each species, to compare the topology of the tree and clade stability. Two strains of Bambusistroma didymosporum D.Q. Dai & K.D. Hyde (MFLU 15-0057 and MFLU 15-0058) are set as the outgroup taxon. The best-scoring RAxML tree with a final likelihood value of -16559.564563 is presented. The matrix had 838 distinct alignment patterns, with 23.64% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.238369, C = 0.251538, G = 0.273530, T = 0.236562; substitution rates AC = 1.319072, AG = 2.377467, AT = 1.425866, CG = 0.960524, CT = 6.538802, GT = 1.000000; gamma distribution shape parameter alpha = 0.188509 (Fig.
The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, SSU and tef1-α) is rooted to Bambusistroma didymosporum (MFLU 15-0057 and MFLU 15-0058). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95 are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are noted with “T”.
Phylogenetic analyses of Phaeoseptum
The concatenated dataset (ITS, LSU, SSU, and tef1-α regions) contained 45 strains in the sequence analysis, which comprise 3532 characters with gaps. Single gene analysis was carried out and compared with each species, to contrast the topology of the tree and clade stability. Hysterium angustatum Pers. (MFLUCC 16-0623) and Gloniopsis praelonga (Schwein.) Underw. & Earle (CBS 112415) were selected as the outgroup taxa. The best-scoring RAxML tree with a final likelihood value of -23164.186742 is presented. The matrix had 1334 distinct alignment patterns, with 25.07% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.241078, C = 0.255689, G = 0.276841, T = 0.226392; substitution rates AC = 1.125548, AG = 2.311485, AT = 1.305084, CG = 1.147813, CT = 6.370520, GT = 1.000000; gamma distribution shape parameter alpha = 0.281773 (Fig.
The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, SSU and tef1-α) is rooted to Hysterium angustatum (MFLUCC 16-0623) and Gloniopsis praelonga (CBS 112415). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95 are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are indicated with “T”.
Phylogenetic analyses of Synnemasporella
The concatenated dataset (ITS, LSU, tef1-α and rpb2 regions) contained 97 strains in the sequence analysis, which comprise 2575 characters with gaps. Single gene analysis was carried out and compared with each species, to compare the topology of the tree and clade stability. Nakataea oryzae (Catt.) J. Luo & N. Zhang (CBS 243.76) and Pyricularia grisea Cooke ex Sacc. (Ina168) are set as the outgroup taxa. The best-scoring RAxML tree with a final likelihood value of -30093.037277 is presented. The matrix had 1256 distinct alignment patterns, with 32.60% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.248601, C = 0.250906, G = 0.280824, T = 0.219669; substitution rates AC = 1.521472, AG = 3.435591, AT = 1.966143, CG = 1.205529, CT = 7.891750, GT = 1.000000; gamma distribution shape parameter alpha = 0.244582 (Fig.
The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, tef1-α and rpb2) is rooted to Nakataea oryzae (CBS 243.76) and Pyricularia grisea (Ina168). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95, are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are indicated with “T”.
Class Dothideomycetes O.E. Erikss. & Winka
Subclass Dothideomycetidae P.M. Kirk, P.F. Cannon, J.C. David & Stalpers ex C.L. Schoch, Spatafora, Crous & Shoemaker
Pleosporales Luttrell ex M.E. Barr
The genus Spegazzinia was introduced by
Named after the locality from where it was collected, Zhujiangyuan, Yunnan (China).
MHCU 23-0273.
Saprobic on twigs of an unknown woody plant. Sexual morph: undetermined. Asexual morph: Hyphomycetous. Conidiomata sporodochia, powdery, dark, dense, 0.2–2 mm in diam. Conidiogenous cells 7–12 µm high × 2.5–6 µm wide (x̄¯ = 9.5 × 3.5 µm; n = 10), basauxic, ampulate, subspherical, hyaline-to-light-brown, rough at surface. Conidiophores of α conidia up to 32.5–142.5 × 1.5–3.5 µm (x̄¯ = 82.5 × 2.5 µm, n = 20), erect or flexuous, unbranched, dark brown. Conidiophores of β conidia 14.5–19 × 2.0–2.3 µm (x̄¯ = 16.3 × 2.1 µm; n = 20), short, erect, unbranched, sub-hyaline or light brown. Conidia two types; α conidia 17.5–25 × 15.5–26 µm (x̄¯ = 20.5 × 19.7 µm; n = 20), 4-celled, stellate-shaped, brown to dark-brown, globose to subglobose, with dark brown warts on the surface of some cells, with conspicuous spines, constricted at septa, 3.6–8 × 1–2.8 µm (x̄¯ = 5.3 × 1.7 µm; n = 20); β conidia 12.2–16 × 12–17 µm (x̄¯ = 14.1 × 14.6 µm; n = 20), 4-celled, disc-shaped, quadrangular or subspherical, pale brown at immaturity, becoming brown to dark-brown at maturity, usually attached with conidiogenous cells when detached from the conidiophore, each cell cruciately septate, turbinate, sometimes verrucose around the edges, deeply constricted at septa, flat from side view.
Spegazzinia zhujiangyuanensis (MHCU 23-0273, holotype) a, b fungal colonies on the host surface c–f conidiophore of α conidia and α conidia g, h α conidia i germinated α conidium j–m β conidia n, o culture characters on pda (n above o below). Scale bars: 150 μm (b); 25 μm (c); 20 μm (d–f); 15 μm (g–m).
Conidia germinating on PDA within 24 h. Colonies growing on PDA, reaching reached 30–40 mm diam. After 14 days at 27 °C, superficial, circular, curled, producing concentric circles after 3 weeks, gradually turning brownish gray to white from middle to edge, entire white margin, periphery white at the immature stage, reverse yellowish-brown.
China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Dong-Qin Dai, QJNU 09 (MHCU 23-0273, holotype), ex-type ZHKUCC 23-1016; Ibid. (GMB 1002, isotype), ex-isotype GMBCC1002.
Phylogenetic analyses based on ITS, LSU, SSU, and tef1-α gene regions showed that our new strains (ZHKUCC 23-1020 (ex-type) and GMBCC1002) belonged to the genus Spegazzinia (Fig.
Diagnostic characters of Spegazzinia jinghaensis and S. zhujiangyuanensis.
| Morphological character | Species name and reference | |
|---|---|---|
| Spegazzinia jinghaensis (Ren et al. 2022) | S. zhujiangyuanensis (This study) | |
| Conidiomata | Sporodochial, velvety, 2–3 mm in diam. | Sporodochial, 0.2–2 mm in diam |
| Conidiogenous cells | 5–6 µm long × 4–5 µm wide | 7–12 µm long × 2.5–6 µm wide, rough surface |
| Conidiophores of α conidia | 80–120 × 1.4–2 µm, unbranched, dark brown | 32.5–142.5 × 1.5–3.5 µm, unbranched, rough surface |
| Conidiophores of β conidia | 3.5–8 × 2.5–3.5 µm short, erect, unbranched, sub-hyaline or light brown | 14.5–19 × 2–2.3 µm, short, erect, unbranched, sub-hyaline or light brown |
| Culture characters | Rough surface, reverse black | With entire white margin, curled, reverse yellowish-brown |
named after the locality from where it was collected, Zhujiangyuan, Yunnan (China).
MHCU 23-0275.
Saprobic on dead wood branches in terrestrial habitats. Sexual morph: Ascomata 215–470 μm long × 150–320 μm wide (x̄¯ = 340 × 225 µm, n = 20), solitary, scattered, semi-immersed to immersed, globose to subglobose, irregular, clypeate, ostiolate, sometimes erumpent as dark brown to black area from the host tissue, or sometimes with a slit-like opening. Ostiole 33–60 μm high, 15–55 μm diam., short, pale brown. Peridium 25–60 μm (x̄¯ = 44 μm, n = 15) wide, comprising 4–6 layers of cells of textura angularis, with thick-walled and brown cells of outer layers, with thin-walled and hyaline cells of inner layers. Hamathecium composed of 1–1.5 μm (x̄¯ = 1.6 µm, n = 20) wide, numerous, branched, cellular, septate, narrow pseudoparaphyses, anastomosing above the asci, and embedded in a gelatinous matrix. Asci 105–165 × 22–35 μm (x̄¯ = 140 × 30 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical-clavate to elongate-clavate, with a distinct pedicel, apically rounded and thinned, with a distinct ocular chamber at immature stage, with a minute ocular chamber when mature. Ascospores 35–42 × 9–15 μm (x̄¯ = 38 × 10 μm, n = 30), partly overlapping, uniseriate at base, 2–3-seriate above, pale to yellowish brown to medium brown from immaturity to maturity, oblong to broadly fusiform, with broadly rounded ends, slightly curved, with 7–13-transversally septa, and 5–21-vertical septa, rarely 2–5 longitudinal septa in each row, normally 1–2 longitudinal septa, but not all cells with a vertical septum in median, the septa partly pale brown, slightly constricted at septa, smooth-walled. Y-shaped septum present or absent in the end cells, with hyaline to pale brown end cells, Asexual morph: undetermined.
Phaeoseptum zhujiangyuanense (MHCU 23-0275, holotype) a–c appearance of ascomata on host substrate d, e vertical section of ascoma f ostiole g peridium h–k asci l pseudoparaphyses m germinated ascospore n–q ascospores r, s colonies on PDA (r above s below). Scale bars: 300 μm (a–c); 200 μm (d, e); 50 μm (f, g, p, q); 20 μm (h–o).
Ascospores germinating on PDA, producing germ tubes from both ends of the ascospores within 24 hours. Colonies growing on PDA, reaching reached 30–40 mm diam. after 14 days at 27 °C, surface pale brown, irregular, curled, producing concentric circles after 3 weeks, reverse warm blackish brown with olive buff at margins.
China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Nalin N. Wijayawardene, RM16 (MHCU 23-0275, holotype), ex-type ZHKUCC 23-1022; Ibid. (GMB 1003, isotype), ex-isotype GMBCC1003.
The phylogenetic analyses based on a combined dataset of ITS, LSU, SSU and tef1-α gene regions (Fig.
Diagnostic characters of Phaeoseptum mali, P. manglicola and P. zhujiangyuanense.
| Morphological character | Species name and reference | ||
|---|---|---|---|
|
P. mali ( |
P. manglicola (Dayarathne et al. 2020) | P. zhujiangyuanense (This study) | |
| Ascomata | Globose ascomata | Globose to subglobose or irregular, aggregate to solitary, with ostiolate | Globose to subglobose, scattered, solitary, ostiolate, with slit-like opening |
| Ostiole | Opened pore, ostiolate with periphyses | 28–94 μm high, 39–96 μm diam | 33–60 μm high, 15–55 μm diam |
| Peridium | 5–19 µm, composed of 8–11 layers | 30– 85 µm, composed 4–6 layers | 25–60 μm wide, composed 4–6 layers |
| Asci | 85–190 × 19–32 μm, cylindrical-clavate to elongate-clavate; apically rounded, ocular chamber clearly visible when immature | 102–212 × 17–27.5 μm, cylindrical to clavate; apically rounded and thickened; a refractive plate in the ectoascus and a refractive apical plate in the endoascus | 105–165 × 22–35 μm, cylindrical-clavate to elongate-clavate; apically rounded and thinned, with a clearly ocular chamber at immature stage |
| Ascospores | 27–38 × 8–13 μm, broad cylindrical, broadly cylindrical, yellowish to dark brown; 11–14 transverse septa, and 1–2 longitudinal septum in each cell | 27–36 × 7.5–13 μm, oblong to broadly fusiform, straight, sometimes slightly curved, hyaline, becoming pale brown to yellowish brown; 9–13 transverse septa, 1–2 longitudinal septa in each row | 35–42 × 9–15 μm, oblong to broadly fusiform, slightly curved, pale to yellowish brown to brownness; 7–13-transversally septate, 5–21-vertical septate, 1–5 longitudinal septa in each row |
Sordariomycetes O.E. Erikss. & Winka
Diaporthomycetidae Senan., Maharachch. & K.D. Hyde
Diaporthales Nannf
The genus Synnemasporella is a pleomorphic taxon that exhibits both sexual and asexual morphs (
Named after Dr. Xin-Lei Fan, the mycologist who introduced the genus, to recognize his outstanding contribution to mycology in China.
MHCU 23-0271.
Saprobic on twigs of an unknown woody plant. Sexual morph: undetermined. Asexual morph: hyphomycetous. Conidiomata synnematous. Synnemata 1000–1300 µm high, 110–360 µm diam., long and determinate, pale to brown, straight, occasionally curved, composed of parallelly and compactly arranged conidiophores. Conidiophores 30–70 µm long × 4.5–6.5 µm wide, hyaline to pale brown, aggregated, straight to curved. Conidiogenous cells 1.5–3.5 × 0.5–2.5 µm, enteroblastic, with a minute collarette at the tip, hyaline to pale brown, straight to curved, cylindrical, arranged adjacent to one another at the fertile end of the synnema, with each conidiogenous cells producing one conidium. Conidia 23–37 × 11–17 µm (x̄¯ = 30 × 15 µm, n = 20), cylindrical to oblong-cylindrical, 1–3 septate, slightly constricted at septa, straight to slightly curved, with a discrete hilum, smooth-walled, multiguttulate, pale brown to brown.
Synnemasporella fanii (MHCU 23-0271, holotype) a, b habit of synnemata on branches c, d longitudinal section of synnemata e–h conidiophores and conidiogenous cells i conidiophores showing septa j–m conidiogenous cells. n–p conidia q germinating conidia r, s colony on PDA (r above s below). Scale bars: 2 mm (b); 300 μm (c); 400 μm (d); 10 μm (e, h); 20 μm (f, g); 15 μm (i); 25 μm (j–m, q); 30 μm (n–p).
Conidia germinating on PDA within 24 h. Colonies growing on PDA, reaching reached 30–40 mm diam. after 14 days at 27 °C, circular, initially white, becoming sepia on the bottom after 7 days, with an irregular edge, texture uniform.
China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Nalin N. Wijayawardene, RM17 (MHCU 23-0271, holotype), ex-type ZHKUCC 23-1018; Ibid. (GMB 1001, isotype), ex-isotype GMBCC1001.
The phylogenetic analyses of the combined dataset of ITS, LSU, rpb2 and tef1-α gene regions (Fig.
| Morphological character | Species name and reference | ||
|---|---|---|---|
|
Synnemasporella aculeans ( |
S. fanii (This study) |
S. toxicodendri ( |
|
| Synnemata | 1100–1500 µm high, 200–400 µm diam., pale to brown, straight to curved, parallel | 1000–1300 µm high, 110–360 µm diam., long and determinate, pale to brown, straight, occasionally curved, parallel | 1200–1800 µm high, 150–300 µm diam., pale to brown, straight to curved, parallel |
| Conidiophores | 20–30 µm, aggregated, aseptate, straight to curved | 30–70 µm long, 4.5–6.5 µm wide, aggregated, septate, straight to curved | 20–30 µm, aggregated, aseptate, straight to curved |
| Conidiogenous cells | Cylindrical, hyaline | Cylindrical, hyaline, enteroblastic, straight to curved | Cylindrical, hyaline |
| Conidia | 8–10(–11) × 3–3.5 µm, oblong-cylindrical, aseptate | 23–37 × 11–17 µm, cylindrical to oblong-cylindrical, 1–3 septate, slightly curved | 6–8 × 2.5–4 µm, cylindrical to oblong-cylindrical, aseptate |
| Culture characters | Regular edge; texture initially uniform, producing concentric circle on the margin after 3 days | Irregular edge, circular, initially white, becoming sepia on the bottom after one week | Irregular edge; texture initially uniform, producing concentric circles after 3 weeks |
Zhujiangyuan Nature Reserve in Yunnan Province, China, harbours a large number of native evergreen and deciduous plant species and we predict this region has higher fungal diversity, although many are yet to be discovered (
Taxa of Didymosphaeriaceae are often reported as endophytic, pathogenic or saprobic on a wide range of plant hosts (
Phaeoseptaceae was introduced by
Synnemasporellaceae was introduced by
The authors would like to thank Dr. Shaun Pennycook and Prof. Jayarama D. Bhat for their advice on nomenclature and taxonomy respectively.
The authors have declared that no competing interests exist.
No ethical statement was reported.
The authors are grateful to High-Level Talent Recruitment Plan of Yunnan Provinces (“Young Talents” Program and “High-End Foreign Experts” Program), Mee-mann Chang Academician Workstation in Yunnan Province, (Grant No. 202205AF150002), and Science and technology plan project of Science and Technology Department of Yunnan Province (Grant No. 202305AC350252, 20210BA070001-076) for support. This work was supported by the Key Laboratory of Yunnan Provincial Department of Education of the Deep-Time Evolution on Biodiversity from the Origion of the Pearl River. Jaturong and Nakarin thank Chiang Mai University for partially support. The authors extend their appreciation to the Researchers supporting Project Number (RSPD2024R741) King Saud University, Riyadh, Saudi Arabia.
Data curation: LHH. Funding acquisition: AME. Project administration: IMM, QL. Writing – original draft: GQZ. Writing – review and editing: NNW, JK, NS, CC, DQD.
Gui-Qing Zhang https://orcid.org/0000-0001-5354-0607
Nalin N. Wijayawardene https://orcid.org/0000-0003-0522-5498
Li-Hong Han https://orcid.org/0000-0002-6127-0915
Jaturong Kumla https://orcid.org/0000-0002-3673-6541
Nakarin Suwannarach https://orcid.org/0000-0002-2653-1913
Qiang Li https://orcid.org/0000-0002-9735-8214
Abdallah M. Elgorban https://orcid.org/0000-0003-3664-7853
Ihab M. Moussa https://orcid.org/0000-0001-9050-2079
Claudia Coleine https://orcid.org/0000-0002-9289-6179
Dong-Qin Dai https://orcid.org/0000-0001-8935-8807
All of the data that support the findings of this study are available in the main text.