Research Article
Print
Research Article
Three novel woody litter inhabiting fungi in Didymosphaeriaceae, Phaeoseptaceae and Synnemasporellaceae from Zhujiangyuan Nature Reserve, Yunnan Province, P.R. China
expand article infoGui-Qing Zhang‡, Nalin N. Wijayawardene§‡, Li-Hong Han‡, Jaturong Kumla|, Nakarin Suwannarach|, Qiang Li‡, Abdallah M. Elgorban, Ihab M. Moussa, Claudia Coleine#, Dong-Qin Dai‡
‡ Qujing Normal University, Qujing, China
§ Tropical Microbiology Research Foundation, Pannipitiya, Sri Lanka
| Chiang Mai University, Chiang Mai, Thailand
¶ King Saud University, Riyadh, Saudi Arabia
# University of Tuscia, Viterbo, Italy

Corresponding author: Nalin N. Wijayawardene ( nalinwijayawardene@yahoo.com )

Corresponding author: Dong-Qin Dai ( cicidaidongqin@gmail.com )

Academic editor: Chitrabhanu Sharma Bhunjun
© 2024 Gui-Qing Zhang, Nalin N. Wijayawardene, Li-Hong Han, Jaturong Kumla, Nakarin Suwannarach, Qiang Li, Abdallah M. Elgorban, Ihab M. Moussa, Claudia Coleine, Dong-Qin Dai.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Zhang G-Q, Wijayawardene NN, Han L-H, Kumla J, Suwannarach N, Li Q, Elgorban AM, Moussa IM, Coleine C, Dai D-Q (2024) Three novel woody litter inhabiting fungi in Didymosphaeriaceae, Phaeoseptaceae and Synnemasporellaceae from Zhujiangyuan Nature Reserve, Yunnan Province, P.R. China. MycoKeys 106: 173-200. https://doi.org/10.3897/mycokeys.106.123105
Open Access

Abstract

Zhujiangyuan Nature Reserve, located in Qujing City, Yunnan Province, China, is reported with high fauna and floral diversity, while the fungal diversity of the region is poorly documented. During the summer season in 2023, decaying wood-inhabiting microfungi were collected from different microhabitats. The novel species were identified based on morphological characteristics and phylogenetic analyses (based on combined datasets of ITS, LSU, SSU, tef1-α, and rpb2 regions). Two species belong to Dothideomycetes (viz., Spegazzinia zhujiangyuanensis sp. nov. and Phaeoseptum zhujiangyuanense sp. nov. in Pleosporales) while the other one resides in Sordariomycetes (Synnemasporella fanii sp. nov. in Diaporthales). The results are in conformity with the earlier studies that predicted higher fungal diversity in this region.

Key words

Morpho-molecular, new fungal species, phylogeny, taxonomy, woody fungi

Introduction

Fungi have a worldwide distribution and underpin nearly all life on the Earth (Mueller and Schmit 2007). They can grow in a wide range of habitats, including extreme environments like deserts or high salt concentrations (Raghukumar and Raghukumar 1998; Dadachova et al. 2007). Fungi exist in various lifestyles, including pathogenic, saprophytic, endophytic, and symbiotic (Naranjo-Ortiz and Gabaldón 2019). They occur as decomposers to degrade organic materials, contribute to carbon and nutrient cycling directly in ecosystems (Richards et al. 2017), and play a role in facilitating mineral cycling, accelerating rock weathering, and promoting plant growth. Currently, the estimates of fungal diversity range from 2 to 3 million. Species Fungorum (2024) (accession date: 31 May 2024) lists all accepted species of fungi, currently 161,104 species; therefore, over 90% of fungal species is still unknown (Hawksworth and Lücking 2017; Niskanen et al 2023). It is predicted that a number of novel taxa could be harboured in tropical regions where the environmental factors are favourable for higher diversity and continued living (Hawksworth and Lücking 2017). Wijayawardene et al. (2021) reported that Yunnan and Guizhou Provinces in China would be an important locality to explore novel taxa although it showcases subtropical climate.

The Zhujiangyuan Nature Reserve harbours abundant plant resources, with forest coverage of more than 95% and exceeding 1,000 species of plants (Wang et al. 2015). The warm climate and sufficient moisture guarantee a rich fungal diversity in Zhujiangyuan Nature Reserve. However, few studies have been carried out in the Zhujiangyuan Nature Reserve, especially on the floristic diversity of fungi.

Zhujiang is the third longest river in China, which covers about 450,000 km2, and flows through most cities in Southern China and a wide range of areas in Northern Vietnam (Guo et al. 2023). It originates from Maxiong Mountain in Zhanyi District, Qujing City, Yunnan Province (Wang 2014). The fungal diversity of this region (i.e. Qujing City and Zhujiangyuan Nature Reserve) is not well documented. Nevertheless, recently, Doilom et al. (2021) introduced Praeclarispora Doilom, W. Dong, K.D. Hyde & C.F. Liao, a novel genus, with Praeclarispora artemisiae Doilom, W. Dong, K.D. Hyde & C.F. Liao as the type species. At the same time, Doilom et al. (2021) reported Plenodomus artemisiae A. Karun., Phookamsak & K.D. Hyde as a new collection from Artemisia argyi in Qujing City, Yunnan Province. Wijayawardene et al. (2021) introduced two new species of Phragmocamarosporium Wijayaw., Yong Wang bis & K.D. Hyde (viz., P. magnoliae and P. qujingensis) and one new species of Lonicericola Phookamsak, Jayasiri & K.D. Hyde (viz., L. qujingensis), collected from Magnolia grandiflora from Qujing Normal University garden, Qujing. Furthermore, five new host/geographical records of different taxa on Magnolia grandiflora collected from Qujing City, were also reported by Wijayawardene et al. (2021), Botryosphaeria dothidea (Moug.) Ces. & De Not. and Shearia formosa (Ellis & Everh.) Petr. were reported as new geographical records from China; Diplodia mutila (Fr.) Fr. and D. seriata De Not. were identified as new host records from M. grandiflora in China; while Angustimassarina populi Thambug. & K.D. Hyde was comfirmed as a new host and geographical record by Wijayawardene et al. (2021), which mentioned it is the first report of A. populi from China and on M. grandiflora.

During the summer of 2023 (July–September), we collected samples of microfungi associated with decaying wood litter in the North-east gate of Zhujiangyuan Nature Reserve. From the collected samples, we introduce three novel species belonging to Spegazzinia Sacc. (i.e. S. zhujiangyuanensis in Didymosphaeriaceae Munk, Pleosporales, Dothideomycetes O.E. Erikss. & Winka), Phaeoseptum Ying Zhang, J. Fourn. & K.D. Hyde (i.e. P. zhujiangyuanense in Phaeoseptaceae Boonmee, Thambugala & K.D. Hyde, Pleosporales, Dothideomycetes) and Synnemasporella X.L. Fan & J.D.P. Bezerra (i.e. S. fanii in Synnemasporellaceae X.L. Fan & J.D.P. Bezerra, Diaporthales Nannf., Sordariomycetes O.E. Erikss. & Winka) based on morpho-molecular analyses. The new taxa are provided with illustrations and morphological descriptions.

Materials and methodology

Sample collection

With prior permission of the management of Zhujiangyuan Nature Reserve, located in Qujing City, Yunnan Province, China, decaying wood litter samples were collected in the terrestrial habitats. The samples were stored in separate zip-lock plastic bags and transported to the microbiology laboratory of Qujing Normal University. Geographical information and sample information were recorded. Collections were maintained at room temperature (25 °C) and the samples were examined within 3–5 days.

Morphology, isolation and preservation

Fruiting bodies were examined using a Leica S8AP0 stereomicroscope with an HDMI 200C camera (Leica Corporation, Germany). Micro-morphological characters were photographed using an Olympus BX53 compound microscope (Olympus Corporation, Japan) with differential interference contrast (Olympus BX53 DIC compound microscope with an Olympus DP74 camera, Japan). Ascomata and conidiomata were sectioned by hand using a razor blade to obtain thin sections (Dai et al. 2022). All microscopic measurements were made using Tarosoft (R) Image FrameWork software (http://www.tarosoft.in.th/), and the measurements were provided as minimum–maximum values and average values. The photographic plates were edited and provided by using Adobe Photoshop CC 2018 (Adobe Systems, USA) software.

Single spore isolation was performed to obtain pure cultures following the methods described in Senanayake et al. (2020). Germinating spores were photographed, transferred to potato dextrose agar (PDA), and then incubated under the dark at 27 °C to obtain a pure culture, which were photographed to record the different characters. After a week, hyphal tips were transferred into PDA plates and grown at 27 °C in the dark.

Dried herbarium specimens and living cultures were preserved at the Mycological Herbarium of Zhongkai University of Agriculture and Engineering (MHZU) and Zhongkai University of Agriculture and Engineering (ZHKUCC), China. Duplicates of holotypes and type cultures were deposited at the Herbarium of Guizhou Medical University, Guiyang, China (GMB) and Guizhou Medical University Culture Collection (GMBCC) in Guiyang, China. Index Fungorum identifiers (2023) were obtained for the newly introduced taxa.

In the text, the following abbreviations are used: n = a number of ascospores/asci/conidiogenous cells/conidiophores/conidia measured from a given number of specimens, x̄¯ = arithmetical average of sizes of all ascospores/asci/conidiogenous cells/conidia.

DNA extraction, PCR amplification and sequencing

Fresh cultures were grown on PDA in the dark at 27 °C for 15–30 days. The genomic DNA of the fungus was extracted from fresh cultures according to the specifications of the Biospin Fungal Genomic DNA Extraction Kit (bioflux ®). Both forward and reverse primers were used for the amplification of internal transcribed spacers (ITS), large subunit rDNA (LSU), small subunit rDNA (SSU), translation elongation factor 1-α (tef1-α) and RNA polymerase II second largest subunit (rpb2) regions are listed in Table 1. A final volume of polymerase chain reaction (PCR) was prepared, including 1 μl of DNA template, 1 μl of each forward and reverse primer, 12.5 μl of 2 × taq PCR Master Mix and 9.5 μl of double-distilled water (ddH2O) as described by Dai et al. (2022). The PCR thermal cycling procedure for amplifying ITS, LSU, SSU, tef1-α and rpb2 regions was run under the conditions presented in Table 2. The PCR products were sent to Shanghai Sangon Biological Engineering Technology & Services Co. (Shanghai, People’s Republic of China) for sequencing. All newly generated sequences were deposited in GenBank and accession numbers were obtained.

Table 1.
Download as
CSV
XLSX

Forward and reverse primers information of ITS, LSU, SSU, tef1-α and rpb2 regions.

Locus Primers Reference
ITS Forward: ITS5 TCCTCCGCTTATTGATATGC White et al. (1990)
Reverse: ITS4 GGAAGTAAAAGTCGTAACAAGG
LSU Forward: LROR GTACCCGCTGAACTTAAGC Vilgalys and Hester (1990)
Reverse: LR5 ATCCTGAGGGAAACTTC
SSU Forward: NS1 GTAGTCATATGCTTGTCTC White et al. (1990)
Reverse: NS4 CTTCCGTCAATTCCTTTAAG
tef1-α Forward: EF1-983F Rehner and Buckley (2005)
GCYCCYGGHCAYCGTGAYTTYAT
Reverse: EF1-2218R
ATGACACCRACRGCRACRGTYTG
rpb2 Forward: fRPB2-5f GAYGAYMGWGATCAYTTYGG Liu et al. (1999)
Reverse: fRPB2-7cr CCCATRGCTTGTYYRCCCAT
Table 2.
Download as
CSV
XLSX

The PCR thermal cycling procedure for amplifying ITS, LSU, SSU, tef1-α, and rpb2 regions.

ITS, LSU, SSU and tef1-α Initial denaturation 95 °C for 5 min. Followed by 35 cycles, denaturation at 95 °C for 30 s, annealing at 55 °C for 50 s, elongation at 72 °C for 90 s. Final extension at 72 °C for 10 min Dai et al. (2022)
rpb2 Initial denaturation 95 °C for 3 min. Follow by 35 cycles, elongation at 94 °C for 1 min, annealing at 52 °C for 50 s, elongation at 72 °C for 1 min. Final extension at 72 °C for 10 min Ma et al. (2022)

Phylogenetic analyses

Based on blast similarity and related publications, closely related sequences were downloaded from GenBank (Table 3). Single gene sequence alignment was performed by mafft v.7.215 (http://mafft.cbrc.jp/alignment/server/index.html) (Katoh and Standley 2013), and final improvements were done using BioEdit v.7.0.5.2 (Hall 2004). Alignment of ITS, LSU, SSU, tef1-α and rpb2 regions was combined with MEGA6 version 6.0 (Tamura et al. 2013). The alignment of combined datasets in FASTA format was converted to PHYLIP and NEXUS formats by using ALTER (Alignment Transformation Environment online, http://sing.ei.uvigo.es/ALTER/) (Glez-Peña et al. 2010). The online tool Findmodel (http://www.hiv.lanl.gov/content/sequence/findmodel/findmodel.html) was used to determine the best nucleotide substitution model for each partition data (Dai et al. 2022).

Table 3.
Download as
CSV
XLSX

Names, strain numbers, and corresponding GenBank accession numbers of taxa were used in this study.

Taxon Strain Number GenBank Accession Numbers
ITS LSU SSU tef1-α
Didymosphaeriaceae
Alloconiothyrium aptrootii CBS 980.95T JX496121 JX496234 N/A N/A
A. aptrootii CBS 981.95 JX496122 JX496235 N/A N/A
A. encephalarti CPC: 35980 MN562102 MN567610 N/A N/A
Austropleospora archidendri MFLUCC 17-2429 MK347757 MK347974 MK347863 MK360044
A. archidendri MFLU 22-0042 OP058964 OP059055 OP059006 OP135941
Bambusistroma didymosporum MFLU 15-0057T KP761733 KP761730 KP761737 KP761727
B. didymosporum MFLU 15-0058 KP761734 KP761731 KP761738 KP761728
Bimuria novae-zelandiae CBS 107.79T MH861181 AY016356 AY016338 DQ471087
Chromolaenicola nanensis MFLUCC 17-1473T MN325015 MN325003 MN325009 MN335648
C. nanensis MFLUCC 17-1477 MN325014 MN325002 MN325008 MN335647
C. sapindi KUMCC 21-0564T OP058967 OP059058 OP059009 OP135943
Cylindroaseptospora leucaenae MFLUCC 17-2424T NR_163333 NG_066310 MK347856 MK360047
C. siamensis MFLUCC 17-2527T MK347760 MK347976 MK347866 MK360048
Deniquelata barringtoniae MFLUCC 11-0422T NR_111779 NG_042696 JX254656 N/A
Dictyoarthrinium vittalii NFCCI4249T MF406218 MF182395 MF622059 MF182398
D. hydei SQUCC 13296 T MW077145 N/A MW077161 MW075771
D. musae MFLUCC 20-0105T MT482323 MT482320 MT482326 MT495602
D. musae MFLUCC 20-0106 MT482324 MT482321 MT482327 MT495603
D. sacchari MFLUCC 20-0107 MT482325 MT482322 MT482328 N/A
D. sacchari CBS 529.73 N/A MH872479 N/A N/A
D. thailandicum KUMCC 21-0664T OP058965 OP059056 OP059007 N/A
D. thailandicum KUMCC 21-0665 OP058966 OP059057 OP059008 OP135942
Didymocrea sadasivanii CBS 438.65T MH858658 DQ384103 N/A N/A
Didymosphaeria rubi-ulmifolii MFLUCC 14-0023T N/A KJ436586 NG_063557 N/A
D. rubi-ulmifolii MFLUCC 14-0024 N/A KJ436585 KJ436587 N/A
Kalmusia italica MFLUCC 14-0560T KP325440 KP325441 KP325442 N/A
K. variispora CBS 121517T MH863113 MH874668 N/A N/A
K. ebuli CBS 123120T KF796674 JN644073 JN851818 N/A
Kalmusibambusa triseptata MFLUCC 13-0232T KY682697 KY682695 KY682696 N/A
Karstenula lancangensis KUMCC 21-0670T OP058969 OP059060 OP059011 N/A
K. lancangensis KUMCC 21-0677 OP058970 OP059061 OP059012 N/A
Laburnicola hawksworthii MFLUCC 13-0602T KU743194 KU743195 KU743196 N/A
L. muriformis MFLUCC 14-0921T KU743200 KU743201 KU743202 N/A
Letendraea cordylinicola MFLUCC 11-0150 KM213996 KM213999 KM214002 N/A
L. cordylinicola MFLUCC 11-0148T NR_154118 NG_059530 KM214001 N/A
Montagnula donacina KUMCC 21-0653 OP058961 OP059052 OP059003 OP135938
M. thailandica MFLUCC 17-1508T MT214352 NG070949 NG070158 MT235774
Neokalmusia brevispora KT 1466T LC014573 AB524600 AB524459 AB539112
N. scabrispora KT 1023 LC014575 AB524593 AB524452 AB539106
Neptunomyces aureus CMG12T MK912121 N/A N/A MK948000
Paracamarosporium fagi CPC 24890 KR611886 KR611904 N/A N/A
P. fagi CPC 24892T KR611887 KR611905 N/A N/A
P. anthostomoides MFLU 16-0172T KU743206 KU743207 KU743208 N/A
Paraphaeosphaeria rosae MFLUCC 17-2547 MG828935 MG829044 MG829150 MG829222
P. rosae MFLUCC 17-2549T MG828937 MG829046 MG829152 MG829223
Phaeodothis winteri CBS 182.58 N/A GU301857 GU296183 N/A
Pseudocamarosporium propinquum MFLUCC 13-0544 KJ747049 KJ813280 KJ819949 N/A
P. pteleae MFLUCC 17-0724T NR_157536 MG829061 MG829166 MG829233
Pseudopithomyces entadae MFLUCC 17-0917T N/A NG_066305 MK347835 MK360083
P. rosae MFLUCC 15-0035T MG828953 MG829064 MG829168 N/A
Septofusispora thailandica KUMCC 21-0647T OP058971 OP059062 OP059013 OP135945
S. thailandica KUMCC 21-0652 OP058972 OP059063 OP059014 N/A
Spegazzinia bromeliacearum URM 8084T MK804501 MK809513 N/A N/A
S. camelliae WNA03 MZ538526 MZ538560 N/A MZ567102
S. camelliae CMU328T MH734522 MH734521 MH734523 MH734524
S. deightonii MFLUCC 20-0002T MN956768 MN956772 MN956770 MN927133
S. intermedia CBS 249.89T MH862171 MH873861 N/A N/A
S. jinghaensis KUMCC 21-0495T OP058973 OP059064 OP059015 OP135946
S. jinghaensis KUMCC 21-0496 OP058974 OP059065 OP059016 OP135947
S. lobulata CBS 361.58T MH857812 MH869344 N/A N/A
S. musae MFLUCC 20-0001T MN930512 MN930514 MN930513 MN927132
S. neosundara MFLUCC 15-0456T KX965728 KX954397 KX986341 N/A
S. radermacherae MFLUCC 17-2285T MK347740 MK347957 MK347848 MK360088
S. tessarthra SH 287 JQ673429 AB807584 AB797294 AB808560
S. zhujiangyuanensis ZHKUCC 23-1020T PP060498 PP060512 PP060504 PP035539
S. zhujiangyuanensis GMBCC1002 PP067151 PP067156 PP066043 PP068812
Tremateia arundicola MFLU 16-1275T KX274241 KX274248 KX274254 KX284706
T. guiyangensis GZAAS01T KX274240 KX274247 KX274253 KX284705
T. murispora GZCC 18-2787T NR_165916 MK972751 MK972750 MK986482
Verrucoconiothyrium nitidae CBS 119209 EU552112 EU552112 N/A N/A
Xenocamarosporium acaciae CBS 139895T NR_137982 NG_058163 N/A N/A
X. acaciae MFLUCC 17-2432 MK347766 MK347983 MK347873 MK360093
Phaeoseptaceae
Alfoldia vorosii CBS 145501T JN859336 MK589354 MK589346 MK599320
Amorocoelophoma cassiae MFLUCC 17-2283T NR_163330 NG_066307 NG_065775 MK360041
Angustimassarina acerina MFLUCC 14-0505T NR_138406 KP888637 NG_063573 KR075168
A. populi MFLUCC 13-0034T KP899137 KP888642 NG_061204 KR075164
A. quercicola MFLUCC 14-0506T KP899133 KP888638 NG_063574 KR075169
Crassiclypeus aquaticus CBS 143643T LC312501 LC312530 LC312472 LC312559
Decaisnella formosa BCC 25616 N/A GQ925846 GQ925833 GU479851
D. formosa BCC 25617 N/A GQ925847 GQ925834 GU479850
Forliomyces uniseptata MFLUCC 15-0765T NR_154006 NG_059659 NG_061234 KU727897
Gloniopsis praelonga CBS 112415 N/A FJ161173 FJ161134 FJ161090
Guttulispora crataegi MFLUCC 13-0442T KP899134 KP888639 KP899125 KR075161
Halotthia posidoniae BBH 22481 N/A GU479786 GU479752 N/A
Hysterium angustatum MFLUCC 16-0623 N/A FJ161180 GU397359 FJ161096
Lignosphaeria fusispora MFLUCC 11-0377T NR_164233 KP888646 N/A N/A
Mauritiana rhizophorae BCC 28866 N/A GU371824 GU371832 GU371817
Misturatosphaeria aurantiacinotata GKM 1238T N/A NG_059927 N/A GU327761
Phaeoseptum aquaticum CBS 123113T KY940803 JN644072 N/A N/A
P. carolshearerianum NFCCI-4221T MK307810 MK307813 MK307816 MK309874
P. carolshearerianum NFCCI-4384 MK307812 MK307815 MK307818 MK309876
P. hydei MFLUCC 17-0801T MT240622 MT240623 MT240624 MT241506
P. mali MFLUCC 17-2108T MK659580 MK625197 N/A MK647990
P. manglicola NFCCI-4666T MK307811 MK307814 MK307817 MK309875
P. terricola MFLUCC 10-0102T MH105778 MH105779 MH105780 MH105781
P. thailandicum MFLU 19-2136 OM293749 OR211590 OM293755 OM305059
P. thailandicum HKAS 106993 OM293750 OM293745 OM293756 OM305060
P. zhujiangyuanense ZHKUCC 23-1022T PP060500 PP060514 PP060506 PP035541
P. zhujiangyuanense GMBCC1003 PP067152 PP067157 PP066044 PP068813
Platystomum crataegi MFLUCC 14-0925T KT026117 KT026109 KT026113 KT026121
Pleopunctum ellipsoideum MFLUCC 19-0390T MK804512 MK804517 MK804514 MK828510
P. pseudoellipsoideum MFLUCC 19-0391T MK804513 MK804518 N/A MK828511
Pseudoaurantiascoma kenyense GKM 1195T N/A NG_059928 N/A GU327767
P. cornisporum CBS 143654T LC312515 LC312544 LC312486 LC312573
Ramusculicola thailandica MFLUCC 13-0284T KP899141 KP888647 KP899131 KR075167
Sporormurispora atraphaxidis MFLUCC 17-0742T NR_157546 NG_059880 NG_061296 N/A
Sulcosporium thailandicum MFLUCC 12-0004T MG520958 KT426563 KT426564 N/A
Teichospora melanommoides CBS 140733T NR_154632 KU601585 N/A KU601610
T. pusilla CBS 140731T NR_154633 KU601586 N/A KU601605
T. rubriostiolata CBS 140734T NR_154634 KU601590 N/A KU601609
Thyridaria macrostomoides GKM 1033 N/A GU385190 N/A GU327776
T. macrostomoides GKM 1159 N/A GU385185 N/A GU327778
T. macrostomoides GKM 224N N/A GU385191 N/A GU327777
Vaginatispora appendiculata MFLUCC 16-0314T KU743217 KU743218 KU743219 KU743220
Westerdykella ornata CBS 379.55 AY943045 GU301880 GU296208 GU349021
Synnemasporellaceae
Apiosporopsis carpinea CBS 771.79 N/A AF277130 N/A N/A
Apiosporopsis sp. Masuya 11Af2-1 N/A AB669034 N/A N/A
Apoharknessia insueta CBS 111377T JQ706083 AY720814 N/A N/A
A. insueta CBS 114575 N/A AY720813 N/A N/A
A. asterospermum CBS 112404 N/A AB553745 N/A N/A
A. asterospermum KT2138 N/A AB553744 N/A N/A
Auratiopycnidiella tristaniopsidis CBS 132180 JQ685516 JQ685522 N/A N/A
Cainiella johansonii Kruys 731 N/A JF701920 N/A N/A
Chapeckia nigrospora AR 3809 JF681957 EU683068 N/A N/A
Chiangraiomyces bauhiniae MFLUCC 17-1669T MF190118 MF190064 N/A MF377604
C. bauhiniae MFLUCC 17-1670 MF190119 MF190065 N/A MF377603
Chrysocrypta corymbiae CBS 132528 JX069867 JX069851 N/A N/A
C. koreana CBS 143.97 KX833584 AF408378 KX833684 KX833490
C. straminea CBS 149.22 AY339348 AF362569 KX833704 KX833506
C. wangiensis CBS 132530 JX069873 JX069857 KX833705 KX833509
Coryneum umbonatum AR 3541 N/A EU683072 N/A N/A
C. umbonatum MFLUCC 15-1110 MF190121 MF190067 N/A MF377610
C. umbonatum MFLUCC 13-0658T MF190120 MF190066 N/A MF377609
Cryphonectria macrospora CBS 109764 EU199182 AF408340 N/A EU220029
C. parasitica ATCC 38755 AY141856 EU199123 EU222014 DQ862017
Cryptodiaporthe aesculi CBS 109765 DQ323530 AF408342 GU354004 EU199138.2
C. aesculi CBS 121905 EU254994 EU255164 DQ313558 EU219269
C. betulae CBS 109763 EU199180 AF408375 EU221884 EU199139
C. hypodermia AR 3552 EU199181 AF408346 N/A EU199140
C. suffusa CBS 109750 EU199207 AF408376 EU221945 EU199163
Cytospora elaeagni CFCC 89633 KF765677 KF765693 KU710919 KU710956
C. leucostoma CFCC 50468 KT732949 KT732968 N/A N/A
Dendrostoma mali CFCC 52102T MG682072 MG682012 MG682052 MG682032
D. osmanthi CFCC 52106T MG682073 MG682013 MG682053 MG682033
D. quercinum CFCC 52103T MG682077 MG682017 MG682057 MG682037
Diaporthe decedens CBS 109772 KC343059 AF408348 N/A N/A
D. detrusa CBS 109770 KC343061 AF408349 KC343787 N/A
D. eres CBS 109767 KC343075 AF408350 KC343801 N/A
Diaporthella corylina CBS 121124 KC343004 N/A N/A N/A
Diaporthella sp. CN 5 KP205483 N/A N/A N/A
Diaporthella sp. CN13 KP205484 N/A N/A N/A
Diaporthosporella cercidicola CFCC 51994T KY852492 KY852515 N/A N/A
D. cercidicola CFCC 51995 KY852493 KY852516 N/A N/A
Diaporthostoma machili CFCC 52100T MG682080 MG682020 MG682060 MG682040
D. machili CFCC 52101 MG682081 MG682021 MG682061 MG682041
Disculoides eucalypti CPC 17650 JQ685517 JQ685523 N/A N/A
D. eucalyptorum CBS 132184 NR_120090 JQ685524 N/A N/A
Ditopella ditopa CBS 109748 EU199187 EU199126 N/A EU199145
Erythrogloeum hymenaeae CPC 18819 JQ685519 JQ685525 N/A N/A
G. gnomon CBS 199.53 AY818956 AF408361 EU221885 EU219295
Harknessia eucalypti CBS 342.97 AY720745 AF408363 N/A N/A
Hercospora tiliae AR 3526 N/A AF408365 N/A N/A
Hyaliappendispora galii MFLUCC 16-1208 MF190149 MF190095 N/A N/A
Juglanconis appendiculata D96 KY427139 KY427139 KY427208 KY427189
J. juglandina ME23 KY427150 KY427150 KY427219 KY427200
J. oblonga ME14 KY427151 KY427151 KY427220 KY427201
J. pterocaryae ME20 KY427155 KY427155 KY427224 KY427205
Lamproconium desmazieri MFLUCC 14-1047 KX430132 KX430133 MF377592 N/A
L. desmazieri MFLUCC 15-0870 KX430134 KX430135 MF377591 MF377605
Lasmenia sp. CBS 124123 GU797406 JF838338 N/A N/A
Lasmenia sp. CBS 124124 JF838336 JF838341 N/A N/A
Luteocirrhus shearii CBS 130776 NR_120254 NG_042770 N/A N/A
Macrohilum eucalypti CPC 19421T KR873244 KR873275 N/A N/A
Melanconiella ellisii BPI 878343 JQ926271 JQ926271 JQ926406 JQ926339
M. spodiaea MSH JQ926298 JQ926298 JQ926431 JQ926364
Melanconis betulae CFCC 50471 KT732952 KT732971 KT733001 KT732986
M. itoana CFCC 50474 KT732955 KT732974 KT733004 KT732987
M. marginalis CBS 109744 EU199197 AF408373 EU221991 EU219301
M. stilbostoma CFCC 50475 KT732956 KT732975 KT733005 KT732988
Nakataea oryzae CBS 243.76 KM484861 DQ341498 N/A N/A
Ophiodiaporthe cyatheae YMJ1364 JX570889 JX570891 N/A JX570893
Pachytrype princeps Rogers S N/A FJ532382 N/A N/A
P. rimosa FF1066 N/A FJ532381 N/A N/A
Paradiaporthe artemisiae MFLUCC 14-0850 MF190155 MF190100 N/A N/A
P. artemisiae MFLUCC 17-1663 MF190156 MF190101 N/A N/A
Phaeoappendispora thailandensis MFLUCC 13-0161 MF190157 MF190102 N/A MF377613
Phaeodiaporthe appendiculata CBS 123821 KF570156 KF570156 N/A N/A
Phragmoporthe conformis CBS 109783 DQ323527 AF408377 N/A N/A
Plagiostoma euphorbiae CBS 340.78 EU199198 AF408382 N/A DQ368643
P. salicellum CBS 109775 DQ323529 AF408345 EU221916 EU199141
Prosopidicola mexicana CBS 113530 AY720710 N/A N/A N/A
P. mexicana CBS 113529T AY720709 KX228354 N/A N/A
Pseudomelanconis caryae CFCC 52110T MG682082 MG682022 MG682062 MG682042
P. caryae CFCC 52111 MG682083 MG682023 MG682063 MG682043
Pseudoplagiostoma eucalypti CBS 124807 GU973512 GU973606 N/A N/A
P. eucalypti CBS 116382 GU973514 GU973608 N/A N/A
Pyricularia grisea Ina168 AB026819 AB026819 N/A N/A
Rossmania ukurunduensis AR 3484 N/A EU683075 N/A N/A
Sillia ferruginea CBS 126567 JF681959 EU683076 N/A N/A
Stegonsporium pyriforme CBS 124487 KF570160 KF570160 N/A KF570190
Stilbospora macrosperma CBS 121883 JX517290 JX517299 N/A KF570196
Sydowiella fenestrans CBS 125530 JF681956 EU683078 N/A N/A
Synnemasporella aculeans CFCC 52094 MG682086 MG682026 MG682066 MG682046
S. aculeans CFCC 52095 MG682087 MG682027 MG682067 MG682047
S. fanii ZHKUCC 23-1018T PP060496 PP060510 PP035537 PP035545
S. fanii GMBCC1001 PP067150 PP067155 PP068811 PP084097
S. toxicodendri CFCC 52097T MG682089 MG682029 MG682069 MG682049
S. toxicodendri CFCC 52098 MG682090 MG682030 MG682070 MG682050

Note: “T” denotes ex-type. Newly generated sequences are indicated in bold. “N/A”: no data available in GenBank.

Maximum-likelihood (ML) analysis was carried out via the online portal CIPRES Science Gateway v. 3.3 (Miller et al. 2010), using RAxML-HPC v.8 on XSEDE (8.2.12) tool, with the default settings but adapted: the GAMMA nucleotide substitution model and 1000 rapid bootstrap replicates.

Bayesian analysis was performed by MrBayes v. 3.0b4 (Ronquist and Huelsenbeck 2003), and the model of evolution was estimated with MrModeltest v. 2.2 (Nylander 2004). The posterior probabilities (PP) (Rannala and Yang 1996; Zhaxybayeva and Gogarten 2002) were determined by the following Markov chain Monte Carlo sampling (MCMC) in MrBayes v.3.0b4 (Huelsenbeck and Ronquist 2001). Six simultaneous Markov chains were run for 1,000,000 generations, with trees sampled every 100th generation. The preburn was set to 5 and the run was automatically stopped when the mean standard deviation of the split frequency reached below 0.01 (Maharachchikumbura et al. 2015).

Figtree v. 1.4.0 (http://tree.bio.ed.ac.uksoftware/figtree/) (Rambaut 2006) was used to view tree. Microsoft Office PowerPoint 2016 (Microsoft Inc., Redmond, WA, USA) was used to edit the phylogram, and then convert it to jpg. file by using the Adobe PhotoShop CC 2018 software (Jiang et al. 2021).

Results

Phylogenetic analyses

Phylogenetic analyses of Spegazzinia

The concatenated dataset (ITS, LSU, SSU, and tef1-α regions) contained 74 strains in the sequence analysis, which comprise 2988 characters with gaps. Single gene analysis was carried out and compared with each species, to compare the topology of the tree and clade stability. Two strains of Bambusistroma didymosporum D.Q. Dai & K.D. Hyde (MFLU 15-0057 and MFLU 15-0058) are set as the outgroup taxon. The best-scoring RAxML tree with a final likelihood value of -16559.564563 is presented. The matrix had 838 distinct alignment patterns, with 23.64% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.238369, C = 0.251538, G = 0.273530, T = 0.236562; substitution rates AC = 1.319072, AG = 2.377467, AT = 1.425866, CG = 0.960524, CT = 6.538802, GT = 1.000000; gamma distribution shape parameter alpha = 0.188509 (Fig. 1). GTR+I+G model was selected as the best model based on MrModeltest and was used for the Bayesian analysis. Overall tree topologies based on ML and BI analyses were similar and not significantly different. In the phylogenetic analysis (Fig. 1), our new strains (ZHKUCC 23-1020 (ex-type) and GMBCC1002) belonged to the genus Spegazzinia (Fig. 1). Both strains grouped as the sister clade to Spegazzinia jinghaensis G.C. Ren & K.D. Hyde (KUMCC 21-0495 (ex-type) and KMUCC 21-0496), and phylogenetically well-distinct with high statistical values (95% ML and 1 PP; Fig. 1).

Figure 1. 

The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, SSU and tef1-α) is rooted to Bambusistroma didymosporum (MFLU 15-0057 and MFLU 15-0058). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95 are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are noted with “T”.

Phylogenetic analyses of Phaeoseptum

The concatenated dataset (ITS, LSU, SSU, and tef1-α regions) contained 45 strains in the sequence analysis, which comprise 3532 characters with gaps. Single gene analysis was carried out and compared with each species, to contrast the topology of the tree and clade stability. Hysterium angustatum Pers. (MFLUCC 16-0623) and Gloniopsis praelonga (Schwein.) Underw. & Earle (CBS 112415) were selected as the outgroup taxa. The best-scoring RAxML tree with a final likelihood value of -23164.186742 is presented. The matrix had 1334 distinct alignment patterns, with 25.07% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.241078, C = 0.255689, G = 0.276841, T = 0.226392; substitution rates AC = 1.125548, AG = 2.311485, AT = 1.305084, CG = 1.147813, CT = 6.370520, GT = 1.000000; gamma distribution shape parameter alpha = 0.281773 (Fig. 2). GTR+I+G model was selected as the best model based on MrModeltest and was used for the Bayesian analysis. Overall tree topologies based on ML and BI analyses were similar and not significantly different. In the phylogenetic analysis (Fig. 2), two strains of Phaeoseptum zhujiangyuanense (ZHKUCC 23-1022 (ex-type) and GMBCC1003) formed a monophyletic clade (100% ML, 1.00 PP). This clade formed a sister taxon to Phaeoseptum mali Phukhams. & K.D. Hyde (MFLUCC-2108) with 95% ML and 1.00 PP support values.

Figure 2. 

The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, SSU and tef1-α) is rooted to Hysterium angustatum (MFLUCC 16-0623) and Gloniopsis praelonga (CBS 112415). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95 are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are indicated with “T”.

Phylogenetic analyses of Synnemasporella

The concatenated dataset (ITS, LSU, tef1-α and rpb2 regions) contained 97 strains in the sequence analysis, which comprise 2575 characters with gaps. Single gene analysis was carried out and compared with each species, to compare the topology of the tree and clade stability. Nakataea oryzae (Catt.) J. Luo & N. Zhang (CBS 243.76) and Pyricularia grisea Cooke ex Sacc. (Ina168) are set as the outgroup taxa. The best-scoring RAxML tree with a final likelihood value of -30093.037277 is presented. The matrix had 1256 distinct alignment patterns, with 32.60% of undetermined characters or gaps. Estimated base frequencies were as follows; A = 0.248601, C = 0.250906, G = 0.280824, T = 0.219669; substitution rates AC = 1.521472, AG = 3.435591, AT = 1.966143, CG = 1.205529, CT = 7.891750, GT = 1.000000; gamma distribution shape parameter alpha = 0.244582 (Fig. 3). GTR+I+G model was selected as the best model based on MrModeltest and was used for the Bayesian analysis. Overall tree topologies based on ML and BI analyses were similar and not significantly different. In the phylogenetic analysis (Fig. 3), our collection of Synnemasporella fanii (ZHKUCC 23-1018 (ex-type) and GMBCC1001) resided in the genus Synnemasporella and formed a sister clade to S. toxicodendri (CFCC 52097 (ex-type) and CFCC 52098) with moderate support (ML 68% and 0.95 PP).

Figure 3. 

The phylogenetic tree from the best scoring of the RAxML analysis based on combined (ITS, LSU, tef1-α and rpb2) is rooted to Nakataea oryzae (CBS 243.76) and Pyricularia grisea (Ina168). Bootstrap values for maximum likelihood (MLBP) and Bayesian posterior probabilities (BYPP) equal to or greater than 50% and 0.95, are given at the respective branches. Hyphen (-) means a value lower than 50% (BS) or 0.95 (PP). The newly generated sequences are indicated in red bold. The ex-type strains are indicated with “T”.

Taxonomy

Class Dothideomycetes O.E. Erikss. & Winka

Subclass Dothideomycetidae P.M. Kirk, P.F. Cannon, J.C. David & Stalpers ex C.L. Schoch, Spatafora, Crous & Shoemaker

Pleosporales Luttrell ex M.E. Barr

Didymosphaeriaceae Munk

Spegazzinia Sacc.

Index Fungorum: IF9963

Notes

The genus Spegazzinia was introduced by Saccardo (1880) with S. ornata (current name: S. tessarthra (Berk. & M.A. Curtis) Sacc. 1886 fide Saccardo 1886) as the type species. Initially, based on morphological characters with basauxic conidiogenesis, Spegazzinia was accommodated in Apiosporaceae, Sordariomycetes (Hyde et al. 1998). However, Tanaka et al. (2015) transferred Spegazzinia to Didymosphaeriaceae (Dothideomycetes) based on molecular data. Morphologically, species of Spegazzinia have a distinctive conidiophore ontogeny, as well as two types of conidia: α conidia are composed of 4–8 subglobose, dark cells with long spines, while β conidia are generally subspherical or broadly ellipsoid, flattened in one plane, cruciately septate or muriform, pale brown and smooth-walled (Samarakoon et al. 2020). Currently, 17 epithets are listed in Species Fungorum 2024 (accession date: 31 May 2024). Our new collection morphologically resembles Spegazzinia s. str. and multi-locus phylogenetic analyses confirmed that it is a novel species.

Spegazzinia zhujiangyuanensis G.Q. Zhang, Wijayaw., & D.Q. Dai, sp. nov.

Index Fungorum: IF901550
Fig. 4

Etymology

Named after the locality from where it was collected, Zhujiangyuan, Yunnan (China).

Holotype

MHCU 23-0273.

Description

Saprobic on twigs of an unknown woody plant. Sexual morph: undetermined. Asexual morph: Hyphomycetous. Conidiomata sporodochia, powdery, dark, dense, 0.2–2 mm in diam. Conidiogenous cells 7–12 µm high × 2.5–6 µm wide (x̄¯ = 9.5 × 3.5 µm; n = 10), basauxic, ampulate, subspherical, hyaline-to-light-brown, rough at surface. Conidiophores of α conidia up to 32.5–142.5 × 1.5–3.5 µm (x̄¯ = 82.5 × 2.5 µm, n = 20), erect or flexuous, unbranched, dark brown. Conidiophores of β conidia 14.5–19 × 2.0–2.3 µm (x̄¯ = 16.3 × 2.1 µm; n = 20), short, erect, unbranched, sub-hyaline or light brown. Conidia two types; α conidia 17.5–25 × 15.5–26 µm (x̄¯ = 20.5 × 19.7 µm; n = 20), 4-celled, stellate-shaped, brown to dark-brown, globose to subglobose, with dark brown warts on the surface of some cells, with conspicuous spines, constricted at septa, 3.6–8 × 1–2.8 µm (x̄¯ = 5.3 × 1.7 µm; n = 20); β conidia 12.2–16 × 12–17 µm (x̄¯ = 14.1 × 14.6 µm; n = 20), 4-celled, disc-shaped, quadrangular or subspherical, pale brown at immaturity, becoming brown to dark-brown at maturity, usually attached with conidiogenous cells when detached from the conidiophore, each cell cruciately septate, turbinate, sometimes verrucose around the edges, deeply constricted at septa, flat from side view.

Figure 4. 

Spegazzinia zhujiangyuanensis (MHCU 23-0273, holotype) a, b fungal colonies on the host surface c–f conidiophore of α conidia and α conidia g, h α conidia i germinated α conidium j–m β conidia n, o culture characters on pda (n above o below). Scale bars: 150 μm (b); 25 μm (c); 20 μm (d–f); 15 μm (g–m).

Culture characteristics

Conidia germinating on PDA within 24 h. Colonies growing on PDA, reaching reached 30–40 mm diam. After 14 days at 27 °C, superficial, circular, curled, producing concentric circles after 3 weeks, gradually turning brownish gray to white from middle to edge, entire white margin, periphery white at the immature stage, reverse yellowish-brown.

Material examined

China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Dong-Qin Dai, QJNU 09 (MHCU 23-0273, holotype), ex-type ZHKUCC 23-1016; Ibid. (GMB 1002, isotype), ex-isotype GMBCC1002.

GenBank numbers

Ex-type (ZHKUCC 23-1020): PP060498 (ITS); PP060512 (LSU); PP060504 (SSU); PP035539 (tef1-α), ex-isotype (GMBCC1002): PP067151 (ITS); PP067156 (LSU); PP066043 (SSU); PP068812 (tef1-α).

Notes

Phylogenetic analyses based on ITS, LSU, SSU, and tef1-α gene regions showed that our new strains (ZHKUCC 23-1020 (ex-type) and GMBCC1002) belonged to the genus Spegazzinia (Fig. 1). Both strains grouped as the sister clade to S. jinghaensis (KUMCC 21-0495 (ex-type) and KMUCC 21-0496), but phylogenetically found distinct with high statistical values (95% ML bootstrap and 1.00 PP) (Fig. 1). Morphological differences between the new taxon and S. jinghaensis are listed in Table 4. Therefore, based on both morpho-molecular results, we herein introduce a new species in the genus, Spegazzinia zhujiangyuanensis.

Table 4.
Download as
CSV
XLSX

Diagnostic characters of Spegazzinia jinghaensis and S. zhujiangyuanensis.

Morphological character Species name and reference
Spegazzinia jinghaensis (Ren et al. 2022) S. zhujiangyuanensis (This study)
Conidiomata Sporodochial, velvety, 2–3 mm in diam. Sporodochial, 0.2–2 mm in diam
Conidiogenous cells 5–6 µm long × 4–5 µm wide 7–12 µm long × 2.5–6 µm wide, rough surface
Conidiophores of α conidia 80–120 × 1.4–2 µm, unbranched, dark brown 32.5–142.5 × 1.5–3.5 µm, unbranched, rough surface
Conidiophores of β conidia 3.5–8 × 2.5–3.5 µm short, erect, unbranched, sub-hyaline or light brown 14.5–19 × 2–2.3 µm, short, erect, unbranched, sub-hyaline or light brown
Culture characters Rough surface, reverse black With entire white margin, curled, reverse yellowish-brown

Phaeoseptaceae S. Boonmee, Thambug. & K.D. Hyde

Phaeoseptum Ying Zhang, J. Fourn. & K.D. Hyde

Index Fungorum: IF561889

Notes

Zhang et al. (2013) introduced Phaeoseptum with P. aquaticum Ying Zhang, J. Fourn. & K.D. Hyde as the type species. There are seven Phaeoseptum epithets listed in Species Fungorum (31 May 2024). Phaeoseptum is characterized by immersed ascomata, cellular pseudoparaphyses, bitunicate, fissitunicate clavate, 8-spored asci, and broadly fusiform, muriform, medium brown coloured, ascospores (Zhang et al. 2013; Phukhamsakda et al. 2019). Our new collection morphologically resembles Phaeoseptum s. str. The phylogenetic study confirmed that the new collection represents a new species of Phaeoseptum (Fig. 2).

Phaeoseptum zhujiangyuanense G.Q. Zhang, Wijayaw., & D.Q. Dai, sp. nov.

Index Fungorum: IF901551
Fig. 5

Etymology

named after the locality from where it was collected, Zhujiangyuan, Yunnan (China).

Holotype

MHCU 23-0275.

Description

Saprobic on dead wood branches in terrestrial habitats. Sexual morph: Ascomata 215–470 μm long × 150–320 μm wide (x̄¯ = 340 × 225 µm, n = 20), solitary, scattered, semi-immersed to immersed, globose to subglobose, irregular, clypeate, ostiolate, sometimes erumpent as dark brown to black area from the host tissue, or sometimes with a slit-like opening. Ostiole 33–60 μm high, 15–55 μm diam., short, pale brown. Peridium 25–60 μm (x̄¯ = 44 μm, n = 15) wide, comprising 4–6 layers of cells of textura angularis, with thick-walled and brown cells of outer layers, with thin-walled and hyaline cells of inner layers. Hamathecium composed of 1–1.5 μm (x̄¯ = 1.6 µm, n = 20) wide, numerous, branched, cellular, septate, narrow pseudoparaphyses, anastomosing above the asci, and embedded in a gelatinous matrix. Asci 105–165 × 22–35 μm (x̄¯ = 140 × 30 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical-clavate to elongate-clavate, with a distinct pedicel, apically rounded and thinned, with a distinct ocular chamber at immature stage, with a minute ocular chamber when mature. Ascospores 35–42 × 9–15 μm (x̄¯ = 38 × 10 μm, n = 30), partly overlapping, uniseriate at base, 2–3-seriate above, pale to yellowish brown to medium brown from immaturity to maturity, oblong to broadly fusiform, with broadly rounded ends, slightly curved, with 7–13-transversally septa, and 5–21-vertical septa, rarely 2–5 longitudinal septa in each row, normally 1–2 longitudinal septa, but not all cells with a vertical septum in median, the septa partly pale brown, slightly constricted at septa, smooth-walled. Y-shaped septum present or absent in the end cells, with hyaline to pale brown end cells, Asexual morph: undetermined.

Figure 5. 

Phaeoseptum zhujiangyuanense (MHCU 23-0275, holotype) a–c appearance of ascomata on host substrate d, e vertical section of ascoma f ostiole g peridium h–k asci l pseudoparaphyses m germinated ascospore n–q ascospores r, s colonies on PDA (r above s below). Scale bars: 300 μm (a–c); 200 μm (d, e); 50 μm (f, g, p, q); 20 μm (h–o).

Culture characteristics

Ascospores germinating on PDA, producing germ tubes from both ends of the ascospores within 24 hours. Colonies growing on PDA, reaching reached 30–40 mm diam. after 14 days at 27 °C, surface pale brown, irregular, curled, producing concentric circles after 3 weeks, reverse warm blackish brown with olive buff at margins.

Material examined

China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Nalin N. Wijayawardene, RM16 (MHCU 23-0275, holotype), ex-type ZHKUCC 23-1022; Ibid. (GMB 1003, isotype), ex-isotype GMBCC1003.

GenBank numbers

Ex-type (ZHKUCC 23-1022): PP060500 (ITS); PP060514 (LSU); PP060506 (SSU); PP035541 (tef1-α), ex-isotype (GMBCC1003): PP067152 (ITS); PP067157 (LSU); PP066044 (SSU); PP068813 (tef1-α).

Note

The phylogenetic analyses based on a combined dataset of ITS, LSU, SSU and tef1-α gene regions (Fig. 2) showed that our isolates (ZHKUCC 23-1022 (ex-type) and GMBCC1003) placed in the genus Phaeoseptum in Didymosphaeriaceae (Fig. 2). Phaeoseptum zhujiangyuanense clusters with P. manglicola (NFCCI-4666) and P. mali (MFLUCC-2108) with significant support (ML 100% and 1.00 PP). Morphologically, P. zhujiangyuanense, P. manglicola Devadatha, V.V. Sarma & E.B.G. Jones and P. mali share similar characteristics in their ascomata, asci and ascospores, and in their overlapping dimensions. However, P. zhujiangyuanense is distinguishable from P. mali and P. manglicola in some characters, as shown in Table 5. Therefore, based on both morphological and phylogenetic evidences, we established this novel species in Phaeoseptum.

Table 5.
Download as
CSV
XLSX

Diagnostic characters of Phaeoseptum mali, P. manglicola and P. zhujiangyuanense.

Morphological character Species name and reference
P. mali (Phukhamsakda et al. 2019) P. manglicola (Dayarathne et al. 2020) P. zhujiangyuanense (This study)
Ascomata Globose ascomata Globose to subglobose or irregular, aggregate to solitary, with ostiolate Globose to subglobose, scattered, solitary, ostiolate, with slit-like opening
Ostiole Opened pore, ostiolate with periphyses 28–94 μm high, 39–96 μm diam 33–60 μm high, 15–55 μm diam
Peridium 5–19 µm, composed of 8–11 layers 30– 85 µm, composed 4–6 layers 25–60 μm wide, composed 4–6 layers
Asci 85–190 × 19–32 μm, cylindrical-clavate to elongate-clavate; apically rounded, ocular chamber clearly visible when immature 102–212 × 17–27.5 μm, cylindrical to clavate; apically rounded and thickened; a refractive plate in the ectoascus and a refractive apical plate in the endoascus 105–165 × 22–35 μm, cylindrical-clavate to elongate-clavate; apically rounded and thinned, with a clearly ocular chamber at immature stage
Ascospores 27–38 × 8–13 μm, broad cylindrical, broadly cylindrical, yellowish to dark brown; 11–14 transverse septa, and 1–2 longitudinal septum in each cell 27–36 × 7.5–13 μm, oblong to broadly fusiform, straight, sometimes slightly curved, hyaline, becoming pale brown to yellowish brown; 9–13 transverse septa, 1–2 longitudinal septa in each row 35–42 × 9–15 μm, oblong to broadly fusiform, slightly curved, pale to yellowish brown to brownness; 7–13-transversally septate, 5–21-vertical septate, 1–5 longitudinal septa in each row

Sordariomycetes O.E. Erikss. & Winka

Diaporthomycetidae Senan., Maharachch. & K.D. Hyde

Diaporthales Nannf

Synnemasporellaceae X.L. Fan & J.D.P. Bezerra

Fan et al. (2018) introduced this family to accommodate the holomorphic genus, Synnemasporella (with type species S. toxicodendri X.L. Fan & J.D.P. Bezerra). Currently, the family comprises only one genus (Wijayawardene et al. 2022a).

Synnemasporella X.L. Fan & J.D.P. Bezerra

Index Fungorum: IF823995

Notes

The genus Synnemasporella is a pleomorphic taxon that exhibits both sexual and asexual morphs (Fan et al. 2018). Currently, the genus comprises two species. The asexual morphs of S. aculeans X.L. Fan & J.D.P. Bezerra were reported with both coelomycetous and hyphomycetous morphs (Fan et al. 2018). However, the second species S. toxicodendri was reported only with its hyphomycetous morph.

Synnemasporella fanii Wijayaw., G.Q. Zhang & D.Q. Dai, sp. nov.

Index Fungorum: IF901552
Fig. 6

Etymology

Named after Dr. Xin-Lei Fan, the mycologist who introduced the genus, to recognize his outstanding contribution to mycology in China.

Holotype

MHCU 23-0271.

Description

Saprobic on twigs of an unknown woody plant. Sexual morph: undetermined. Asexual morph: hyphomycetous. Conidiomata synnematous. Synnemata 1000–1300 µm high, 110–360 µm diam., long and determinate, pale to brown, straight, occasionally curved, composed of parallelly and compactly arranged conidiophores. Conidiophores 30–70 µm long × 4.5–6.5 µm wide, hyaline to pale brown, aggregated, straight to curved. Conidiogenous cells 1.5–3.5 × 0.5–2.5 µm, enteroblastic, with a minute collarette at the tip, hyaline to pale brown, straight to curved, cylindrical, arranged adjacent to one another at the fertile end of the synnema, with each conidiogenous cells producing one conidium. Conidia 23–37 × 11–17 µm (x̄¯ = 30 × 15 µm, n = 20), cylindrical to oblong-cylindrical, 1–3 septate, slightly constricted at septa, straight to slightly curved, with a discrete hilum, smooth-walled, multiguttulate, pale brown to brown.

Figure 6. 

Synnemasporella fanii (MHCU 23-0271, holotype) a, b habit of synnemata on branches c, d longitudinal section of synnemata e–h conidiophores and conidiogenous cells i conidiophores showing septa j–m conidiogenous cells. n–p conidia q germinating conidia r, s colony on PDA (r above s below). Scale bars: 2 mm (b); 300 μm (c); 400 μm (d); 10 μm (e, h); 20 μm (f, g); 15 μm (i); 25 μm (j–m, q); 30 μm (n–p).

Culture characteristics

Conidia germinating on PDA within 24 h. Colonies growing on PDA, reaching reached 30–40 mm diam. after 14 days at 27 °C, circular, initially white, becoming sepia on the bottom after 7 days, with an irregular edge, texture uniform.

Material examined

China. Yunnan Province, Qujing City, Zhujiangyuan Nature Reserve, 25°30′N, 103°45′E, 01 September 2023, Gui-Qing Zhang & Nalin N. Wijayawardene, RM17 (MHCU 23-0271, holotype), ex-type ZHKUCC 23-1018; Ibid. (GMB 1001, isotype), ex-isotype GMBCC1001.

GenBank numbers

Еx-type (ZHKUCC 23-1018): PP060496 (ITS); PP060510 (LSU); PP035537 (tef1-α); PP035545 (rpb2), ex-isotype (GMBCC1001): PP067150 (ITS); PP067155 (LSU); PP068811 (tef1-α); PP084097 (rpb2).

Note

The phylogenetic analyses of the combined dataset of ITS, LSU, rpb2 and tef1-α gene regions (Fig. 3) showed that our isolates (ZHKUCC 23-1018 (ex-type) and GMBCC1001) belonged to the genus Synnemasporella (Fig. 3). Synnemasporella fanii clustered with S. toxicodendri (CFCC 52097 (isotype) and CFCC 52098) with moderate statistical supports (ML 68% and 0.95 PP). Morphologically, Synnemasporella fanii shares similar characteristics in its synnemata with S. toxicodendri and S. aculeans. Furthermore, S. fanii can be distinguished from S. toxicodendri and S. aculeans by having 1–3-septate conidia. Besides, in both two species of this genus, the form of the conidiogenous cells cannot be discerned well from Fan et al. (2018); it is not certain whether the two species have enteroblastic conidiogenous cells similar to our strain. The other differences are provided in Table 6. Based on morphology and phylogeny, we established this new collection as a novel species of Synnemasporella.

Table 6.
Download as
CSV
XLSX

Comparison of morphological characteristics of Synnemasporella species.

Morphological character Species name and reference
Synnemasporella aculeans (Fan et al. 2018) S. fanii (This study) S. toxicodendri (Fan et al. 2018)
Synnemata 1100–1500 µm high, 200–400 µm diam., pale to brown, straight to curved, parallel 1000–1300 µm high, 110–360 µm diam., long and determinate, pale to brown, straight, occasionally curved, parallel 1200–1800 µm high, 150–300 µm diam., pale to brown, straight to curved, parallel
Conidiophores 20–30 µm, aggregated, aseptate, straight to curved 30–70 µm long, 4.5–6.5 µm wide, aggregated, septate, straight to curved 20–30 µm, aggregated, aseptate, straight to curved
Conidiogenous cells Cylindrical, hyaline Cylindrical, hyaline, enteroblastic, straight to curved Cylindrical, hyaline
Conidia 8–10(–11) × 3–3.5 µm, oblong-cylindrical, aseptate 23–37 × 11–17 µm, cylindrical to oblong-cylindrical, 1–3 septate, slightly curved 6–8 × 2.5–4 µm, cylindrical to oblong-cylindrical, aseptate
Culture characters Regular edge; texture initially uniform, producing concentric circle on the margin after 3 days Irregular edge, circular, initially white, becoming sepia on the bottom after one week Irregular edge; texture initially uniform, producing concentric circles after 3 weeks

Discussion

Zhujiangyuan Nature Reserve in Yunnan Province, China, harbours a large number of native evergreen and deciduous plant species and we predict this region has higher fungal diversity, although many are yet to be discovered (Feng and Yang 2018; Luo et al. 2018; Dai et al. 2019, 2022; Wijayawardene et al. 2021, 2022c). Wijayawardene et al. (2022b) emphasized the importance of collecting materials from under-studied geographical locations as even, some extensively studied hosts could still harbour novel taxa. A few saprobic fungal taxa have been discovered on woody litter in the Zhujiangyuan Nature Reserve but leaf litter inhabiting fungi have been poorly studied in this region. Besides, less attention has been given to saprobic fungi on woody litter in riverine habitats. Thus, a comprehensive study of microfungi in this region is most warranted. Further, morphology-based taxonomic information and phylogenetic sequencing data are needed to clarify their correct taxonomy, phylogeny, and functional biodiversity.

Taxa of Didymosphaeriaceae are often reported as endophytic, pathogenic or saprobic on a wide range of plant hosts (Gonçalves et al. 2019; Hongsanan et al. 2020). Based on the morphology, and phylogenetic analyses, taxa of Didymosphaeriaceae were fairly well-studied and currently, 33 genera have been accepted in Didymosphaeriaceae (Wijayawardene et al. 2022a). However, more new taxa are waiting to be discovered from monotypic genera such as Barria Z.Q. Yuan, Cylindroaseptospora Jayasiri, E.B.G. Jones & K.D. Hyde, Kalmusibambusa Phook., Tennakoon, Thambug. & K.D. Hyde, Lineostroma H.J. Swart, Neptunomyces M. Gonçalves, T. Vicente & A. Alves, Vicosamyces Firmino, A.R. Machado & O.L. Pereira, and Xenocamarosporium Crous & M.J. Wingf. In this study, we introduced a novel species of Spegazzinia, viz., S. zhujiangyuanensis (ZHKUCC 23-1020 (ex-type) and GMBCC1002). Morphologically, our new collections show somewhat similar micro-morphological characters to S. jinghaensis (with indistinguishable conidiomata, conidiogenous cells and conidiophores of α conidia), but can be separated by its conidiophores of β conidia). Phylogenetically, our new strains S. zhujiangyuanensis (ZHKUCC 23-1020 (ex-type) and GMBCC1002) were grouped as the sister clade to S. jinghaensis (KUMCC 21-0495 (ex-type) and KMUCC 21-0496), with distinct, high statistical values (94% ML bootstrap and 1.00 PP) (Fig. 1). Therefore, based on morphological characteristics and phylogenetic evidence (Fig. 1; based on ITS, LSU, SSU, and tef1-α regions), we introduce Spegazzinia zhujiangyuanensis as a new species.

Phaeoseptaceae was introduced by Hyde et al. (2018) to accommodate Phaeoseptum (type genus), Lignosphaeria Boonmee, Thambug. & K.D. Hyde, and Neolophiostoma Boonmee & K.D. Hyde. Currently, Phaeoseptaceae comprises only two genera, i.e. Phaeoseptum and Pleopunctum N.G. Liu, K.D. Hyde & J.K. Liu (Wijayawardene et al. 2022a). In this study, we introduce a novel species of Phaeoseptum (Phaeoseptaceae), viz., P. zhujiangyuanense, which shares similar characteristics with P. mali and P. manglicola in their ascomata, asci and ascospore, and their overlapping dimensions, which fit the characters of Phaeoseptum well. However, based on morphological differences (Table 5) and phylogenetic analyses (Fig. 2), our collection can be distinguished from the other known species. Thus, we introduced P. zhujiangyuanense as a novel species in Phaeoseptum.

Synnemasporellaceae was introduced by Fan et al. (2018) to accommodate the genus Synnemasporella. The genus was reported with its both asexual and sexual morphs. The asexual morphs of type species of Synnemasporella, S. toxicodendri was reported with both coelomycetous and hyphomycetous morphs on the same host material (Fan et al. 2018). However, the second species, S. aculeans was reported only with a hyphomycetous morph. However, both species of this genus were not mentioned with the form of conidiogenous cells. In this study, our new species, S. fanii is found with only a hyphomycetous morph, which fits well with the characteristics of Synnemasporella. Synnemasporella fanii shares similarities with S. toxicodendri and S. aculeans in their synnemata but it can be significantly distinguished by their large-sized, 1–3-septate conidia, and possible enteroblastic conidiogenous cells. Synnemasporella is abundant as a hyphomycetous morph but further collections are essential to confirm this assumption.

Acknowledgments

The authors would like to thank Dr. Shaun Pennycook and Prof. Jayarama D. Bhat for their advice on nomenclature and taxonomy respectively.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

The authors are grateful to High-Level Talent Recruitment Plan of Yunnan Provinces (“Young Talents” Program and “High-End Foreign Experts” Program), Mee-mann Chang Academician Workstation in Yunnan Province, (Grant No. 202205AF150002), and Science and technology plan project of Science and Technology Department of Yunnan Province (Grant No. 202305AC350252, 20210BA070001-076) for support. This work was supported by the Key Laboratory of Yunnan Provincial Department of Education of the Deep-Time Evolution on Biodiversity from the Origion of the Pearl River. Jaturong and Nakarin thank Chiang Mai University for partially support. The authors extend their appreciation to the Researchers supporting Project Number (RSPD2024R741) King Saud University, Riyadh, Saudi Arabia.

Author contributions

Data curation: LHH. Funding acquisition: AME. Project administration: IMM, QL. Writing – original draft: GQZ. Writing – review and editing: NNW, JK, NS, CC, DQD.

Author ORCIDs

Gui-Qing Zhang https://orcid.org/0000-0001-5354-0607

Nalin N. Wijayawardene https://orcid.org/0000-0003-0522-5498

Li-Hong Han https://orcid.org/0000-0002-6127-0915

Jaturong Kumla https://orcid.org/0000-0002-3673-6541

Nakarin Suwannarach https://orcid.org/0000-0002-2653-1913

Qiang Li https://orcid.org/0000-0002-9735-8214

Abdallah M. Elgorban https://orcid.org/0000-0003-3664-7853

Ihab M. Moussa https://orcid.org/0000-0001-9050-2079

Claudia Coleine https://orcid.org/0000-0002-9289-6179

Dong-Qin Dai https://orcid.org/0000-0001-8935-8807

Data availability

All of the data that support the findings of this study are available in the main text.

References

  • Dadachova E, Bryan RA, Huang X, Moadel T, Schweitzer AD, Aisen P, Nosanchuk JD, Casadevall A (2007) Ionizing radiation changes the electronic properties of melanin and enhances the growth of melanized fungi. PLoS One 2(5): 457. https://doi.org/10.1371/journal.pone.0000457
  • Dai DQ, Wijayawardene NN, Tang LZ, Liu C, Han LH, Chu HL, Wang HB, Liao CF, Yang EF, Xu RF, Li YM, Hyde KD, Bhat JD, Cannon PF (2019) Rubroshiraia gennova second hypocrellin-producing genus in Shiraiaceae (Pleosporales). MycoKeys 58: 1–26. https://doi.org/10.3897/mycokeys.58.36723
  • Dai DQ, Wijayawardene NN, Dayarathne MC, Kumla J, Han LS, Zhang GQ, Zhang X, Zhang TT, Chen HH (2022) Taxonomic and Phylogenetic Characterizations Reveal Four New Species, Two New Asexual Morph Reports, and Six New Country Records of Bambusicolous Roussoella from China. Journal of Fungi (Basel, Switzerland) 8(5): 532. https://doi.org/10.3390/jof8050532
  • Doilom M, Hyde KD, Dong W, Liao CF, Suwannarach N, Lumyong S (2021) The plant family Asteraceae is a cache for novel fungal diversity: Novel species and genera with remarkable ascospores in Leptosphaeriaceae. Frontiers in Microbiology 12: 660261. https://doi.org/10.3389/fmicb.2021.660261
  • Glez-Peña D, Gómez-Blanco D, Reboiro-Jato M, Fdez-Riverola F, Posada D (2010) ALTER: Program-oriented conversion of DNA and protein alignments. Nucleic Acids Research 38: 14–18. https://doi.org/10.1093/nar/gkq321
  • Gonçalves MF, Vicente TF, Esteves AC, Alves A (2019) Neptunomyces aureus gen. sp. nov. (Didymosphaeriaceae, Pleosporales) isolated from algae in Ria de Aveiro, Portugal. MycoKeys 60: 31–44. https://doi.org/10.3897/mycokeys.60.37931
  • Guo T, Tang WJ, Luo Y, Sun Q (2023) Impact Assessment of the Power Transmission and TransformationProject on the Biodiversity of the Provincial Nature Reserveof the Pearl River Source. Forest Investigation Design 52(3): 52–56+84.
  • Hongsanan S, Hyde KD, Phookamsak R, Wanasinghe DN, McKenzie EHC, Sarma VV, Lücking R, Boonmee S, Bhat DJ, Liu NG, Tennakoon DS, Pem D, Karunarathna A, Jiang SH, Jones EBG, Phillips AJL, Manawasinghe IS, Tibpromma S, Jayasiri SC, Sandamali D, Jayawardena RS, Wijayawardene NN, Ekanayaka AH, Jeewon R, Lu YZ, Phukhamsakda C, Dissanayake AJ, Zeng XY, Luo ZL, Tian Q, Thambugala KM, Dai DQ, Samarakoon MC, Chethana KWT, Ertz D, Doilom M, Liu JK, Pérez-Ortega S, Suija A, Senwanna C, Wijesinghe SN, Konta S, Niranjan M, Zhang SN, Ariyawansa HA, Jiang HB, Zhang JF, Norphanphoun C, de Silva NI, Thiyagaraja V, Zhang H, Bezerra JDP, Miranda-González R, Aptroot A, Kashiwadani H, Harishchandra D, Sérusiaux E, Abeywickrama PD, Bao DF, Devadatha B, Wu HX, Moon KH, Gueidan C, Schumm F, Bundhun D, Mapook A, Monkai J, Chomnunti P, Suetrong S, Chaiwan N, Bhunjun CS, Dayarathne MC, Yang J, Rathnayaka AR, Xu J, Zheng J, Liu G, Feng Y, Xie N (2020) Refned families of Dothideomycetes: Orders and families incertae. Fungal Diversity 105: 17–318. https://doi.org/10.1007/s13225-020-00462-6
  • Hyde KD, Fröhlich J, Taylor JE (1998) Fungi from palms XXXVI Reflections on unitunicate ascomycetes with apiospores. Sydowia 50: 21–80.
  • Hyde KD, Chaiwan N, Norphanphoun C, Boonmee S, Camporesi E, Chethana KWT, Dayarathne MC, de Silva NI, Dissanayake AJ, Ekanayaka AH, Hongsanan S, Huang SK, Jayasiri SC, Jayawardena RS, Jiang HB, Karunarathna A, Lin CG, Liu JK, Liu NG, Lu YZ, Luo ZL, Maharachchimbura SSN, Manawasinghe IS, Pem D, Perera RH, Phukhamsakda C, Samarakoon MC, Senwanna C, Shang QJ, Tennakoon DS, Thambugala KM, Tibpromma S, Wanasinghe DN, Xiao YP, Yang J, Zeng XY, Zhang JF, Zhang SN, Bulgakov TS, Bhat DJ, Cheewangkoon R, Goh TK, Jones EBG, Kang JC, Jeewon R, Liu ZY, Lumyong S, Kuo CH, McKenzie EHC, Wen TC, Yan JY, Zhao Q (2018) Mycosphere notes 169–224. Mycosphere: Journal of Fungal Biology 9(2): 271–430. https://doi.org/10.5943/mycosphere/9/2/8
  • Jiang HB, Phookamsak R, Hyde KD, Mortimer PE, Xu JC, Kakumyan P, Kumla J (2021) A taxonomic appraisal of bambusicolous fungi in Occultibambusaceae (Pleosporales, Dothideomycetes) with new collections from Yunnan Province, China. Life (Basel, Switzerland) 11(9): 932. https://doi.org/10.3390/life11090932
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Luo Z, Hyde KD, Bhat DJ, Jeewon R, Maharachchikumbura SSN, Bao DF, Li WL, Su XJ, Yang XY, Su HY (2018) Morphological and molecular taxonomy of novel species Pleurotheciaceae from freshwater habitats in Yunnan China. Mycological Progress 17(5): 511–530. https://doi.org/10.1007/s11557-018-1377-6
  • Ma H, Song Z, Pan X, Li Y, Yang Z, Qu Z (2022) Multi-Gene Phylogeny and Taxonomy of Hypoxylon (Hypoxylaceae, Ascomycota) from China. Diversity 14(1): 37. https://doi.org/10.3390/d14010037
  • Maharachchikumbura SS, Hyde KD, Jones EBG, McKenzie EHC, Huang SK, Abdel-Wahab MA, Daranagama DA, Dayarathne M, Dsouza MJ, Goonasekara ID, Hongsanan S, Jayawardena RS, Kirk PM, Konta S, Liu JK, Liu ZY, Norphanphoun C, Pang KL, Perera RH, Senanayake IC, Shang Q, Shenoy BD, Xiao YP, Bahkali AH, Kang JC, Somrothipol S, Suetrong S, Wen TC, Xu JC (2015) Towards a natural classification and backbone tree for Sordariomycetes. Fungal Diversity 72(1): 199–301. https://doi.org/10.1007/s13225-015-0331-z
  • Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop (GCE). New Orleans, LA, USA, 1–8. https://doi.org/10.1109/GCE.2010.5676129
  • Naranjo-Ortiz MA, Gabaldón T (2019) Fungal evolution: Major ecological adaptations and evolutionary transitions. Biological Reviews of the Cambridge Philosophical Society 94(4): 1443–1476. https://doi.org/10.1111/brv.12510
  • Niskanen T, Lücking R, Dahlberg A, Gaya E, Suz LM, Mikryukov V, Liimatainen K, Druzhinina I, Westrip JR, Mueller GM, Martins-Cunha K, Kirk P, Tedersoo L, Antonelli A (2023) Pushing the frontiers of biodiversity research: Unveiling the global diversity, distribution, and conservation of fungi. Annual Review of Environment and Resources 48(1): 149–176. https://doi.org/10.1146/annurev-environ-112621-090937
  • Nylander JAA (2004) MrModeltest 2.0. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.
  • Phukhamsakda C, Jeewon R, McKenzie EHC, Xu JC (2019) Morphology and phylogeny of Phaeoseptum mali sp. nov. (Phaeoseptaceae, Pleosporales) on bark of Malus halliana. Asian Journal of Mycology 2(1): 118–128. https://doi.org/10.5943/ajom/2/1/6
  • Raghukumar C, Raghukumar S (1998) Barotolerance of fungi isolated from deep-sea sediments of the Indian Ocean. Aquatic Microbial Ecology 15(2): 153–163. https://doi.org/10.3354/ame015153
  • Rannala B, Yang Z (1996) Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference. Journal of molecular evolution 43: 304–311. https://doi.org/10.1007/BF02338839
  • Rehner SA, Buckley E (2005) A Beauveria Phylogeny Inferred from Nuclear ITS and EF1-α Sequences: Evidence for Cryptic Diversification and Links to Cordyceps Teleomorphs. Mycologia 97(1): 84–98. https://doi.org/10.3852/mycologia.97.1.84
  • Samarakoon BC, Phookamsak R, Wanasinghe DN, Chomnunti P, Hyde KD, McKenzie EHC, Promputtha I, Xu JC, Li YJ (2020) Taxonomy and phylogenetic appraisal of Spegazzinia musae sp. nov and S. deightonii (Didymosphaeriaceae Pleosporales) on Musaceae from Thailand. MycoKeys 70: 19–37. https://doi.org/10.3897/mycokeys.70.52043
  • Senanayake IC, Rathnayaka AR, Marasinghe DS, Calabon MS, Gentekaki E, Wanasinghe DN, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS, Chomnunti P, Boonmee S, Jayawardena RS, Wijayawardene NN, Doilom M, Jeewon R, Bhat JD, Zhang HX, Xie N (2020) Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere: Journal of Fungal Biology 11(1): 2678–2754. https://doi.org/10.5943/mycosphere/11/1/20
  • Species Fungorum (2024) Species Fungorum-Search Page.
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Tanaka K, Hirayama K, Yonezawa H, Sato G, Toriyabe A, Kudo H, Hashimoto A, Matsumura M, Harada Y, Kurihara Y, Shirouzu T, Hosoya T (2015) Revision of the Massarineae (Pleosporales, Dothideomycetes). Studies in Mycology 82(1): 75–136. https://doi.org/10.1016/j.simyco.2015.10.002
  • Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8): 4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
  • Wang JF (2014) Research on the Development of Tourism Industry in the Area of Pearl River Sources. Journal of Qujing Normal University 33(02): 6–10.
  • Wang DL, Wu YM, Gao WJ (2015) Study on the Evolution of Rural Habitat in the Zhujiangyuan Nature reserve. Journal of Anhui Agriculture 43(23): 207–210.
  • White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR Protocols: A guide to methods and applications. Academic Press, San Diego, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Wijayawardene NN, Dissanayake LS, Dai DQ, Xiao YP, Wen TC, Karunarathna SC, Wu HX, Zhang H, Tibpromma S, Kang JC, Wang Y, Shen XC, Tang LZ, Deng CY, Liu YX, Kang YQ (2021) Yunnan–Guizhou Plateau: A mycological hotspot. Phytotaxa 523(1): 1–31. https://doi.org/10.11646/phytotaxa.523.1.1
  • Wijayawardene NN, Hyde KD, Dai DQ, Sánchez-García M, Goto BT, Saxena RK, Erdoğdu M, Selçuk F, Rajeshkumar KC, Aptroot A, Błaszkowski J, Boonyuen N, da Silva GA, de Souza FA, Dong W, Ertz D, Haelewaters D, Jones EBG, Karunarathna SC, Kirk PM, Kukwa M, Kumla J, Leontyev DV, Lumbsch HT, Maharachchikumbura SSN, Marguno F, Martínez-Rodríguez P, Mešić A, Monteiro JS, Oehl F, Pawłowska J, Pem D, Pfiegler WP, Phillips AJL, Pošta A, He MQ, Li JX, Raza M, Sruthi OP, Suetrong S, Suwannarach N, Tedersoo L, Thiyagaraja V, Tibpromma S, Tkalčec Z, Tokarev YS, Wanasinghe DN, Wijesundara DSA, Wimalaseana SDMK, Madrid H, Zhang GQ, Gao Y, Sánchez-Castro I, Tang LZ, Stadler M, Yurkov A, Thines M (2022a) Outline of Fungi and fungus-like taxa–2021. Mycosphere: Journal of Fungal Biology 13(1): 53–453. https://doi.org/10.5943/mycosphere/13/1/2
  • Wijayawardene NN, Phillips AJL, Pereira DS, Dai DQ, Aptroot A, Monteiro JS, Druzhinina IS, Cai F, Fan XL, Selbmann L, Coleine C, Castañeda-Ruiz RF, Kukwa M, Flakus A, Fiuza PO, Kirk PM, Kumar KCR, Arachchi ISL, Suwannarach N, Tang LZ, Boekhout T, Tan CSH, Jayasinghe RPPK, Thines M (2022b) Forecasting the number of species of asexually reproducing fungi (Ascomycota and Basidiomycota). Fungal Diversity 114(1): 463–490. https://doi.org/10.1007/s13225-022-00500-5
  • Wijayawardene NN, Dai DQ, Zhu ML, Wanasinghe DN, Kumla J, Zhang GQ, Zhang TT, Han LS, Tibpromma S, Chen HH (2022c) Fungi associated with dead branches of Magnolia grandiflora: A case study from Qujing, China. Frontiers in Microbiology 13: 954680. https://doi.org/10.3389/fmicb.2022.954680
  • Zhang Y, Fournier J, Phookamsak R, Bahkali AH, Hyde KD (2013) Halotthiaceae fam. nov. (Pleosporales) accommodates the new genus Phaeoseptum and several other aquatic genera. Mycologia 105(3): 603–609. https://doi.org/10.3852/11-286
  • Zhaxybayeva O, Gogarten JP (2002) Bootstrap, Bayesian probability and maximum likelihood mapping: Exploring new tools for comparative genome analyses. BMC Genomics 3(1): 4. https://doi.org/10.1186/1471-2164-3-4
login to comment