Research Article
Print
Research Article
Didymellaceae species associated with tea plant (Camellia sinensis) in China
expand article infoYuchun Wang‡, Yiyi Tu‡, Xueling Chen‡, Hong Jiang‡, Hengze Ren‡, Qinhua Lu§, Chaoling Wei|, Wuyun Lv‡
‡ Zhejiang A & F University, Hangzhou, China
§ Institute of Sericulture and Tea, Zhejiang Academy of Agricultural Sciences, Hangzhou, China
| Anhui Agricultural University, Hefei, China

Corresponding author: Chaoling Wei ( weichl@ahau.edu.cn )

Corresponding author: Wuyun Lv ( lvwuyun_blue@163.com )

Academic editor: Rungtiwa Phookamsak
© 2024 Yuchun Wang, Yiyi Tu, Xueling Chen, Hong Jiang, Hengze Ren, Qinhua Lu, Chaoling Wei, Wuyun Lv.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Wang Y, Tu Y, Chen X, Jiang H, Ren H, Lu Q, Wei C, Lv W (2024) Didymellaceae species associated with tea plant (Camellia sinensis) in China. MycoKeys 105: 217-251. https://doi.org/10.3897/mycokeys.105.119536
Open Access

Abstract

Tea plant is one of the most important commercial crops worldwide. The Didymellaceae fungi can cause leaf blight disease of tea plant. In this study, 240 isolates were isolated from tea plant leaves of 10 provinces in China. Combined with multi-locus (ITS, LSU, RPB2 and TUB2) phylogenetic analysis and morphological characteristics, these isolates were identified as 25 species of six genera in Didymellaceae, including 19 known species Didymella coffeae-arabicae, D. pomorum, D. segeticola, D. sinensis, Epicoccum catenisporum, E. dendrobii, E. draconis, E. italicum, E. latusicollum, E. mackenziei, E. oryzae, E. poaceicola, E. rosae, E. sorghinum, E. tobaicum, Neoascochyta mortariensis, Paraboeremia litseae, Remotididymella anemophila and Stagonosporopsis caricae, of which 15 species were new record species and six novel species, named D. yunnanensis, E. anhuiense, E. jingdongense, E. puerense, N. yunnanensis and N. zhejiangensis. Amongst all isolates, D. segeticola was the most dominant species. Pathogenicity tests on tea plant leaves showed that E. anhuiense had the strongest virulence, while E. puerense had the weakest virulence. Besides, D. pomorum, D. yunnanensis, E. dendrobii, E. italicum, E. jingdongense, E. mackenziei, E. oryzae, E. rosae, E. tobaicum, N. mortariensis, N. yunnanensis, N. zhejiangensis and R. anemophila were non-pathogenic to the tea plant.

Key words

Camellia inhibiting fungi, Didymella, distribution, Epicoccum, leaf blight, Neoascochyta, new species, pathogenicity

Introduction

Pleosporales is a predominant order with a worldwide distribution in terrestrial and aquatic environments (An et al. 2022). In these environments, Pleosporales mainly survives as saprophytic fungi on dead leaves or stems (Kodsueb et al. 2006; Zhang et al. 2009a, 2009b). It also can be endophytes, epiphytes and parasites of green leaves or stems and lichens (Calatayud et al. 2001; Kruys et al. 2006; Huang et al. 2008). Didymellaceae is one of the largest family in Pleosporales, which was established by de Gruyter et al. (2009). It is widely distributed geographically, existing in different ecosystems, such as air, soil, water, house dust and coral and parasitising in other fungi and lichens (Sutton 1980; Chen et al. 2017; Wanasinghe et al. 2018a). Previous studies have reported that this family included three main genera: Ascochyta, Didymella and Phoma, as well as other allied phoma-like genera which grouped in the Didymellaceae (Chen et al. 2017). Besides, Leptosphaerulina and Macroventura were genetically closely similar and classified into Didymellaceae (Silva-Hanlin and Hanlin 1999; Kodsueb et al. 2006; Aveskamp et al. 2010). Aveskamp et al. (2010) divided the family into at least 18 different clusters according to the sequence data obtained from 324 strains, redefining Epicoccum, Peyronellaea and Stagonosporopsis and demonstrating that Ascochyta, Phoma and Didymella were highly polyphyletic. As an extremely species-rich family, more than 5400 species belonging to 44 accepted genera have been recorded in Didymellaceae (Kularathnage et al. 2023).

Although the basic taxonomy of Didymellaceae has been established, the problem of multi-source of many genera has not been solved. Morphological characteristics, coupled with multi-gene molecular phylogeny, have developed as a more effective strategy for the identification of Didymellaceae, which has improved the understanding of the taxonomy (Hou et al. 2020a). For example, combining morphological observation and multi-locus phylogenetic analysis, based on ITS (the internal transcribed spacer region of the rDNA gene), LSU (partial large subunit nrDNA nucleotide sequences), RPB2 (the RNA polymerase II second largest subunit gene) and TUB2 (partial gene regions of β-tubulin), Chen et al. (2015a) clarified the generic delimitation in Didymellaceae. Seventeen fully-supported monophyletic branches in Didymellaceae were revealed and the generic circumscriptions of Ascochyta, Phoma and Didymella emended. Recently, 108 Didymellaceae isolates newly obtained from 40 host plant species in 27 plant families in China and other countries were investigated (Chen et al. 2017). Amongst these, 68 isolates representing 32 new taxa are recognised, based on morphological differences and the multi-locus phylogeny using sequences of ITS, LSU, RPB2 and TUB2 and a total of 19 genera are recognised in the Didymellaceae family (Chen et al. 2017). Wanasinghe et al. (2018a) isolated didymellaceous taxa from Alhagi pseudalhagi, Coronilla emerus, Cytisus sp., Elaeagnus angustifolia and Spartium junceum in Italy, Russia and Uzbekistan and present comprehensive morphological descriptions and in-depth phylogenetic investigation of five new species, including Ascochyta coronillae-emeri, Microsphaeropsis spartii-juncei, Neomicrosphaeropsis alhagi-pseudalhagi, N. cytisicola and N. elaeagni. Furthermore, as a cosmopolitan family, 1124 Didymellaceae strains globally collected from 92 countries, 121 plant families and 55 other substrates were examined via multi-locus phylogenetic analyses and detailed morphological comparisons (Hou et al. 2020b). Seven new genera, including Dimorphoma, Ectodidymella, Longididymella, Macroascochyta, Paramicrosphaeropsis, Pseudopeyronellaea and Sclerotiophoma were newly introduced in Didymellaceae (Hou et al. 2020b). In addition, 40 new species were identified combining phylogenetic analyses, based on concatenated DNA sequence dataset (ITS, LSU, RPB2 and TUB2) and morphological examination (Hou et al. 2020b). Given the above, phylogenetic analyses, based on a combined ITS-LSU- RPB2-TUB2 DNA sequence dataset, have been demonstrated as an effective method for the identification of Didymellaceae at species level (Hou et al. 2020a; Yuan et al. 2021; Kularathnage et al. 2023; Yang et al. 2023a).

Tea plant (Camellia sinensis) is one of the important commercial crops, which is widely cultivated in tropical and subtropical areas (Manawasinghe et al. 2021). Leaf blight disease caused by phytopathogens from Didymellaceae threatens the healthy growth of tea plants (Chen et al. 2017; Manawasinghe et al. 2021; Kumhar et al. 2022; Huang et al. 2023). Some species of Didymellaceae, such as Didymella segeticola, D. bellidis, Epicoccum camelliae, E. latusicollum, E. layuense and E. sorghinum, were isolated from diseased tissues (Chen et al. 2017; Ren et al. 2019; Manawasinghe et al. 2021; Wang et al. 2021). However, comprehensive understanding on the biodiversity and pathogenicity of Didymellaceae on tea plants remains unknown. Thus, to systematically and comprehensively elaborate the species of Didymellaceae in tea plant can provide further insight into the understanding of pathogens causing leaf blight disease.

In this study, 240 isolates of Didymellaceae were obtained from tea plant leaves of ten provinces in China. We aimed to clarify the classification of these isolates using phylogenetic analyses, based on the multi-locus (ITS, LSU, RPB2 and TUB2) DNA sequences and, thus, determined the biodiversity of Didymellaceae on tea plants. In addition, to evaluate the pathogenicity of isolates, we performed pathogenicity tests with 36 representative isolates on leaves of C. sinensis cv. Longjing43 (LJ43), a relative susceptible cultivar (Wang et al. 2016). The pathogenicity results will preliminarily determine the dominant species associated with leaf blight.

Materials and methods

Collection and isolates

The isolates were collected from tea plants in 15 cities of ten provinces in China, including Hangzhou (30°18'N, 120°09'E), Lishui (28°66'N, 120°09'E) and Shaoxing (30°08'N, 120°49'E) Cities in Zhejiang Province, Huangshan (29°72'N, 118°32'E) and Anqing (30°69'N, 116°40'E) Cities in Anhui Province, Yixing (31°28'N, 119°72'E) and Wuxi (31°47'N, 120°27'E) Cities in Jiangsu Province, Chengdu (30°24'N, 103°51'E) and Guangyuan (32°64'N, 105°89'E) Cities in Sichuan Province, Wuhan (30°30'N, 114°14'E) City in Hubei Province, Nanchang (28°55'N, 115°94'E) City in Jiangxi Province, Tongren (27°96'N, 109°28'E) City in Guizhou Province, Xinyang (32°12'N, 114°06'E) City in Henan Province, Yingde City (39°91'N, 116°52'E) in Guangdong Province and Puer (24°45'N, 100°83'E) City in Yunnan Province. The fungal strains were obtained by two different methods, one was tissue isolation from healthy leaves and the other was single spore isolation by scraping diseased spots from diseased leaves (Fig. 1) (Cai et al. 2009; Wang et al. 2016). For single spore isolation, spores were isolated from diseased leaves and suspended in sterilised ddH2O under sterilised conditions, then were coated on potato dextrose agar (PDA) plates and cultured at 25 °C in the dark. For tissue isolation, healthy leaves were surface-sterilised and then cultured on PDA plates at 25 °C in the dark. After 2 days, single colonies were selected and transferred to new PDA plates for further pure cultivation. For further study, pure cultures were stored in 25% glycerol at -80 °C.

Figure 1. 

Disease symptoms on Camellia sinensis caused by Didymellaceae A leaf symptom B fungal fruitbody structures formed on leaves C close-up of fungal fruitbody structures D conidia. Scale bars: 10 μm.

Type specimens of new species from this study were deposited in the Mycological Herbarium, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China (HMAS) and ex-type living cultures were deposited in the China General Microbiological Culture Collection Center (CGMCC). The descriptions of the novel species reported in this study were submitted to the MycoBank database (https://www.mycobank.org).

DNA extraction, PCR amplification and sequencing

Isolates were cultured at 28 °C in the dark for 7 days. Genomic DNA was extracted from fresh mycelia using Genomic DNA Purification Kit (Sangon Biotechnology (Shanghai) Co., Ltd., China). The fragments of ITS, LSU, RPB2 and TUB2 were amplified by PCR using the genomic DNA as the template (Chen et al. 2015a). PCR amplifications were performed in a reaction mixture consisting of 12 μl 2× Taq Master Mix, 1 μl 10 μM forward primer, 1 μl 10 μM reverse primer, 1 μl DNA template, adjusted to a final volume of 25 μl with ddH2O. Primer pairs used in this study were listed in Table 1. The PCR amplification procedures of four loci were as follows: ITS, predenaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 48 °C for 30 s and extension at 72 °C for 2 min, with the final extension at 72 °C for 10 min; LSU, predenaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at 48 °C for 45 s and extension at 72 °C for 2 min, with the final extension at 72 °C for 10 min; RPB2, predenaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 45 s, annealing at 56 °C for 80 s and extension at 72 °C for 2 min, with the final extension at 72 °C for 10 min; TUB2, predenaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 52 °C for 30 s and extension at 72 °C for 80 s, with the final extension at 72 °C for 10 min. The PCR products were visualised using 1% agarose electrophoresis gels. Sequencing was performed by Youkang Biotechnology (Hangzhou) Co., Ltd., China.

Table 1.
Download as
CSV
XLSX

Primer pairs used in this study.

Gene Primer Primer sequence (5’-3’)
ITS ITS5 GGAAGTAAAAGTCGTAACAAGG
ITS4 TCCTCCGCTTATTGATATGC
LSU LROR GTACCCGCTGAACTTAAGC
LR7 TACTACCACCAAGATCT
RPB2 RPB2-5f2 GGGGWGAYCAGAAGAAGGC
RPB2-7cR CCCATRGCTTGYTTRCCCAT
TUB2 Btub2Fd GTBCACCTYCARACCGGYCARTG
Btub4Rd CCRGAYTGRCCRAARACRAAGTTGTC

Phylogenetic analysis

Sequences of the ITS, LSU, RPB2 and TUB2 loci for all the isolates were blasted against the National Center for Biotechnology Information (NCBI) GenBank nucleotide datasets (http://www.ncbi.nlm.nih.gov/Blast.cgi) (Suppl. material 1). Alignments of ITS, LSU, RPB2 and TUB2 sequences were generated with MAFFT v.7.525 (Katoh et al. 2019) and MEGA v.6.0 software was used for manual correction (Tamura et al. 2013). To investigate the phylogenetic relationships between different isolates, both Bayesian Inference (BI) and Maximum Likelihood (ML) methods were used and followed by the concatenated alignments (Han et al. 2023). For BI analysis, Markov Chain Monte Carlo (MCMC) sampling was used to reconstruct phylogenies in MrBayes v.3.2 (Ronquist and Huelsenbeck 2003). For ML analysis, the substitution model (GTR + I + G model with gamma-distributed rate) were selected (Wang et al. 2016). Phylograms were created in FigTree v. 1.3.1 (Rambaut and Drummond 2008) and edited in Adobe Illustrator 2022 (available from https://www.adobe.com/cn/creativecloud/roc/business.html).

Morphology

Isolates were grown on oatmeal agar (OA) and PDA plates and cultured at 28 °C for 7 days (Hou et al. 2020b). Colony diameters of each strain with three replicates were then measured and repeated at least three times. The morphological characteristics were determined after another 7 days (Boerema et al. 2004). The shape, colour and size of mature pycnidia and conidia were observed under light microscopy (SOPTOP-CX40RFL, China). Sizes of at least 30 conidia were measured with the light microscopy. The description of new species is mainly based on the morphology of colony, conidia and pycnidia, conidia size, colony growth rate and aerial hyphae on OA and PDA.

Pathogenicity tests

Asymptomatic leaves were collected from 5-year-old LJ43 grown in a tea garden in Hangzhou, Zhejiang Province, China. The fourth leaf of current-growth branches was cut off for the analysis. The detached leaves were surface-sterilised with 75% alcohol and washed with sterilised ddH2O twice and air dried. A 5-mm mycelial disc cut from the edge of 7-day-old cultures was inoculated both sides of leaves after wounding with a sterilised needle (using a pattern of puncture perpendicular to the leaf to create the same number of wounds and this pattern was applied uniformly across all leaves) and cultured directly on a moist surface in the dark with 100% humidity at 28 °C for 3 days (Solarte et al. 2017). After 3 days, the lesion diameters were measured and photographed. Each strain with at least three replicates was repeated three times. Thirty-six representative isolates were selected for the pathogenicity test, including D. pomorum YCW196, D. segeticola YCW109, YCW192, YCW1135, YCW1289 and YCW2007, D. sinensis YCW1884 and YCW2118, D. yunnanensis CGMCC 3.24241 (YCW1909), E. anhuiense YCW961 and YCW1829, E. dendrobii YCW1866, E. draconis YCW101 and YCW187, E. italicum YCW2005, E. jingdongense YCW1868 and YCW1937, E. latusicollum YCW1921, E. mackenziei YCW1965 and YCW1967, E. oryzae YCW2010, E. poaceicola YCW1948 and YCW2115, E. rosae YCW331, E. poerense YCW224 and YCW2117, E. tobaicum YCW372, Neoascochyta mortariensis YCW1346, N. yunnanensis YCW1883, N. zhejiangensis YCW1361 and YCW1107, Paraboeremia litseae YCW1356 and YCW1363, Remotididymella anemophila YCW434 and Stagonosporopsis caricae YCW1928 and YCW1977.

Statistical analysis

The average value of all measurements was analysed using the SPSS Inc. software (IBM, New York, USA). The lesion sizes data were analysed with one-way ANOVA (analysis of variance) and the least significant difference (LSD) test and the values were presented as the mean ± SE (standard error) of three repeats. A P value < 0.05 was considered statistically significant according to the LSD test.

Results

Isolates and phylogenetic analysis

In this study, 240 isolates were obtained from tea plant leaves of ten provinces in China. A multi-locus phylogeny was constructed, based on four loci (ITS, LSU, RPB2 and TUB2). The ML tree from each alignment is presented, with bootstrap support values and Bayesian posterior values plotted at each node. All isolates were recognised and clustered into six genera in Didymellaceae, including Didymella, Epicoccum, Neoascochyta, Paraboeremia, Remotididymella and Stagonosporopsis.

For Didymella genus, phylogenetic analysis was performed with the combined sequence data from 227 isolates, including 45 referenced strains and 182 newly-sequenced strains. The 227 isolates comprised 2453 characters (ITS = 1–540 bp, LSU = 1504–2465 bp, RPB2 = 545–1146 bp and TUB2 = 1151–1499 bp) after alignment. Pleiochaeta setosa CBS 118.25 / CBS 496.63 and Coniothyrium palmarum CBS 400.71 were used as the outgroup. Of the 182 new isolates, 171 isolates clustered with D. segeticola and retrieved 92% ML and 0.90 PP support, eight clustered with D. sinensis (99% in ML and 1 in PP), one clustered with D. pomorum (100% in ML and 1 in PP) and one clustered with D. coffeae-arabicae (94% in ML and 1 in PP). One isolate formed a new clade named D. yunnanensis (88% in ML and 0.92 in PP), which showed a close phylogenetic affinity to D. prosopidis (CBS 136414, CPC 21704 and BRIP 69579) (Fig. 2).

Figure 2. 

Phylogenetic tree generated by Maximum Likelihood analysis, based on the combined ITS, LSU, RPB2 and TUB2 dataset of Didymella species. Bootstrap support values above 50% and Bayesian posterior values above 0.75 are shown at each node (ML/PP). Pleiochaeta setosa CBS 118.25 / CBS 496.63 and Coniothyrium palmarum CBS 400.71 are used as outgroups. Ex-type strains are emphasised in bold.

For Epicoccum genus, phylogenetic analysis was performed with the combined sequence data from 114 isolates, including 68 referenced strains and 46 newly-sequenced strains. The 114 isolates comprised 2466 characters (ITS = 1–559 bp, LSU = 1516–2478 bp, RPB2 = 564–1162 bp and TUB2 = 1167–1511 bp) after alignment. Pleiochaeta setosa CBS 118.25 / CBS 496.63 and Co. palmarum CBS 400.71 were used as the outgroups. Of the 46 new isolates, seven isolates clustered with E. poaceicola (78% in ML and 0.96 in PP), three clustered with E. latusicollum (84% in ML and 1 in PP), one clustered with E. sorghinum (99% in ML and 1 in PP), one clustered with E. catenisporum (99% in ML and 1 in PP), three clustered with E. dendrobii (89% in ML and 0.95 in PP), two clustered with E. draconis (96% in ML and 0.76 in PP), five clustered with E. tobaicum (96% in ML and 0.90 in PP), three clustered with E. rosae (97% in ML and 1 in PP), two clustered with E. mackenziei (88% in ML and 0.98 in PP), one clustered with E. oryzae (99% in ML and 1 in PP), one clustered with E. italicum (100% in ML and 1 in PP) and 17 unidentified isolates did not match any known lineage of Epicoccum species. Amongst the 17 unidentified isolates, six isolates formed a new monophyletic clade named E. anhuiense with support values 96% in ML and 0.68 in PP, six formed a new clade named E. jingdongense showing a close phylogenetic affinity to E. dendrobii in the combined phylogeny with 83% ML and 0.99 PP support and five formed a new monophyletic clade named E. puerense with high support (98% in ML and 0.92 in PP) (Fig. 3).

Figure 3. 

Phylogenetic tree generated by Maximum Likelihood analysis, based on the combined ITS, LSU, RPB2 and TUB2 dataset of Epicoccum species. Bootstrap support values above 50% and Bayesian posterior values above 0.75 are shown at each node (ML/PP). Pleiochaeta setosa CBS 118.25 / CBS 496.63 and Co. palmarum CBS 400.71 are used as outgroups. Ex-type strains are emphasised in bold.

For other genera, phylogenetic analysis was performed with the combined sequence data from 56 isolates, including 44 referenced strains and 12 newly-sequenced strains. The 56 isolates comprised 2385 characters (ITS = 1–480 bp, LSU = 1435–2397 bp, RPB2 = 485–1080 bp and TUB2 = 1085–1430 bp) after alignment. Pleiochaeta setosa CBS 118.25 / CBS 496.63 was used as the outgroup. Of the 12 new isolates, two isolates clustered with Stagonosporopsis caricae (99% in ML and 1 in PP), three clustered with Remotididymella anemophila (100% in ML and 1 in PP), two clustered with Paraboeremia litseae (94% in ML and 1 in PP) and one clustered with Neoascochyta mortariensis (100% in ML and 1 in PP). One isolate formed a new clade named N. yunnanensis and showed a close phylogenetic affinity to N. rosicola (MFLUCC 15-0048) in the combined phylogeny and this relationship retrieved 99% ML and 1 PP support. Two isolates formed a new monophyletic clade named N. zhejiangensis with high support (100% in ML and 1 in PP). Unfortunately, the non-viability of YCW1124 resulted in the failure of identification, so it was tentatively determined as unidentified species Neoascochyta sp. (Fig. 4).

Figure 4. 

Phylogenetic tree generated by Maximum Likelihood analysis, based on the combined ITS, LSU, RPB2 and TUB2 dataset of Neoascochyta, Paraboeremia, Remotididymella and Stagonosporopsis species. Bootstrap support values above 50% and Bayesian posterior values above 0.75 are shown at each node (ML/PP). Pleiochaeta setosa CBS 118.25 / CBS 496.63 is used as the outgroup. Ex-type strains are emphasised in bold.

Morphology and taxonomy

Based on the multi-locus phylogenetic analysis, six species are delineated as new and their morphological characteristics are described below. In addition, 15 new record species and three known species are noted.

Didymella coffeae-arabicae (M. M. Aveskamp et al.) Q. Chen et al., Studies in Mycology. 82: 175. 2015a

Description

see Aveskamp et al. (2009).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis cv. Longjing43, 13 Jun 2020, Y. C. Wang, culture YCW1972.

Notes

Didymella coffeae-arabicae was introduced as Phoma coffeae-arabicae before the comprehensive revision of Didymellaceae (Chen et al. 2015a). The sexual morph of D. coffeae-arabicae was reported by Samaradiwakara et al. (2023). It forms pseudo-sclerotioid chlamydospores and is easily recognised by its conspicuously wide ostiole and is phylogenetically related to a group that mainly comprises Peyronellaea species forming alternarioid-botryoid chlamydospores (Aveskamp et al. 2009). Didymella coffeae-arabicae caused leaf cankers of Castanea mollissima in China (Jiang et al. 2021). In the present study, one isolate from healthy tea plant leaves grouped with D. coffeae-arabicae with high statistical support (Fig. 2). This is the first report of D. coffeae-arabicae isolated from C. sinensis.

Didymella pomorum (Thüm.) Q. Chen & L. Cai, Studies in Mycology. 82: 179. 2015a

Description

see Boerema (1993).

Materials examined

China, Yunnan Province, from diseased leaves of C. sinensis cv. Dalicha, 22 Jun 2019, Y. C. Wang, culture YCW196.

Notes

Didymella pomorum was introduced as Phoma pomorum before the comprehensive revision of Didymellaceae (Chen et al. 2015a). Chen et al. (2015a) regarded four taxa of the respective Phoma pomorum varieties, viz. vars. circinata (CBS 285.76), cyanea (CBS 388.80) and pomorum (CBS 539.66) and the species Ph. triticina (CBS 354.52) to be conspecific and treated them as a single species D. pomorum. Pycnidia produced by this species are usually subglobose-ampulliform with a distinct ostiole (Boerema 1993). It can cause leaf spots on many plants (Boerema 1993; Romero et al. 2021). In the present study, one isolate from diseased tea plant leaves is closely related to D. sinensis with high statistical support (Fig. 2). This is the first report of D. pomorum isolated from C. sinensis.

Didymella segeticola (Q. Chen) Q. Chen et al., Studies in Mycology. 87: 138. 2017

Description

see Chen et al. (2015b).

Materials examined

China, Jiangsu Province, Yixing City, Zhangzhu Town, Furong Village, from diseased leaves of C. sinensis cv. Longjing43, 19 Jun 2019, Y. C. Wang, culture YCW109. Zhejiang Province, Lishui City, from diseased leaves of C. sinensis cv. Baiye1, 22 Jun 2019, Y. C. Wang, culture YCW192. Zhejiang Province, Hangzhou City, from diseased leaves of C. sinensis cv. Longjing43, 6 Jun 2018, Y. C. Wang, culture YCW1289.

Notes

Didymella segeticola was introduced as Phoma segeticola before the comprehensive revision of Didymellaceae (Chen et al. 2015a). Under the current circumstance of Didymellaceae, it belongs to Didymella. Didymella segeticola can develop abundant aerial mycelium and black pycnidia on oatmeal agar (OA) plates (Chen et al. 2015b). Zhao et al. (2018) first reported that D. segeticola can cause tea leaf spot in the tea plantations in Guizhou Province, which results in leaf fall and a huge loss of tea leaves. In the present study, 171 isolates from diseased tea plant leaves formed a monophyletic subclade, closely related to D. bellidis with high statistical support (Fig. 2).

Didymella sinensis (Q. Chen) Q. Chen et al., Studies in Mycology. 87: 138. 2017

Description

see Chen et al. (2017).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture YCW2118.

Notes

Didymella sinensis is closely related to D. pomorum. It can be observed from different host plants in a wide range, such as Cerasus pseudocerasus (Rosaceae), Dendrobium officinale (Orchidaceae) and Urticaceae. The sexual morph was characterised by ascomata aggregated, globose to irregular, brown, small and papillate. Asci were bitunicate, clavate to short cylindrical; Ascospores were biseriate, ellipsoidal, straight to slightly curved, hyaline, apex obtuse, medianly 1-septate (Chen et al. 2017). In the present study, eight isolates from healthy tea plant leaves phylogenetically grouped with D. sinensis with high statistical support (Fig. 2). This is the first report of D. sinensis isolated from C. sinensis.

Didymella yunnanensis Y. Wang, Y. Tu, X. Chen, H. Jiang, H. Ren, Q. Lu, C. Wei & W. Lv, sp. nov.

MycoBank No: 848984
Fig. 5

Etymology

Named after the location where it was collected, Yunnan Province.

Description

Sexual morph : undetermined. Asexual morph: Pycnidia smooth, subglobose to ellipsoidal, hyaline. Conidia ellipsoidal to subcylindrical, pale, smooth- and thin-walled, abundant, generated from pycnidia, aseptate, 4–6.5 × 1.8–2.6 µm (av. = 5.2 ± 0.5 × 2.3 ± 0.2 µm, n = 30). Mycelia sparsely branched from subapical hyphal compartments (lateral branching), septate, hyaline.

Culture characteristics

Colonies on PDA have scarce aerial mycelium reaching 24–27 mm diam. after being cultured for 7 days at 28 °C in the dark, margin regular, olive in the centre, white edges; black on the reverse, white edges. Pycnidia and conidia produced on the colony surface after being cultured for 14 days at 28 °C in the dark. Colonies on OA reaching 18–21 mm diam. after 7 days at 28 °C in the dark, margin regular, aerial mycelium flat, black in the centre, white edges; olive on the reverse, white edges.

Figure 5. 

Didymella yunnanensis CGMCC 3.24241 (YCW1909) A, B colony on PDA (front and reverse) C, D colony on OA (front and reverse) E myceli F pycnidia forming on PDA G conidia. Scale bars: 10 μm (E–G).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis cv. Longjing43, 16 Jun 2020, Y. C. Wang, Holotype HMAS 352387, culture ex-type CGMCC 3.24241 = YCW1909.

Notes

Didymella yunnanensis is closely related to D. prosopidis with high statistical support (88%/0.92, ML/PP, Fig. 2). Didymella yunnanensis has 85 bp differences in LSU locus from D. prosopidis. In addition, D. yunnanensis can be distinguished from D. prosopidis by the morphological features of conidia and the conidia size of D. yunnanensis (4–6.5 × 1.8–2.6 µm) is smaller than that of D. prosopidis (5–7 × 2.5–3.5 µm). In the present study, Didymella yunnanensis was isolated from healthy tea plant leaves.

Epicoccum anhuiense Y. Wang, Y. Tu, X. Chen, H. Jiang, H. Ren, Q. Lu, C. Wei & W. Lv, sp. nov.

MycoBank No: 848998
Fig. 6

Etymology

Named after the location where it was collected, Anhui Province.

Description

Sexual morph : undetermined. Asexual morph: Pycnidia smooth, subglobose to ellipsoidal, pale brown, attached to mycelium. Conidia ellipsoidal to subcylindrical, pale yellow to green, smooth- and thin-walled, abundant, generated from pycnidia, composed of a single cell, 10.5–16 × 4.5–8 µm (av. = 13.4 ± 1.4 × 6.3 ± 0.7 µm, n = 30). Mycelia lateral branching, septate, hyaline.

Culture characteristics

Colonies on PDA reaching 75–79 mm diam. after 7 days at 28 °C in the dark, margin regular, covered by floccose aerial mycelium, greyish; reverse pale brown to pale buff, white edges. Pycnidia and conidia produced on the colony surface after being cultured for 14 days at 28 °C in the dark. Colonies on OA reaching 81–85 mm diam. after 7 days at 28 °C in the dark, margin irregular, aerial mycelium flat, whitish; reverse concolorous.

Figure 6. 

Epicoccum anhuiense YCW961 A, B colony on PDA (front and reverse) C, D colony on OA (front and reverse) E mycelia F pycnidia forming on PDA G conidia. Scale bars: 10 μm (E–G).

Materials examined

China, Anhui Province, Anqing City, from diseased leaves of C. sinensis cv. Longjingchangye, 16 Nov 2019, Y. C. Wang, Holotype HMAS 352388, culture ex-type CGMCC 3.24242 = YCW961. Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from health leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture ex-type CGMCC 3.24246 = YCW1829.

Notes

Epicoccum anhuiense is closely related to E. latusicollum with high statistical support (Fig. 3). Epicoccum anhuiense has 5 bp differences in the TUB2 sequence from E. latusicollum. In addition, E. anhuiense can be distinguished from E. latusicollum by the morphological features of its conidia and the conidia size of E. anhuiense (10.5–16 × 4.5–8 µm) is larger than that of D. prosopidis (4–6.5 × 2–3 µm). In the present study, eight strains were isolated from healthy or diseased tea plant leaves.

Epicoccum catenisporum N. Valenzuela-Lopez et al., Studies in Mycology. 90: 30. 2018

Description

see Valenzuela-Lopez et al. (2018).

Materials examined

China, Jiangxi Province, Nanchang City, from diseased leaves of C. sinensis cv. Zhenong139, 22 Jun 2019, Y. C. Wang, culture YCW142.

Notes

Epicoccum catenisporum was introduced as Phoma catenisporum before the comprehensive revision of Epicoccum (Chen et al. 2015a). It was first isolated from a leaf spot of Oryza sativa in Guinea-Bissau and morphologically characterised by the production of pycnidia as observed in several other members of Epicoccum (Valenzuela-Lopez et al. 2018). Conidiogenous cells were phialidic, hyaline, doliiform or ampulliform and conidia were aseptate, hyaline ovoid or ellipsoidal and guttulate (Valenzuela-Lopez et al. 2018). In the present study, one isolate from diseased tea plant leaves grouped with E. catenisporum (CBS 181.80) with high statistical support (Fig. 3). This is the first report of E. catenisporum isolated from C. sinensis.

Epicoccum dendrobii Q. Chen et al., Studies in Mycology. 87: 140. 2017

Description

see Chen et al. (2017).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture YCW1866.

Notes

Epicoccum dendrobii formed a distinct clade, closely related to E. jingdongense and E. puerense (Fig. 3). It produced typical epicoccoid conidia (multicellular-phragmosporous, verrucose). In the present study, three strains were isolated from healthy or diseased tea plant leaves. This is the first report of E. dendrobii isolated from C. sinensis.

Epicoccum draconis (Berk. ex Cooke) Q. Chen et al., Studies in Mycology. 82: 172. 2015b

Description

see de Gruyter et al. (1998).

Materials examined

China, Jiangsu Province, Yixing City, Zhangzhu Town, Furong Village, from diseased leaves of C. sinensis cv. Longjing43, 19 Jun 2019, Y. C. Wang, culture YCW101.

Notes

Epicoccum draconis was introduced as Phyllosticta draconis and Phoma draconis previously (Chen et al. 2017). It formed a new combination by the ellipsoidal conidia (Chen et al. 2017). In the present study, two isolates from diseased tea plant leaves grouped with E. draconis with high statistical support (Fig. 3). This is the first report of E. draconis causing leaf blight on C. sinensis.

Epicoccum italicum Q. Chen et al., Studies in Mycology. 87: 144. 2017

Description

see Chen et al. (2017).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture YCW2005.

Notes

Phylogenetically, Epicoccum italicum formed a distinct lineage closely related to E. oryzae (Fig. 3). Epicoccum italicum produced epicoccoid conidia and clavate conidiomata (Chen et al. 2017). It was first isolated from seedlings of Acca sellowiana in Italy (Chen et al. 2017) and reported in the dairy setting (Rodríguez et al. 2023). In addition, this species significantly reduced both leaf area of soybean consumed aboveground by caterpillars and number of cysts produced belowground by nematodes (Rivera-Vega et al. 2022). In the present study, one strain was isolated from healthy tea plant leaves. This is the first report of E. italicum isolated from C. sinensis.

Epicoccum jingdongense Y. Wang, Y. Tu, X. Chen, H. Jiang, H. Ren, Q. Lu, C. Wei & W. Lv, sp. nov.

MycoBank No: 849000
Fig. 7

Etymology

Named after the location where it was collected, Jingdong Yizu Autonomous County.

Description

Sexual morph : undetermined. Asexual morph: Pycnidia smooth, subglobose, pale brown. Conidia ellipsoidal to subcylindrical, pale yellow, smooth, generated from pycnidia, aseptate, 7.1–16 × 4–9 µm (av. = 10.7 ± 1.2 × 5.4 ± 0.6 µm, n = 30). Mycelia extensively branched from subapical hyphal compartments, septate, hyaline.

Culture characteristics

Colonies on PDA reaching 35–42 mm diam. after 7 days at 28 °C in the dark, margin irregular, aerial mycelium flat, pale brown to rosy, white edges; reverse black to brown, pale buff edges. Pycnidia and conidia produced on the colony surface after being cultured for 14 days at 28 °C in the dark. Colonies on OA reaching 49–55 mm diam. after 7 days at 28 °C in the dark, margin regular, aerial mycelium flat, pale buff to whitish; reverse concolorous.

Figure 7. 

Epicoccum jingdongense YCW1868 A, B colony on PDA (front and reverse) C, D colony on OA (front and reverse) E mycelia F pycnidia forming on PDA G conidia. Scale bars: 10 μm (E–G).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, Holotype HMAS 352389, culture ex-type CGMCC 3.24247 = YCW1868. Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture ex-type CGMCC 3.24248 = YCW1937.

Notes

Epicoccum jingdongense is closely related to E. dendrobii and E. puerense with high statistical support (83%/0.99, ML/PP, Fig. 3). Epicoccum puerense differs in 1 bp in ITS and 40 bp in TUB2 from E. dendrobii. The conidia size is larger than that of E. dendrobii. In the present study, six strains were isolated from healthy tea plant leaves. It was isolated and identified from tea plant for the first time.

Epicoccum latusicollum Q. Chen et al., Studies in Mycology. 87: 144. 2017

Description

see Chen et al. (2017).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture YCW1921.

Notes

Isolates of Epicoccum latusicollum were clustered into a sister clade to E. poaceicola and E. sorghi (Fig. 3). Pycnidia were black-brown and mostly spheroid and conidia were ellipsoidal to oblong, aseptate and hyaline (Chen et al. 2017; Li et al. 2023). It was first discovered from Acer palmatum (Aceraceae), Camellia sinensis (Theaceae), Podocarpus macrophyllus (Podocarpaceae) and Vitex negundo (Verbenaceae) (Chen et al. 2017). As a phytopathogen, it can cause leaf spot, leaf blight and stalk rot on many plants (Xu et al. 2022; Li et al. 2023; Wang et al. 2023). In the present study, three strains were isolated from healthy tea plant leaves.

Epicoccum mackenziei S. C. Jayasiri et al., Mycosphere 8: 1093. 2017

Description

see Jayasiri et al. (2017).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture ex-type CGMCC 3.24244 = YCW1965 and culture ex-type CGMCC 3.24245 = YCW1967.

Notes

Epicoccum mackenziei formed a distinct clade basal to E. endophyticum (Fig. 3). It was found as the sexual morph in nature and as chlamydospores in culture. Zhang et al. (2023) first reported that E. mackenziei caused dark brown spot of tea leaf in China. In the present study, two strains were isolated from healthy tea plant leaves.

Epicoccum oryzae S. Ito & Iwadare, Report of the Hokkaido Prefectural Agricultural Experiment Station 31: 1. 1934

Description

see Hou et al. (2020b).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture YCW2010.

Notes

Epicoccum oryzae was synonymised as E. nigrum previously (Schol – Schwarz 1959). It was resurrected as a separate species, distant from E. nigrum and CBS 173.34 was proposed as the ex-neotype of E. oryzae (Hou et al. 2020b). Epicoccum oryzae is characterised by “olivaceous hyphae, globose or subglobose sporodochia and globose, subglobose or pyriform, granular, verrucose, olivaceous conidia, consisting of one to five cells” (Hou et al. 2020b). It clustered into a sister clade to E. endophyticum and E. mackenziei (Fig. 3). In the present study, one isolate from healthy tea plant leaves grouped with E. draconis (CBS 173.34 and CBS 174.34) with high statistical support (Fig. 3). This is the first report of E. oryzae isolated from C. sinensis.

Epicoccum poaceicola Thambugala & K.D. Hyde, Mycosphere. 8: 711. 2017

Description

see Thambugala et al. (2017).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture YCW1948.

Notes

Epicoccum poaceicola is described as a new phoma-like species, based on phylogenetic analysis. It formed a distinct lineage closely related to E. sorghi (Fig. 3). Conidia produced by E. poaceicola were ellipsoidal to cylindrical and sometimes with small guttules (Thambugala et al. 2017). Epicoccum poaceicola can cause leaf spot in bamboo, camphor tree and eggplant (Liu et al. 2020; Li et al. 2022; Aementado and Balendres 2023). In the present study, seven strains were isolated from healthy tea plant leaves. This is the first report of E. poaceicola isolated from C. sinensis.

Epicoccum puerense Y. Wang, Y. Tu, X. Chen, H. Jiang, H. Ren, Q. Lu, C. Wei & W. Lv, sp. nov.

MycoBank No: 848999
Fig. 8

Etymology

Named after the location where it was collected, Puer City.

Description

Sexual morph : undetermined. Asexual morph: Pycnidia smooth, subglobose to ellipsoidal, hyaline. Conidia were not of uniform size, ellipsoidal to subcylindrical, pale yellow to green, smooth- and thin-walled, abundant, generated from pycnidia, aseptate, 6.8–15 × 3.6–7.2 µm (av. = 9.7 ± 1.9 × 4.7 ± 0.7 µm, n = 30). Mycelia lateral branching, septate, hyaline.

Culture characteristics

Colonies on PDA reaching 32–41 mm diam. after 7 days at 28 °C in the dark, margin irregular, aerial mycelium flat, olivaceous to buff, white edges; reverse black to brown, pale buff edges. Pycnidia and conidia produced on the colony surface after cultured for 14 days at 28 °C in the dark. Colonies on OA reaching 51–58 mm diam. after 7 days at 28 °C in the dark, margin regular, aerial mycelium flat, rosy to pale green, white edges; reverse pale buff to whitish.

Figure 8. 

Epicoccum puerense YCW2117 A, B colony on PDA (front and reverse) C, D colony on OA (front and reverse) E mycelia F pycnidia forming on PDA G conidia. Scale bars: 10 μm (E–G).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from diseased leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, Holotype HMAS 352390, culture ex-type CGMCC 3.24249 = YCW2117. Yunnan Province, from healthy leaves of C. sinensis cv. Dalicha, 22 Jun 2019, Y. C. Wang, culture ex-type CGMCC 3.24243 = YCW224.

Notes

Epicoccum puerense is closely related to E. dendrobii with high statistical support (Fig. 3). Epicoccum puerense has 1 bp difference in ITS from E. dendrobii. The conidia size is larger than that of E. dendrobii. In the present study, five strains were isolated from healthy or diseased tea plant leaves. It was isolated and identified from tea plant for the first time.

Epicoccum rosae D. N. Wanasinghe et al., Fungal Diversity. 89: 29. 2018

Description

see Wanasinghe et al. (2018b).

Materials examined

China, Hubei Province, Wuhan City, Jiangxia District, from diseased leaves of C. sinensis cv. Yulv, 10 Jul 2019, Y. C. Wang, culture YCW331.

Notes

Epicoccum rosae had pycnidial conidiomata with hyaline conidia and hyphomycetous dark sporodochia with branched conidiophores and verruculose, muriform chlamydospores. It formed a distinct lineage closely related to E. tobaicum (Fig. 3). In the present study, three strains were isolated from diseased tea plant leaves. This is the first report of E. rosae isolated from C. sinensis.

Epicoccum tobaicum (Svilv.) L.W. Hou et al., Studies in Mycology. 96: 348. 2020

Description

see von Szilvinyi (1936).

Materials examined

China, Anhui Province, Huangshan City, from diseased leaves of C. sinensis cv. Zhonghuang1, 2 Jul 2019, Y.C. Wang, culture YCW372.

Notes

Epicoccum tobaicum was synonymised as E. nigrum previously (Hou et al. 2020b). It was resurrected as a separate species, distant from E. nigrum (Hou et al. 2020b). Conidia were globular to pear-shaped, dark, verrucose and multicellular (Han et al. 2021). It formed a distinct lineage closely related to E. rosae (Fig. 3). This species as a pathogen was isolated from diseased leaves showing leaf spot of flowering cherry and oat (Han et al. 2021; Jeong et al. 2022a). In the present study, five strains were isolated from diseased tea plant leaves. This is the first report of E. tobaicum isolated from C. sinensis.

Neoascochyta mortariensis L.W. Hou et al., Studies in Mycology. 96: 391. 2020

Description

see Hou et al. (2020b).

Materials examined

China, Zhejiang Province, Hangzhou City, from healthy leaves of C. sinensis cv. Longjing43, 16 Nov. 2017 Y. C. Wang, culture ex-type CGMCC 3.24251 = YCW1346.

Notes

Neoascochyta mortariensis was introduced as Didymella graminicola previously. It was described as a new species in Neoascochyta, distant from the authentic culture of D. graminicola (currently: Neoascochyta graminicola) (Hou et al. 2020b). Neoascochyta mortariensis was first isolated from Oryza sativa in Italy and formed colonies on PDA covered by dense felty aerial mycelium (Hou et al. 2020b). It formed a distinct lineage closely related to N. tardicrescens (Fig. 4). In the present study, one strain was isolated from diseased tea plant leaves. This is the first report of N. mortariensis isolated from C. sinensis.

Neoascochyta yunnanensis Y. Wang, Y. Tu, X. Chen, H. Jiang, H. Ren, Q. Lu, C. Wei & W. Lv, sp. nov.

MycoBank No: 849001
Fig. 9

Etymology

Named after the location where it was collected, Yunnan Province.

Description

Sexual morph : undetermined. Asexual morph: Pycnidia smooth, subglobose to ellipsoidal, hyaline. Conidia ellipsoidal to subcylindrical, pale yellow to green, smooth- and thin-walled, abundant, generated from pycnidia, aseptate, 8.5–11.7 × 4.5–7 µm (av. = 9.9 ± 0.9 × 5.4 ± 0.6 µm, n = 30). Mycelia lateral branching, septate, hyaline.

Culture characteristics

Colonies on PDA reaching 42–45 mm diam. after 7 days 28 °C in the dark, margin regular, aerial mycelium flat, whitish; reverse black to pale buff. Pycnidia and conidia produced on the colony surface after being cultured for 14 days at 28 °C in the dark. Colonies on OA reaching 34 – 39 mm diam. after 7 days at 28 °C in the dark, margin irregular, aerial mycelium flat, black in the centre, white edges; reverse concolorous.

Figure 9. 

Neoascochyta yunnanensis YCW1883 A, B colony on PDA (front and reverse) C, D colony on OA (front and reverse) E mycelia F pycnidia forming on PDA G conidia. Scale bars: 10 μm (E–G).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, Holotype HMAS 352391, culture ex-type CGMCC 3.24253 = YCW1883.

Notes

Neoascochyta yunnanensis is closely related to N. rosicola with high statistical support (99%/1, ML/PP, Fig. 4). Neoascochyta yunnanensis has 2 bp differences in ITS from N. rosicola. In the present study, one strain was isolated from healthy tea plant leaves. It was isolated and identified from tea plant for the first time.

Neoascochyta zhejiangensis Y. Wang, Y. Tu, X. Chen, H. Jiang, H. Ren, Q. Lu, C. Wei & W. Lv, sp. nov.

MycoBank No: 849002
Fig. 10

Etymology

Named after the location where it was collected, Zhejiang Province.

Description

Sexual morph : undetermined. Asexual morph: Pycnidia smooth, subglobose to ellipsoidal, hyaline. Conidia biconical to subcylindrical, hyaline, smooth- and thin-walled, abundant, generated from pycnidia, aseptate, 4.8–6.5 × 2.9–4.2 µm (av. = 5.6 ± 0.5 × 3.6 ± 0.3 µm, n = 30). Mycelia lateral branching or uniaxial branching, septate, hyaline.

Figure 10. 

Neoascochyta zhejiangensis YCW1107 A, B colony on PDA (front and reverse) C, D colony on OA (front and reverse) E mycelia F pycnidia forming on PDA G conidia. Scale bars: 10 μm (E–G).

Culture characteristics

Colonies on PDA reaching 65–69 mm diam. after 7 days at 28 °C in the dark, margin regular, aerial mycelium flat, whitish; reverse black, white edges. Pycnidia and conidia produced on the colony surface after being cultured for 14 days at 28 °C in the dark. Colonies on OA reaching 53–57 mm diam. after 7 days at 28 °C in the dark, margin regular, aerial mycelium flat, whitish; reverse olivaceous, white edges.

Materials examined

China, Zhejiang Province, Hangzhou City, from diseased leaves of C. sinensis cv. Longjing43, Jun 2014, Y. C. Wang, Holotype HMAS 352392, culture ex-type CGMCC 3.24250 = YCW1107. Yunnan Province, from diseased leaves of C. sinensis, 23 Mar 2020, Y. C. Wang, culture CGMCC 3. YCW1361.

Notes

Neoascochyta zhejiangensis is closely related to N. cylindrispora with high statistical support (82%/77, ML/PP, Fig. 4). Neoascochyta Cylindrispora differs in 1 bp in ITS, 16 bp in TUB2 and 95 bp in LSU from N. zhejiangensis. In the present study, two strains were isolated from healthy tea plant leaves.

Paraboeremia litseae J. R. Jiang et al., Mycological Progress. 16: 291. 2017

Description

see Jiang et al. (2017).

Materials examined

China, Yunnan Province, from diseased leaves of C. sinensis, 23 Mar 2020, Y. C. Wang, culture YCW1356 and culture YCW1363.

Notes

Isolates of Paraboeremia litseae clustered into a sister clade to P. selaginellae (Fig. 5). It was first isolated from Litsea sp. (Jiang et al. 2017). Conidia produced by P. litseae are oblong to ellipsoidal and aseptate with two large polar guttules (Jiang et al. 2017). This species as an endophytic fungus in Coptis chinensis exhibited obvious inhibition against methicillin-resistant Staphylococcus aureus (Ming et al. 2022). In the present study, two strains were isolated from diseased tea plant leaves. This is the first report of P. litseae causing leaf blight on C. sinensis.

Remotididymella anemophila A. L. Yang et al., International Journal of Systematic Evolutional Microbiology. 71: 10. 2021

Description

see Yang et al. (2021).

Materials examined

China, Anhui Province, Huangshan City, from diseased leaves of C. sinensis cv. Fenglixiang, 2 Jul 2019, Y. C. Wang, culture YCW499. Zhejiang Province, Hangzhou City, from diseased leaves of C. sinensis cv. Longjing43, Jun 2014, Y. C. Wang, culture YCW1118.

Notes

Remotididymella anemophila was clustered into a sister clade to R. bauhiniae (Fig. 4), characterised by shorter ascospores, longer asci and larger conidia. It was first isolated from canopy air of Ageratina adenophora (Spreng.) in China (Yang et al. 2021). In the present study, three strains were isolated from diseased tea plant leaves. This is the first report of R. anemophila causing leaf blight on C. sinensis.

Stagonosporopsis caricae (Sydow & P. Sydow) M. M. Aveskamp et al., Studies in Mycology. 65: 45. 2010

Description

see Sivanesan (1990).

Materials examined

China, Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture YCW1928. Yunnan Province, Puer City, Jingdong Yizu Autonomous County, from healthy leaves of C. sinensis, 13 Jun 2020, Y. C. Wang, culture YCW1977.

Notes

Stagonosporopsis caricae was synonymised as Phoma caricae with Mycosphaerella caricae previously (Sivanesan 1990). It formed a distinct lineage in Stagonosporopsis (Fig. 4). Zhang et al. (2022) observed its sexual morph and is characterised by ascomata pseudothecioid, subglobose, 121 × 142 μm, ostiolate, walls of brown textura angularis and smooth. Asci were bitunicate, cylindrical to clavate, 7 × 90 μm, 8-spored, ascospores elliptical, straight to slightly curved, 5 × 17 μm, 1-septate, constricted at the septum, sub-hyaline and smooth. As one of three Stagonosporopsis species, S. caricae caused gummy stem blight (Jeong et al. 2022b; Seblani et al. 2023). In the present study, two isolates from healthy tea plant leaves grouped with S. caricae with high statistical support (Fig. 4). This is the first report of S. caricae isolated from C. sinensis.

Pathogenicity tests

To determine the pathogenicity of isolates from these 22 species, 36 representative isolates were selected for the analysis on the healthy leaves of C. sinensis cv. Longjing43 with the wound-inoculation method. Amongst the tested strains, the sizes of necrotic lesions caused by the strain YCW1829 of E. anhuiense were largest (av. 8.00 ± 0.42 mm); on the contrary, the size of that caused by the strain YCW224 of E. puerense was smallest (av. 1.35 ± 0.70 mm) (Figs 11, 12). Didymella segeticola, E. draconis, E. latusicollum and E. poaceicola could also cause necrotic lesions on the inoculated leaves. Furthermore, the other strains caused no necrotic lesions on tea plant leaves (Fig. 11). The results indicated that E. anhuiense had the strongest virulence; on the contrary, E. puerense displayed the weakest virulence. In addition, D. pomorum, D. yunnanensis, E. dendrobii, E. italicum, E. mackenziei, E. oryzae, E. rosae, E. tobaicum, E. jingdongense, N. mortariensis, N. yunnanensis, N. zhejiangensis and R. anemophila were not pathogenic to tea plants.

Figure 11. 

Symptoms of Didymellaceae family strains on tea plant leaves at 3 days after inoculation.

Geographical distribution

To explore the geographical distribution of Didymellaceae family strains associated with C. sinensis in China, we combined our data with these from Chen et al. (2017) and Ren et al. (2019) for the analysis (Table 2). Amongst the 240 isolates that we collected from ten provinces in China, most of the isolates were distributed in Yunnan Province. Amongst the 25 species, D. segeticola (171 isolates in this study and 14 isolates from Ren et al. (2019) had the widest geographical distribution, in nine provinces. Fourteen species, D. coffeae-arabicae, D. pomorum, D. sinensis, D. yunnanensis, E. dendrobii, E. italicum, E. jingdongense, E. mackenziei, E. oryzae, E. poaceicola, E. puerense, N. rosicola, P. litseae and S. caricae, were only distributed in Yunnan Province. One species, E. catenisporum, was only distributed in Jiangxi Province. These results suggest that D. segeticola as the most widely distributed species may be the dominant species causing leaf blight disease in tea plants.

Table 2.
Download as
CSV
XLSX

Geographical distribution of Didymellaceae family associated with C. sinensis in China.

Species Collecting location
AH GD GZ HB HN JS JX SC YN ZJ
D. coffeae-arabicae √
D. pomorum √
D. segeticola √ √ √⊥ √ √ √ √ √ √
D. sinensis √
D. yunnanensis √
E. anhuiense √ √
E. catenisporum √
E. dendrobii √
E. draconis √ √
E. italicum √
E. jingdongense √
E. latusicollum * √
E. mackenziei √
E. oryzae √
E. poaceicola √
E. puerense √
E. rosae √ √ √
E. sorghinum * √
E. tobaicum √ √ √ √
N. mortariensis √
N. rosicola √
N. zhejiangensis √ √
P. litseae √
R. anemophila √ √
S. caricae √

AH: Anhui; GD: Guangdong; GZ: Guizhou; HB: Hubei; HN: Henan; JS: Jiangsu; JX: Jiangxi; SC: Sichuan; YN: Yunnan; ZJ: Zhejiang. This table includes data from Chen et al. (2017) (*), Ren et al. (2019) (⊥), and our study (√).

Discussion

In this study, 240 isolates were obtained from tea plant leaves in ten provinces of four major tea regions (southwest China, south China, south Yangtze and north Yangtze) in China (Yang et al. 2023b). Based on the multi-locus (ITS, LSU, RPB2 and TUB2) sequences, three phylogenetic trees were constructed to identify the species of the tested isolates. Six novel species, named Didymella yunnanensis, Epicoccum anhuiense, Epicoccum jingdongense, Epicoccum puerense, Neoascochyta yunnanensis and Neoascochyta zhejiangensis, were identified and their morphological characteristics were described in detail (Figs 4–9). As one of the most species-rich genera in the Didymellaceae, Didymella was introduced by Saccardo (1880) with Didymella exigua (Niessl) Sacc. as the type species of the genus (Thambugala et al. 2017; Wang et al. 2021). Most species in the genus produced chlamydospores in culture (Chen et al. 2015a), whereas D. yunnanensis as one novel species of Didymella did not form chlamydospores on PDA or OA cultures (Fig. 5), which may be the result of suitable culture conditions in the incubator not being favourable for the production of the resting spores. Pycnidia of D. yunnanensis formed on PDA was smooth, subglobose to ellipsoidal, hyaline, which conflicts with the pigmented outer wall of pycnidia of Didymella genus (Chen et al. 2015a). However, based on multi-locus phylogenetic analyses, D. yunnanensis belonged to this genus as a novel species. We believed that multi-locus phylogenetic analyses were the more reliable method to clarify the genetic delimitation in Didymellaceae compared with the morphological observations. Here, we provide phylogenetic trees for Didymella, Epicoccum, Neoascochyta, Paraboeremia, Remotididymella and Stagonosporopsis using as much vouchered sequence data as possible. Six new species and 15 new records are proposed herein with support from our analysis of ITS, LSU, RPB2 and TUB2 sequences.

The genus Epicoccum is known as a hyphomycetous asexual morph in the Didymellaceae family (Hyde et al. 2013). However, it was emended with coelomycetous synanamorph by Chen et al. (2015a) and five Phoma species were recombined into the genus, based on multi-gene phylogenetic analysis (Thambugala et al. 2017). Epicoccum anhuiense is phylogenetically distinct from other Epicoccum species with close phylogenetic affinity to E. latusicollum (5 bp difference within the TUB2 sequence). Epicoccum jingdongense and E. puerense are also phylogenetically distinct from other Epicoccum species with close phylogenetic affinity to E. dendrobii (40 bp difference within the TUB2 sequence and 1 bp difference within the ITS sequence, respectively). Asexual morphs of the three novel species accommodated in Epicoccum were also determined and formed the coelomycetous asexual morphs (Figs 6–8), which is consistent with the characteristics of Epicoccum coelomycetous synasexual stage that is characterised by the formation of doliiform to flask-shaped conidiogenous cells that produce unicellular, hyaline conidia under culture conditions (Aveskamp et al. 2010; Jayasiri et al. 2017). Therefore, these species are introduced, based on the synasexual morphs and phylogenetic data.

In Neoascochyta, three different groups are observable based on conidial morphology: species with one-septate conidia, such as N. dactylidis, N. europaea, N. exitialis and N. graminicola; species with mainly one-septate conidia, but occasionally aseptate, such as N. argentina, N. cylindrispora, N. desmazieri, N. rosicola, N. tardicrescens and N. triticicola; and species with aseptate conidia, such as N. fuci, N. paspali and N. soli (Gonçalves et al. 2020). Two novel species, N. yunnanensis and N. zhejiangensis, produced aseptate conidia (Figs 9G, 10G), which fit within the last group. All the same, N. yunnanensis and N. zhejiangensis phylogenetically have a close relationship with N. rosicola and N. cylindrispora, respectively (Fig. 4). Conidia produced by N. zhejiangensis were hyaline, biconical to subcylindrical (Fig. 10G), keeping consistent with the conidial characteristics of Neoascochyta genus. By contrast, N. yunnanensis formed pale yellow conidia (Fig. 9G), which was a typical characteristic of Neoascochyta conidia. Besides, pycnidia of the two species formed on PDA was hyaline (Figs 9F, 10F), which is also a non-representative characteristic. This may be due to the culture conditions. The majority of Neoascochyta species was found in association with various Poaceae plant species, appearing to have some host preference (Gonçalves et al. 2020). In this study, we reported two novel species isolated from the tea plant for the first time.

Didymella and Neoascochyta genera have sexual morphs (Woudenberg et al. 2009; Jayasiri et al. 2017). However, sexual morphs of the isolates belonging to two genera were not observed under culture conditions and then undetermined. In the future, the detailed description of sexual morphs of the isolates, especially the three novel species D. yunnanensis, N. yunnanensis and N. zhejiangensis, will provide more morphological evidence for the identification of the novel species.

Amongst six new species in this study, most isolates were obtained from Yunnan Province (Table 2). Yunnan Province, as the oldest tea region in China, is rich in tea plant resources and is also the centre of fungi biodiversity. Molecular evidence suggested that many fungi belonging to the family Didymellaceae may be seedborne and can co-spread with the host through seeds (Fang et al. 2021; Yang et al. 2023a). Therefore, we speculated that Yunnan as the birthplace of tea plants has more abundant germplasm resources and is prone to fungal transmission. The remaining isolates were collected from Zhejiang and Anhui Provinces (Table 2), which provide the most suitable environment for tea plant growth. This warm and humid climate are also conducive to the rapid growth of fungi (Du et al. 2012).

More than half of the strains isolated from tea plants were clustered into Didymella segeticola species, indicating that this species in Didymellaceae family is probably more dominant in tea plants. They were isolated from diseased tea plant leaves and had strong virulence (Figs 11, 12), suggesting that D. segeticola may be the causal agent of foliar diseases in tea plants. Didymella species have been reported to cause leaf spot on many plants, such as Angelica dahurica (Xu et al. 2016), Bellis perennis (Chen et al. 2015a), Chrysanthemum morifolium (Liu et al. 2019), C. sinensis (Ren et al. 2019; Wang et al. 2021), Eleocharis dulcis (Lv et al. 2011), Lodium multiflorum (Liu et al. 2022) and Zanthoxylum bungeanum (Yang et al. 2022). Especially, Ren et al. (2019) have also proved that D. segeticola is a causal agent of leaf spot on tea plants in China. However, the morphological characteristics of D. segeticola shared some similarities with those of Discula theae-sinensis, the causal agent of tea anthracnose (Moriwaki and Sato 2009), especially the conidial morphology. We thus speculated that D. segeticola could also be the pathogen causing anthracnose on tea plant leaves. The pathogenicity of isolates in the Epicoccum genus is different; E. dendrobii, E. italicum, E. jingdongense, E. mackenziei, E. oryzae, E. rosae and E. tobaicum did not cause any disease symptoms, whereas E. anhuiense, E. draconis, E. latusicollum, E. poaceicola and E. puerense caused necrotic lesions on the tea plant leaves (Figs 11, 12). Epicoccum commonly display an endophytic lifestyle (Braga et al. 2018), so we speculated that the difference in pathogenicity may be due to the wound-inoculation method, which may result in the transition of some endophytes, such as E. anhuiense and E. puerense isolated from healthy leaves, to phytopathogens and the invasion of leaves from the artificial wounds. Therefore, the spray inoculation of healthy leaves in the future with conidia suspensions will help elucidate the pathogenic mechanism of all isolates. On the other hand, some Epicoccum species, such as E. draconis, E. latusicollum and E. poaceicola isolated from diseased leaves, were also reported as phytopathogens causing leaf spot on many plants, such as Eugenia involucrata (Bernardi et al. 2022), flowering cherry (Han et al. 2021), tobacco (Guo et al. 2020) and Weigela florida (Tian et al. 2021). Besides, Epicoccum species were mainly known as biocontrol agents against phytopathogens via inhibiting their growth and conidial germination (Braga et al. 2018). For example, E. nigrum limited the development of Rhizoctonia solani in potato plants by growing along its hyphae and inducing lysis (Lahlali and Hijri 2010). In addition, Epicoccum species as endophytes can produce antifungal compounds, such as epicolactone that exhibits an inhibitory activity against Remotididymella solani, epicoccamide D that induces morphogenesis and pigment formation in phytopathogenic fungus Phoma destructiva and flavipin that inhibits the growth of several fungal phytopathogens (Madrigal et al. 1991; Wangun et al. 2007; Fávaro et al. 2012; Talontsi et al. 2013). Therefore, endophytes isolated from tea plants, E. dendrobii, E. italicum, E. jingdongense, E. mackenziei, E. oryzae, E. rosae and E. tobaicum, may be beneficial species with biological control potential. Future studies could determine the inhibitory activity of these endophytes against the dominant pathogens in tea plants, such as Colletotrichum camelliae, C. fructicola, Didymella segeticola, Exobasidium vexans, Discula theae-sinensis and Pestalotiopsis theae and then identify the antifungal compounds.

Figure 12. 

Lesion diameters of Didymellaceae family strains on tea plant leaves at 3 days after inoculation. Error bars represent standard deviation.

The potential factors influencing the prevalence and pathogenicity of tested species in Epicoccum genus may be the different host-pathogen interaction patterns. Various infection strategies were deployed by pathogens to facilitate their own infection, such as secreting effectors, reprogramming the host transcriptome, rewiring host phytohormone signalling and disarming plant immune outputs (Wang et al. 2022). For E. nigrum, many strains secreted enzymes including amylases and proteases expected to participate mainly in the later stages of the infection (Ogórek et al. 2020). Epicoccum sorghi secreted polyglycine hydrolases to cleave the polyglycine linker of chitinases, antifungal proteins from Zea mays (Naumann et al. 2014; Naumann et al. 2017). To defend against diverse pathogens, plants have also evolved a robust innate immune system (Wang et al. 2022). Then, we speculated that E. anhuiense, E. draconis, E. latusicollum, E. poaceicola and E. puerense may adopt different infection strategies to invade tea plant (LJ43) leaves, resulting in the different outcome of host plant-pathogen interactions.

In summary, this study represents a comprehensive investigation of Didymellaceae family strains isolated from tea plant leaves of ten provinces in China. Combined with multi-locus (ITS, LSU, RPB2 and TUB2) phylogenetic analysis and morphological characteristics, a total of 240 isolates were identified as 25 species of six genera, including 19 known species and six novel species. Amongst all isolates, Didymella segeticola was the most dominant species. Pathogenicity analysis showed that their virulence varied. These results help us comprehend the diversity of Didymellaceae family in tea plants and provide a reference for disease management.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This work was supported by the Fundamental Research Funds for the Provincial Universities of Zhejiang (2020YQ001); The Open Fund of State Key Laboratory of Tea Plant Biology and Utilization (SKLTOF20200109); Zhejiang Science and Technology Major Program on Agricultural New Variety Breeding-Tea Plant (2021C02067-7); the Scientific Research Project of Zhejiang Education Department (No. Y202250195); the Natural Science Foundation of Zhejiang Province (LY22C160001); the Scientific Research and Development Foundation of Zhejiang A & F University (2020FR016; 2021LFR046).

Author contributions

Data curation: HJ. Funding acquisition: YW, CW. Investigation: QL, XC, HR. Writing - original draft: YT. Writing - review and editing: WL.

Author ORCIDs

Wuyun Lv  https://orcid.org/0000-0003-3781-0763

Data availability

Sequence data from this study can be obtained from GenBank at https://www.ncbi.nlm.nih.gov/genbank/ with the accession numbers as listed in Suppl. material 1.

References

  • Aementado HDR, Balendres MAO (2023) Identification of Epicoccum poaceicola causing eggplant leaf spot and its cross-infection potential to other solanaceous vegetable crops. Archiv für Phytopathologie und Pflanzenschutz 56(11): 872–888. https://doi.org/10.1080/03235408.2023.2227328
  • An J, Fan C, Fu Z, Zhang H, Yang P (2022) Analyses of the complete mitochondrial genome of Paraconiothyrium sp. and gene rearrangement diversity in the Pleosporales. Diversity 14(8): 601. https://doi.org/10.3390/d14080601
  • Aveskamp MM, Verkley GJM, de Gruyter J, Murace MA, Perelló A, Woudenberg JHC, Groenewald JZ, Crous PW (2009) DNA phylogeny reveals polyphyly of Phoma section Peyronellaea and multiple taxonomic novelties. Mycologia 101(3): 363–382. https://doi.org/10.3852/08-199
  • Aveskamp MM, de Gruyter J, Woudenberg JHC, Verkley GJM, Crous PW (2010) Highlights of the Didymellaceae: A polyphasic approach to characterise Phoma and related Pleosporalean genera. Studies in Mycology 65: 1–60. https://doi.org/10.3114/sim.2010.65.01
  • Boerema GH (1993) Contributions towards a monograph of Phoma (Coelomycetes) – II. Section Peyronellaea. Persoonia 15: 197–221.
  • Boerema GH, de Gruyter J, Noordeloos ME, Hamers MEC (2004) Phoma identification manual: Differentiation of specific and infraspecific taxa in culture. CABI publishing, Wallingford, UK, 425 pp. https://doi.org/10.1079/9780851997438.0000
  • Cai L, Hyde KD, Taylor PWJ, Weir BS, Waller JM, Abang MM, Zhang JZ, Yang YL, Phoulivong S, Liu ZY, Prihastuti H, Shivas RG, McKenzie EHC, Johnston PR (2009) A polyphasic approach for studying Colletotrichum. Fungal Diversity 39: 183–204. https://doi.org/10.1016/j.riam.2009.11.001
  • Calatayud V, Sanz MJ, Aptroot A (2001) Lichenopyrenis galligena (Pleomassariaceae), a new genus of gall-forming lichenicolous fungi on Leptochidium. Mycological Research 105(5): 634–637. https://doi.org/10.1017/S0953756201003963
  • de Gruyter J, Noordeloos ME, Boerema GH (1998) Contributions towards a monograph of Phoma (Coelomycetes) – I. 3. Section Phoma: Taxa with conidia longer than 7 μm. Persoonia 16: 471–490.
  • de Gruyter J, Aveskamp MM, Woudenberg JHC, Verkley GJM, Groenewald JZ, Crous PW (2009) Molecular phylogeny of Phoma and allied anamorph genera: Towards a reclassification of the Phoma complex. Mycological Research 113(4): 508–519. https://doi.org/10.1016/j.mycres.2009.01.002
  • Du BX, Yan DF, Sun B, Xiangchuan L, Dao KQ, Li XQ (2012) Cunninghamia praelanceolata sp. nov. with associated epiphyllous fungi from the upper Miocene of eastern Zhejiang, S. E China and their palaeoecological implications. Review of Palaeobotany and Palynology 182: 32–43. https://doi.org/10.1016/j.revpalbo.2012.06.002
  • Fang K, Zhou J, Chen L, Li YX, Yang AL, Dong XF, Zhang HB (2021) Virulence and community dynamics of fungal species with vertical and horizontal transmission on a plant with multiple infections. PLoS Pathogens 17(7): e1009769. https://doi.org/10.1371/journal.ppat.1009769
  • Gonçalves MFM, Esteves AC, Alves A (2020) Revealing the hidden diversity of marine fungi in Portugal with the description of two novel species, Neoascochyta fuci sp. nov. and Paraconiothyrium salinum sp. nov. International Journal of Systematic and Evolutionary Microbiology 70(10): 5337–5354. https://doi.org/10.1099/ijsem.0.004410
  • Han VC, Yu NH, Yoon H, Son YK, Lee BH, Kim JC (2021) First report of Epicoccum tobaicum associated with leaf spot on flowering cherry in South Korea. Plant Disease 105(9): 2734. https://doi.org/10.1094/PDIS-12-20-2711-PDN
  • Han SL, Wang MM, Ma ZY, Raza M, Zhao P, Liang JM, Gao M, Li YJ, Wang JW, Hu DM, Cai L (2023) Fusarium diversity associated with diseased cereals in China, with an updated phylogenomic assessment of the genus. Studies in Mycology 104(1): 87–148. https://doi.org/10.3114/sim.2022.104.02
  • Hou L, Hernández-Restrepo M, Groenewald JZ, Cai L, Crous PW (2020a) Citizen science project reveals high diversity in Didymellaceae (Pleosporales, Dothideomycetes). MycoKeys 65: 49–99. https://doi.org/10.3897/mycokeys.65.47704
  • Huang WY, Cai YZ, Hyde KD, Corke H, Sun M (2008) Biodiversity of endophytic fungi associated with 29 traditional Chinese medicinal plants. Fungal Diversity 33: 75. https://doi.org/10.1002/yea.1639
  • Huang H, Li D, Jiang S, Yang R, Yang Y, Xia Z, Jiang X, Zhao Y, Wang D, Song B, Chen Z (2023) Integrated transcriptome and proteome analysis reveals that the antimicrobial griseofulvin targets Didymella segeticola beta-tubulin to control tea leaf spot. Phytopathology 113(2): 194–205. https://doi.org/10.1094/PHYTO-02-22-0061-R
  • Hyde KD, Jones EBG, Liu JK, Ariyawansa H, Boehm E, Boonmee S, Braun U, Chomnunti P, Crous PW, Dai DQ, Diederich P, Dissanayake A, Doilom M, Doveri F, Hongsanan S, Jyawardena R, Lawrey JD, Li YM, Liu YX, Lücking R, Monkai J, Muggia L, Nelsen MP, Pang KL, Phookamsak R, Senanayake IC, Shearer CA, Suetrong S, Tanaka K, Thambugala KM, Wijayawardene NN, Wikee S, Wu HX, Zhang Y, Aguirre-Hudson B, Alias SA, Aptroot A, Bahkali AH, Bezerra JL, Ghat DJ, Camporesi E, Chukeatirote E, Gueidan C, Hawksworth DL, Hirayama K, Hoog SD, Kang JC, Knudsen K, Li WJ, Li XH, Liu ZY, Mapook A, McKenzie EHC, Miller AN, Mortimer PE, Phillips AJL, Raja HA, Scheuer C, Schumm F, Taylor JE, Tian Q, Tibpromma S, Wanasinghe DN, Wang Y, Xu JC, Yacharoen S, Yan JY, Zhang M (2013) Families of Dothideomycetes. Fungal Diversity 63(1): 1–313. https://doi.org/10.1007/s13225-013-0263-4
  • Jayasiri SC, Hyde KD, Jones EBG, Jeewon R, Ariyawansa HA, Bhat JD, Camporesi E, Kang JC (2017) Taxonomy and multigene phylogenetic evaluation of novel species in Boeremia and Epicoccum with new records of Ascochyta and Didymella (Didymellaceae). Mycosphere 8(8): 1080–1101. https://doi.org/10.5943/mycosphere/8/8/9
  • Jeong YJ, Kwon OK, Jeong AR, Lee H, Moon H, Lee ON, Hong JK, Park CJ (2022b) Population structure of Stagonosporopsis species associated with cucurbit gummy stem blight in Korea. The Plant Pathology Journal 38(5): 522–532. https://doi.org/10.5423/PPJ.OA.07.2022.0102
  • Jiang N, Fan X, Tian C (2021) Identification and characterization of leaf-inhabiting fungi from Castanea plantations in China. Journal of Fungi (Basel, Switzerland) 7(1): 64. https://doi.org/10.3390/jof7010064
  • Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108
  • Kodsueb R, Dhanasekaran V, Aptroot A, Lumyong S, McKenzie EHC, Hyde KD, Jeewon R (2006) The family Pleosporaceae: Intergeneric relationships and phylogenetic perspectives based on sequence analyses of partial 28S rDNA. Mycologia 98(4): 571–583. https://doi.org/10.1080/15572536.2006.11832660
  • Kruys A, Eriksson OE, Wedin M (2006) Phylogenetic relationships of coprophilous Pleosporales (Dothideomycetes, Ascomycota), and the classification of some bitunicate taxa of unknown position. Mycological Research 110(5): 527–536. https://doi.org/10.1016/j.mycres.2006.03.002
  • Kularathnage ND, Senanayake IC, Wanasinghe DN, Doilom M, Stephenson SL, Song J, Dong W, Xu B (2023) Plant-associated novel Didymellaceous taxa in the South China botanical garden (Guangzhou, China). Journal of Fungi (Basel, Switzerland) 9(2): 182. https://doi.org/10.3390/jof9020182
  • Kumhar KC, Babu A, Nisha SN, Kishor Chand Kumhar (2022) Management of tea (Camellia sinensis) diseases with application of microbes: A review. Innovare Journal of Agricultural Science 10: 6–10. https://doi.org/10.22159/ijags.2022.v10i2.44271
  • Lahlali R, Hijri M (2010) Screening, identification and evaluation of potential biocontrol fungal endophytes against Rhizoctonia solani AG3 on potato plants. FEMS Microbiology Letters 311(2): 152–159. https://doi.org/10.1111/j.1574-6968.2010.02084.x
  • Li D, Zhang T, Song Q, Liu J, Zhang H, Luan F (2022) First report of leaf spot disease on Cinnamomum camphora (camphor tree) caused by Epicoccum poaceicola in China. Plant Disease 106(3): 1059. https://doi.org/10.1094/PDIS-04-21-0683-PDN
  • Li Z, Hu J, Li W, Wang H, Guo Z, Cheng X, Cai L, Shui C (2023) Characteristics of Epicoccum latusicollum as revealed by genomic and metabolic phenomic analysis, the causal agent of tobacco Epicoccus leaf spot. Frontiers in Plant Science 14: 1199956. https://doi.org/10.3389/fpls.2023.1199956
  • Liu YH, Zhang CQ, Dai DJ (2019) First report of leaf black spot on White Chrysanthemum (Chrysanthemum morifolium) caused by Phoma bellidis in China. Plant Disease 103(9): 2475. https://doi.org/10.1094/PDIS-03-19-0611-PDN
  • Liu SY, He J, Bian JY, Qi XL, Song Q, Huang L (2020) First report of Epicoccum poaceicola causing leaf spot on Phyllostachys viridis in China. Plant Disease 104(12): 3257. https://doi.org/10.1094/PDIS-03-20-0484-PDN
  • Lv R, Zheng L, Zhu Z, Pan L, Huang J, Hsiang T (2011) First report of stem blight of Eleocharis dulcis caused by Phoma bellidis in China. Plant Disease 95(9): 1190. https://doi.org/10.1094/PDIS-05-11-0438
  • Madrigal C, Tadeo JL, Melgarejo P (1991) Relationship between flavipin production by Epicoccum nigrum and antagonism against Monilinia laxa. Mycological Research 95(12): 1375–1381. https://doi.org/10.1016/S0953-7562(09)80388-2
  • Manawasinghe IS, Jayawardena RS, Li HL, Zhou YY, Phillips AJL, Wanasinghe DN, Dissanayake AJ, Li XH, Li YH, Hyde KD, Yan JY (2021) Microfungi associated with Camellia sinensis: A case study of leaf and shoot necrosis on tea in Fujian, China. Mycosphere 12(1): 430–518. https://doi.org/10.5943/mycosphere/12/1/6
  • Ming Q, Huang X, Guo L, Liu D, Qin L, He Y, Tang Y, Liu Y, Liu J, Li P (2022) Diversity of endophytic fungi in Coptis chinensis Franch. and their activity against methicillin-resistance Staphylococcus aureus. Folia Microbiologica 67(6): 965–974. https://doi.org/10.1007/s12223-022-00994-1
  • Moriwaki J, Sato T (2009) A new combination for the causal agent of tea anthracnose: Discula theae-sinensis (I. Miyake) Moriwaki & Toy. Sato, comb. Nov. Journal of General Plant Pathology 75(5): 359–361. https://doi.org/10.1007/s10327-009-0183-z
  • Naumann TA, Wicklow DT, Price NPJ (2014) Polyglycine hydrolases secreted by Pleosporineae fungi that target the linker of plant class IV chitinases. The Biochemical Journal 460(2): 187–198. https://doi.org/10.1042/BJ20140268
  • Naumann TA, Bakota EL, Price NPJ (2017) Recognition of corn defense chitinases by fungal polyglycine hydrolases. Protein Science 26(6): 1214–1223. https://doi.org/10.1002/pro.3175
  • Ogórek R, Przywara K, Piecuch A, Cal M, Lejman A, Matkowski K (2020) Plant-fungal interactions: A case study of Epicoccoum nigrum Link. Plants 9(12): 1691. https://doi.org/10.3390/plants9121691
  • Rambaut A, Drummond A (2008) FigTree: Tree figure drawing tool, version 1.2.2. Institute of Evolutionary Biology, University of Edinburgh.
  • Ren Y, Li D, Zhao X, Wang Y, Bao X, Wang X, Wu X, Wang D, Song B, Chen Z (2019) Whole genome sequences of the tea leaf spot pathogen Didymella segeticola. Phytopathology 109(10): 1676–1678. https://doi.org/10.1094/PHYTO-02-19-0050-A
  • Rivera-Vega LJ, Zhou W, Buchman LW, Valencia CU, Jack ALH, Lopez DC, Sword GA (2022) Plant-associated fungi affect above- and belowground pest responses to soybean plants. Journal of Applied Microbiology 133(2): 422–435. https://doi.org/10.1111/jam.15554
  • Rodríguez J, Vázquez L, Flórez AB, Mayo B (2023) Epicoccum sp. as the causative agent of a reddish-brown spot defect on the surface of a hard cheese made of raw ewe milk. International Journal of Food Microbiology 406: 110401. https://doi.org/10.1016/j.ijfoodmicro.2023.110401
  • Romero LR, Tacke D, Koopmann B (2021) First characterisation of the Phoma species complex on maize leaves in Central Europe. Pathogens (Basel, Switzerland) 10(9): 1216. https://doi.org/10.3390/pathogens10091216
  • Saccardo PA (1880) Fungi Gallici lecti a cl. viris P. Brunaud, Abb. Letendre, A. Malbranche, J. Therry, vel editi in Mycotheca Gallica C. Roumeguèri. Series Ⅱ. Michelia 2: 39–135.
  • Samaradiwakara NP, de Farias ARG, Tennakoon DS, Bhunjun CS, Hyde KD, Lumyong S (2023) Sexual morph of Allophoma tropica and Didymella coffeae-arabicae (Didymellaceae, Pleosporales, Dothideomycetes), including novel host records from leaf litter in Thailand. New Zealand Journal of Botany, 1–24. https://doi.org/10.1080/0028825X.2023.2272957
  • Seblani R, Keinath AP, Munkvold G (2023) Gummy stem blight: One disease, three pathogens. Molecular Plant Pathology 24(8): 825–837. https://doi.org/10.1111/mpp.13339
  • Silva-Hanlin DMW, Hanlin RT (1999) Small subunit ribosomal RNA gene phylogeny of several loculoascomycetes and its taxonomic implications. Mycological Research 103(2): 153–160. https://doi.org/10.1017/S0953756298006972
  • Solarte F, Muñoz CG, Maharachchikumbura SSN, Álvarez E (2017) Diversity of Neopestalotiopsis and Pestalotiopsis spp., causal agents of guava scab in Colombia. Plant Disease 102(1): 49–59. https://doi.org/10.1094/PDIS-01-17-0068-RE
  • Sutton BC (1980) The coelomycetes. Fungi imperfecto with pycnidia, acervuli and stromata. Australasian Plant Pathology 9(4): 120–121. https://doi.org/10.1007/BF03213663
  • Talontsi FM, Dittrich B, Schüffler A, Sun H, Laatsch H (2013) Epicoccolides: Antimicrobial and antifungal polyketides from an endophytic fungus Epicoccum sp. associated with Theobroma cacao. European Journal of Organic Chemistry 2013(15): 3174–3180. https://doi.org/10.1002/ejoc.201300146
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Thambugala KM, Wanasinghe DN, Phillips AJL, Camporesi E, Bulgakov TS, Phukhamsakda C, Ariyawansa HA, Goonasekara ID, Phookamsak R, Dissanayake AJ, Tennakoon DS, Tibpromma S, Chen YY, Liu ZY, Hyde KD (2017) Mycosphere notes 1–50: Grass (Poaceae) inhabiting Dothideomycetes. Mycosphere 8(4): 697–796. https://doi.org/10.5943/mycosphere/8/4/13
  • Valenzuela-Lopez N, Cano-Lira JF, Guarro J, Sutton DA, Wiederhold N, Crous PW, Stchigel AM (2018) Coelomycetous Dothideomycetes with emphasis on the families Cucurbitariaceae and Didymellaceae. Studies in Mycology 90(1): 1–69. https://doi.org/10.1016/j.simyco.2017.11.003
  • von Szilvinyi A (1936) Archiv für Hydrobiologie Supplement 14. Tropische Binnengewässer 6a: 519.
  • Wanasinghe DN, Jeewon R, Peršoh D, Jones EBG, Camporesi E, Bulgakov TS, Gafforov YS, Hyde KD (2018a) Taxonomic circumscription and phylogenetics of novel didymellaceous taxa with brown muriform spores. Studies in Fungi 3(1): 152–175. https://doi.org/10.5943/sif/3/1/17
  • Wanasinghe DN, Phukhamsakda C, Hyde KD, Jeewon R, Lee HB, Jones EBG, Tibpromma S, Tennakoon DS, Dissanayake AJ, Jayasiri SC, Gafforov Y, Camporesi E, Bulgakov TS, Ekanayake AH, Perera EH, Samarakoon MC, Goonasekara ID, Mapook A, Li WJ, Senanayake IC, Li J, Norphanphoun C, Doilom M, Bahkali AH, Xu J, Mortimer PE, Tinell L, Yibell S, Karunarathna SC (2018b) Fungal diversity notes 709 – 839: Taxonomic and phylogenetic contributions to fungal taxa with an emphasis on fungi on Rosaceae. Fungal Diversity 89(1): 1–236. https://doi.org/10.1007/s13225-018-0395-7
  • Wang YC, Hao XY, Wang L, Xiao B, Wang XC, Yang YJ (2016) Diverse Colletotrichum species cause anthracnose of tea plants (Camellia sinensis (L.) O. Kuntze) in China. Scientific Reports 6(1): 35287. https://doi.org/10.1038/srep35287
  • Wang X, Wu X, Jiang S, Yin Q, Li D, Wang Y, Wang D, Chen Z (2021) Whole genome sequence and gene annotation resource for Didymella bellidis associated with tea leaf spot. Plant Disease 105(4): 1168–1170. https://doi.org/10.1094/PDIS-05-20-0939-A
  • Wang H, Shi YP, Lin S, Liu Z, Guo J, Xiuming H, Liao H, Gao Q, Zhou H (2023) First report of Epicoccum latusicollum causing leaf blight on Curcuma kwangsiensis in China. Plant Disease 107(8): 2546. https://doi.org/10.1094/PDIS-11-22-2668-PDN
  • Wangun HVK, Dahse HM, Hertweck C (2007) Epicoccamides B-D, glycosylated tetramic acid derivatives from an Epicoccum sp. associated with the tree fungus Pholiota squarrosa. Journal of Natural Products 70(11): 1800–1803. https://doi.org/10.1021/np070245q
  • Woudenberg JHC, Aveskamp MM, de Gruyter J, Spiers AG, Crous PW (2009) Multiple Didymella teleomorphs are linked to the Phoma clematidina morphotype. Persoonia 22(1): 56–62. https://doi.org/10.3767/003158509X427808
  • Xu H, Cui J, Zhou R, Fu J, Hao N (2016) First report of leaf spot disease in Angelica dahurica caused by Phoma bellidis in China. Journal of Phytopathology 164(7–8): 448–454. https://doi.org/10.1111/jph.12470
  • Xu X, Zhang L, Yang X, Li J, Wang X, Zhao J, Xiang W (2022) First report of maize stalk rot caused by Epicoccum latusicollum on maize (Zea mays L.) in China. Plant Disease 106(8): 2255. https://doi.org/10.1094/PDIS-11-21-2392-PDN
  • Yang AL, Chen L, Fang K, Dong XF, Li YX, Zhang HB, Yu ZF (2021) Remotididymella ageratinae sp. nov. and Remotididymella anemophila sp. nov., two novel species isolated from the invasive weed Ageratina adenophora in PR China. International Journal of Systematic and Evolutionary Microbiology 71(1): 004572. https://doi.org/10.1099/ijsem.0.004572
  • Yang J, Chen C, Yin X, Xu H, Long H, Gu G, Shu R, Yuan J, Zhou H (2022) Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 1–10. https://doi.org/10.1080/01140671.2022.2080235
  • Yang X, Yi X, Ni K, Zhang Q, Shi Y, Chen L, Zhao Y, Zhang Y, Ma Q, Cai Y, Ma L, Ruan J (2023b) Patterns and abiotic drivers of soil organic carbon in perennial tea (Camellia sinensis L.) plantation system of China. Environmental Research 237: 116925. https://doi.org/10.1016/j.envres.2023.116925
  • Yuan J, Zeng XY, Geng K, Wijayawardene NN, Bhat JD, Wu SP, Wang Y, Yang ZF (2021) Allophoma species (Pleosporales: Didymellaceae) associated with Thunbergia grandiflora in Guangxi Province, China. Biodiversity Data Journal 9: e63643. https://doi.org/10.3897/BDJ.9.e63643
  • Zhang Y, Schoch CL, Fournier J, Crous PW, de Gruyter J, Woudenberg JHC, Hirayama K, Tanaka K, Pointing SB, Spatafora JW, Hyde KD (2009a) Multi-locus phylogeny of Pleosporales: A taxonomic, ecological and evolutionary re-evaluation. Studies in Mycology 64: 85–102. https://doi.org/10.3114/sim.2009.64.04
  • Zhang Y, Fournier J, Crous PW, Pointing SB, Hyde KD (2009b) Phylogenetic and morphological assessment of two new species of Amniculicola and their allies (Pleosporales). Persoonia 23(1): 48–54. https://doi.org/10.3767/003158509X472187
  • Zhang J, Yang R, Jiang S, Li D, Li T, Yang Z, Yuan J, Zhao Y, Tan X, Wang D, Chen Z (2022) First report of Stagonosporopsis caricae causing chayote leaf spot in Guizhou Province, China. Plant Disease. https://doi.org/10.1094/PDIS-07-22-1703-PDN
  • Zhang J, Yin QX, Jaing SL, Li DX, Tang D, Zhang Y, Ma YL, Li PY, Wang Y, Wang DL, Chen Z (2023) First report of Epicoccum mackenziei causing dark brown spot of tea leaf in Guizhou Province, Southwestern China. Plant Disease 107(7): 2247. https://doi.org/10.1094/PDIS-10-22-2372-PDN
  • Zhao XZ, Wang Y, Li DX, Ren YF, Chen Z (2018) Morphological characterization and phylogenetic analysis of the pathogen Phoma segeticola var. camelliae causing a new tea disease. Acta Phytopathologica Sinica 48: 32556–32559. https://doi.org/10.13926/j.cnki.apps.000184

Supplementary material

Supplementary material 1 

Isolates of the Didymellaceae family in this study and GenBank accession numbers of the generated sequences

Yuchun Wang, Yiyi Tu, Xueling Chen, Hong Jiang, Hengze Ren, Qinhua Lu, Chaoling Wei, Wuyun Lv

Data type: docx

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (59.40 kb)
login to comment