Introduction

Volutella colletotrichoides was first described from diseased alfalfa and other forage legumes collected from Iowa, USA (Chilton 1954), evident as pink acervular dark-setose fruit bodies erumpent from stems and leaves. It was compared with four other species of Volutella known to be associated with legumes, and distinguished by its acervular setae that are dark rather than hyaline, and by the size of its conidia. The dark setae and relatively large conidia invited comparison with Colletotrichum and led to choice of the specific epithet. A collection with especially numerous setae was given varietal status as Volutella colletotrichoides var. setosa.

The pathogenicity of Volutella colletotrichoides was demonstrated by observations of naturally infected plants in the glasshouse and in the field, and also by infection experiments (Chilton 1954). The original samples derived from stem cuttings of Medicago sativa (alfalfa), Trifolium pratense (red clover) and Lotus corniculatus (bird’s foot trefoil), with Medicago plants proving the most vulnerable to infection, and were reproduced in plant samples transferred to Lincoln, Nebraska. Periodic observations over the following two years showed sparse and erratic occurrence of the pathogen, suggesting that the fungus is not a virulent pathogen, at least in those local conditions. Chilton found that inoculations on mature alfalfa and red clover plants produced petiole girdling and girdling of the stem tips, causing a blighted appearance in severely infected plants. Infection of mature stem tissues produced elliptical sunken lesions to a limited extent. No evidence of systemic invasion of the plant was found although stem infections gradually enlarged to involve much of the plant under high moisture conditions.

Host range experiments (Chilton 1954) provided evidence that Trifolium hybridum and Medicago falcata were susceptible to infection, in addition to the three plant species on which the original observations were made. In contrast, Melilotus alba and Glycine max were not infected under similar experimental conditions. As the plants originally infected were of foreign origin (Chilton did not specify from where) and the occurrence of the pathogen was highly localized, it seems likely that Volutella colletotrichoides was a pathogen introduced into the USA that did not become established, rather than a native species. There are no further records of the species from the USA, and no material in the national fungus collection BPI (Farr and Rossman 2011).

Published reports of Volutella colletotrichoides from other regions are sparse. It was reported from Glycine max in Ethiopia by Mengistu and Sinclair (1979), from the same host (as Glycine ussuriensis) in Democratic Republic of the Congo by Lenné (1990), and on Senna sophera from India (Lenné 1990). Eken et al. (2002) showed the fungus to be present on alfalfa in Turkey. A sequence from an unlocalised sample on Viola sp. was submitted to GenBank (http://www.ncbi.nlm.nih.gov/nuccore/AJ301962.1) by Hagedorn (unpubl., 2002), and cultures from alfalfa from Turkey (reported above) and South Africa are stored in the CBS culture collection (http://www.cbs.knaw.nl/). The plant associates given above do not necessarily imply a biological relationship.

In the winter of 1988, a field survey was carried out for diseases of chickpea (Cicer arietinum) in the vicinity of Salheia, at that time a newly reclaimed region between the Nile Delta and the Suez Canal (Ismaelia) in northern Egypt. There, blighted chickpea plants were observed and collected, with the causal organism initially assumed to be the common chickpea pathogen Ascochyta rabiei. The macroscopic visible symptoms were circular or elongated dark brown to black anthracnose-like lesions approximately one centimeter long on the lower stem parts in addition to partly chlorotic leaves. The causal organism was isolated and sent to the Danish Government Institute of Seed Pathology for Developing Countries (DGISP), and designated as DGISP 271. Later the diagnostic studies were transferred to The Danish Veterinary and Agricultural University. Here the organism was registered as CP 2035. After an extended period of analysis using both morphological and molecular methods with multiple collaborators, the affinities of CP 2035 have finally been confirmed to be with Volutella colletotrichoides.

As Chilton (1954) had observed, we found that Volutella colletotrichoides differed in a number of morphological characteristics from other Volutella species. As molecular analysis has confirmed this separation, we therefore describe the new genus Lectera for Volutella colletotrichoides and a similar, closely related species.

Materials and methods

Isolates were retrieved from storage in the CABI Genetic Resources Collection (see Table 1). For morphological analysis, strains were grown at 25°C for 7 d on PCA and PDA media (Smith and Onions 1994). Observations were made using microscope preparations in water and lactic acid, with measurements made from slides mounted in lactic acid.

Infection studies were carried out, using chickpea cultivar Family 88 as well as certain other species of Fabaceae as hosts: Vicia faba, Glycine max, Pisum sativum, Vigna unguiculata, and Phaseolus vulgaris. The inoculum was produced as above. Stems and leaves were inoculated without prior wounding using a spore suspension produced by flooding four week old cultures with 10 ml sterile distilled water. The conidial concentration was adjusted to 2 × 10⁵ ml^-1 and finally one drop of Tween 20 (as detergent) was added. Symptoms were observed two weeks after inoculation.

For the molecular analysis, strains were grown on malt extract (MADW) agar plates (Smith and Onions 1994) at 28°C for 5–7 days. The isolates were subcultured onto fresh MADW plates and incubated at 28°C for 7–10 days prior to DNA extraction.

Total genomic DNA was obtained from a small loopful (1 µl) of each strain using a proprietary complex DNA release solution (microLYSIS®–PLUS; Microzone Ltd, UK) in accordance with manufacturer’s instructions. The thermal cycler lysis profile was: 15 min at 65°C, 2 min at 96°C, 4 min at 65°C, 1 min at 96°C, 1 min at 65°C, 30 s at 96°C and hold at 20°C.

Partial ribosomal RNA gene clusters (part of 18S small subunit RNA gene, internal transcribed spacer 1 (ITS1), 5.8S ribosomal RNA gene, internal transcribed spacer 2 (ITS2), part of 28S large subunit ribosomal RNA gene) were amplified by polymerase chain reaction (PCR) using primer set TW81 (fwd): 5’–GTTTCCGTAGGTGAACCTGC–3’ & AB28 (rev): 5`–ATATGCTTAAGTTCAGCGGGT–3’ (Curran et al. 1994; Sigma Genosys, UK). Part of the glyceraldehyde 3-phosphate dehydrogenase gene was amplified using the primers GDF: 5’-GCCGTCAACGACCCCTTCATTGA-3’ & GDR: 5’-GGGTGGAGTCGTACTTGAGCATGT-3’ (Prihastuti et al. 2009; Sigma Genosys, UK). PCR was undertaken in a ThermoHybaid PCR Express thermal cycler (Thermo-Hybaid, UK) using a reaction mix containing 3 pmoles of each primer, 1 µl of template DNA solution and 10 µl of MegaMix-Royal (Microzone Ltd, UK) containing optimised mixture of Taq polymerase, anti-Taq polymerase monoclonal antibodies in 2 × Reaction Buffer (6 mM MgCl₂) with 400 µM dNTPs made up to a final volume of 20 µl with sterilised ultrapure H₂O. Amplification conditions were: 95°C for 5 min followed by 30 cycles of 30 s at 95°C, 30 s at 50°C, 45 s at 72°C, followed by 5 min at 72°C and hold at 10°C.

Aliquots (4 µl) of amplification products were assessed for quality by gel electrophoresis using 1.5 % Seakem LE agarose (BMA, UK) for 2 h at 5V cm^-1 in half-strength Tris-Borate-EDTA buffer (i.e., 0.5 × TBE buffer; 45 mM Tris; 45 mM Boric acid; 1.25mM EDTA, pH 7.5, see Sambrook et al. 1989) containing 5 μl of SafeView Nucleic Acid Stain (NBS Biologicals Ltd, UK) per 100 ml of buffer. Gel images were captured by using the U:Genius gel documentation system (Syngene, UK) and stored as TIFF bitmaps for later use.

Remaining unused PCR products were purified with the microCLEAN PCR Purification Kit (Microzone Ltd, UK) following the manufacturer’s instructions. The purified PCR products were utilised in sequencing reactions undertaken in a Primus 96 plus thermal cycler (MWG-BIOTECH AG, Germany) by using BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems) with primer TW81 (as above). Sequencing conditions were: 96°C for 1 min followed by 25 cycles of 20 s at 96°C, 10 s at 50°C, 4 min at 60°C (ramp rate: 1°C s^-1). Excess unincorporated BigDye was removed with DyeEx 2.0 affinity columns (Qiagen Ltd., UK) according to the manufacturer’s instructions and the sequencing reaction products were suspended in HiDi Formamide (Applied Biosystems, UK). These products were separated on a capillary array 3130 Genetic Analyser (Applied Biosystems, UK).

Sequence trace files were first assessed for quality using Sequencing Analysis Software v5.2 Patch 2 (Applied Biosystems, UK) and then checked manually using the software package Chromas v2.23 (Technelysium, Australia) and exported as text files. Sequences were deposited in GenBank and Accession numbers obtained (see Table 1).

Sequences of studied species were aligned using the default parameters of Clustal W (Thompson et al. 1994), then optimised manually using the CLUSTALW plug-in of MEGA5 (Tamura et al. 2011). Phylogenetic inferences were made from Neighbour Joining trees constructed from Maximum Likelihood in Mega5. Branch support was estimated by bootstrap analysis (1000 replicates). Accession numbers of rDNA ITS and GAPDH sequences derived from the public databases are cited on the phylogenetic trees.

Results Pathogenicity

Besides Cicer arietinum (from which the tester strain CP2035 (IMI 332702) was isolated), the following leguminous plants were found to function as hosts after experimental inoculation: Glycine max, Phaseolus vulgaris, Pisum sativum, Vicia faba and Vigna unguiculata. The main symptoms were evident as brown to black lesions on the lower stem parts, within which acervuli develop. Leaves also showed similar symptoms in all species, in addition to chlorosis. The symptoms were very similar to those caused by Ascochyta rabiei, a well-known and commonly occurring pathogen causing ascochyta blight on chickpea.

Taxonomy Discussion

The genus Volutella is poorly researched and no modern monograph is available, but some of the more well-known species, including the type Volutella ciliata, were included in a recent phylogenetic study of Fusarium-like fungi (Gräfenhan et al. 2011). This work demonstrated that Volutella (as represented by its type) occupies a distinct clade within the Nectriaceae, with Chaetopsina as sister group and Pseudonectria buxi (the anamorph of which was at one time ascribed to Volutella) also related. Volutella in its currently understood sense is clearly polyphyletic (Seifert et al. 2011), with many of its constituent species referable to other genera.

Lectera has brightly coloured sporodochia surrounded by brown setae (those in true Volutella species are hyaline). Other sporodochial genera with these characteristics include Kutilakesa, Sarcopodium and Actinostilbe (Seifert et al. 2011). The taxonomic affinities of the type of Kutilakesa are currently unclear (no sequences are available), but the only other species in that genus has a Nectriella teleomorph (Alfieri and Samuels 1979) and is therefore likely to belong to the Hypocreales. The type of Sarcopodium belongs to the Lanatonectria clade (Nectriaceae, Hypocreales) according to Summerbell et al. (2011). Both Kutilakesa and Sarcopodium have flexuous verruculose setae with rounded apices, in contrast to Lectera, where they are straight, hardly ornamented and tapering to an acute tip. On one occasion, a teleomorphic fungus with thin-walled asci and aseptate ascospores was observed on old wilted plant material infected by Lectera colletotrichoides, but the observation could not be repeated and we are not confident that the two fungi are genetically connected.

One other species of Volutella has orange sporodochia surrounded by brown tapering setae, in common with Lectera colletotrichoides, Volutella melaloma Berk. & Br. which was described from dead leaves of Carex in the UK (Berkeley and Broome 1850). It is possible that this species is congeneric with Lectera colletotrichoides, but it differs in a number of important characters: the conidiogenous cells are thicker-walled and do not taper, the setae are longer, more closely septate and smooth-walled, and the conidia are significantly larger and more tapered, measuring 15–18 × 3.5–4.5 µm. No recently collected material is available for sequencing.

The ITS sequences generated in this study strongly suggest that Lectera has affinities with the Plectosphaerellaceae, and may be a sister group to Verticillium (Fig. 1), although this relationship only receives weak bootstrap support. That systematic relationship was previously noted incidentally by Réblová and Seifert (2004), while researching into the phylogeny of Conioscypha and its relatives. Many fungi in these groups are wide-spectrum soil-borne plant pathogens, in common with Lectera. The Plectosphaerellaceae includes a series of Acremonium-like fungi as well as Plectosphaerella, Verticillium, Gibellulopsis and Musicillium (Zare et al. 2004, 2007). Verticillium has recently been monographed using multigene phylogenetic data (Inderbitzin et al. 2011), but its generic position was not assessed. Based on LSU and SSU rDNA data, Réblová et al. (2011) considered the Plectosphaerellaceae to be well-defined, and a sister group with the Glomerellales to the Microascales, an order containing important plant pathogens such as Ceratocystis.

Lectera colletotrichoides contains two distinct ITS phylotypes, IMI 265740 differing from the other strains sequenced by only a single base pair. The ITS sequence of Lectera longa differs from Lectera colletotrichoides by three short insertions and a single substitution, and this combined with differences in conidial length and lengh/width ratio justifies its separation. The distinction between the two species is supported by GAPDH sequences also (see fig. 3). The gene fragment sequenced here is a ~200 bp intron in the glyceraldehyde 3-phosphate dehydrogenase gene, used for phylogenetic studies of Colletotrichum by Damm et al. (2009) and Guerber et al. (2003), not the same fragment used for Verticillium by Inderbitzin et al. (2011).

The wide distribution of Lectera colletotrichoides and its association with agricultural ecosystems make it difficult to assess its geographical origin, although its apparent preference for dry-land legumes might indicate an evolutionary history centred on the Near East. However, judging from environmental sequencing studies, it (or a closely related species) does seem to be present in soils in SE USA (Wu et al. 1997, Jackson 2010), suggesting that its distribution in that country is not as restricted as indicated by Chilton (1954).