Research Article
Print
Research Article
Morphological and phylogenetic characterisation of two new soil-borne fungal taxa belonging to Clavicipitaceae (Hypocreales, Ascomycota)
expand article infoZhi-Yuan Zhang‡, Yao Feng‡, Shuo-Qiu Tong§, Chen-Yu Ding§, Gang Tao‡, Yan-Feng Han§
‡ Guizhou Minzu University, Guiyang, China
§ Guizhou University, Guiyang, China

Corresponding author: Zhi-Yuan Zhang ( zhangzhiyuan_16@163.com )

Corresponding author: Yan-Feng Han ( swallow1128@126.com )

Academic editor: Thorsten Lumbsch
© 2023 Zhi-Yuan Zhang, Yao Feng, Shuo-Qiu Tong, Chen-Yu Ding, Gang Tao, Yan-Feng Han.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Zhang Z-Y, Feng Y, Tong S-Q, Ding C-Y, Tao G, Han Y-F (2023) Morphological and phylogenetic characterisation of two new soil-borne fungal taxa belonging to Clavicipitaceae (Hypocreales, Ascomycota). MycoKeys 98: 113-132. https://doi.org/10.3897/mycokeys.98.106240
Open Access

Abstract

The fungal taxa belonging to the Clavicipitaceae (Hypocreales, Ascomycota) are widely distributed and include diverse saprophytic, symbiotic and pathogenic species that are associated with soils, insects, plants, fungi and invertebrates. In this study, we identified two new fungal taxa belonging to the family Clavicipitaceae that were isolated from soils collected in China. Morphological characterisation and phylogenetic analyses showed that the two species belong to Pochonia (Pochonia sinensis sp. nov.) and a new genus for which we propose Paraneoaraneomyces gen. nov. in Clavicipitaceae.

Key words

Clavicipitaceae, entomopathogenic fungi, new taxa, phylogeny, Pochonia, taxonomy

Introduction

Fungi are found in a wide array of ecological niches and play key roles as decomposers, mutualists and pathogens (Araújo et al. 2022). Clavicipitaceae (Ascomycota, Hypocreales) is a large fungal family with diverse ecological characteristics and includes saprophytes, symbionts and pathogens that are associated with soils, insects, plants, fungi and other invertebrates (Gams and Zare 2003; Spatafora et al. 2007; Sung et al. 2007a; Steiner et al. 2011; Kepler et al. 2012a). Currently, the family Clavicipitaceae includes 52 genera and more than 500 species (Hyde et al. 2020; Mongkolsamrit et al. 2020a, 2021; Gao et al. 2021; Chen et al. 2022). Some members of these genera are valuable as biocontrol agents in agriculture and production of antibiotics in the pharmaceutical industry (e.g. cyclosporin, fingolimod, hydroxyfungerins; Uchida et al. (2005); Mapook et al. (2022)). For example, species of Metarhizium are commercially used as biocontrol agents (Kim et al. 2020). Gao et al. (2021) reported two new entomopathogenic species belonging to the genus Parametarhizium (P. hingganense and P. changbaiense) that were isolated from the forest litters in northeast China and exhibited anti-insect activities against three farmland pests (Monolepta hieroglyphica, Callosobruchus chinensis and Rhopalosiphum maidis).

Phylogenetic analyses showed that the Verticillium section Prostrata was heterogenous and Pochonia was recognised as a distinct genus with several species that often form dictyochlamydospores and were parasitic on the nematode cysts and eggs (Zare et al. 2001). Pochonia chlamydosporia was the first recognised species of the genus Pochonia. Subsequently, several new taxa have been identified in this genus. Kepler et al. (2012b, 2014) showed that the genus Pochonia belonged to Claviciptaceae; Pochonia was polyphyletic and formed two different clades; P. chlamydosporia was the only species assigned to the monophyletic clade in the Pochonia genus, whereas the remaining species were transferred to a new genus, Metapochonia. Currently, Pochonia includes three species (P. globispora, P. boninensis and P. chlamydosporia) and four varieties (P. chlamydosporia var. ellipsospora, P. chlamydosporia var. catenulata, P. chlamydosporia var. spinulospora and P. chlamydosporia var. chlamydosporia). The species of Pochonia are commonly obtained from soil and demonstrate the ability to parasitise plant-parasitic nematodes (Nonaka et al. 2013).

In this study, we report the morphological and phylogenetic characterisation of two new taxa belonging to the family Claviciptaceae that were isolated from the urban soil samples in China.

Materials and methods

Fungal isolation and morphology

The soil samples were collected in June 2020 from the Cengong County (27°16’98’’N, 108°81’46’’E) in Kaili City, Guizhou Province, China. The fungi were isolated using the methods described previously (Zhang et al. 2023). Colonies on PDA were incubated after 14 days at 25 °C and the cultures were placed to slowly dry at 50 °C to produce the holotypes, which were deposited in the Institute of Fungus Resources, Guizhou University, Guiyang City, Guizhou, China (GZUIFR). All living cultures were stored in a metabolically inactive state (i.e. kept in sterile 30% glycerol in a –80 °C freezer) and were deposited in the GZUIFR.

The phenotype was determined by growing the single isolates in plates containing potato dextrose agar (PDA), malt extract agar (MEA), oatmeal agar (OA) and synthetic low-nutrient agar (SNA) medium. The plates were incubated in the dark at 25 °C for 14 days. The photomicrographs of the fungal structures were obtained using an OLYMPUS BX53 microscope equipped with differential interference contrast (DIC) optics, an OLYMPUS DP73 high-definition colour camera and the cellSens software version 1.18.

DNA extraction, PCR amplification and sequencing

Total DNA was extracted using the 5% chelex-100 solution as described previously (Zhang et al. 2023). The small subunit (SSU) rDNA, the internal transcribed spacer (ITS), the large subunit (LSU) rDNA, the second largest subunit of RNA polymerase II (RPB2) and the translation elongation factor EF-1α (EF1A) were PCR amplified and sequenced using primers listed in Table 1. The novel sequences identified in this study were deposited in the GenBank database (Table 2).

Table 1.
Download as
CSV
XLSX

Sequences of primers used in this study.

Molecular marker Primer name Primer sequence (5´-3´) Reference
SSU NS1 GTAGTCATATGCTTGTCTC White et al. (1990)
NS4 CTTCCGTCAATTCCTTTAAG White et al. (1990)
ITS ITS1 TCCGTAGGTGAACCTGCG White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC White et al. (1990)
LSU LR0R ACCCGCTGAACTTAAGC Moncalvo et al. (2000)
LR7 TACTACCACCAAGATCT Vilgalys and Hester (1990)
EF1A 2218R ATGACACCRACRGCRACRGTYTG Rehner and Buckley (2005)
983F GCYCCYGGHCAYCGTGAYTTYAT Rehner and Buckley (2005)
RPB2 fRPB2-5F GAYGAYMGWGATCAYTTYGG Liu et al. (1999)
RPB2-7cR CCCATRGCTTGYTTRCCCAT Liu et al. (1999)
Table 2.
Download as
CSV
XLSX

GenBank accession numbers of the sequences used in this study.

Species Strains SSU ITS LSU RPB2 EF1A References
Aciculosporium oplismeni MAFF 246966 – LC571760 LC571760 LC572054 LC572040 Tanaka et al. (2021)
Aciculosporium take MAFF 241224 – LC571753 LC571753 LC572048 LC572034 Tanaka et al. (2021)
TNS-F-60465 – LC571755 LC571756 LC572049 LC572035 Tanaka et al. (2021)
Aschersonia confluens BCC 7961 – JN049841 DQ384947 DQ452465 DQ384976 Kepler et al. (2012b)
Aschersonia placenta BCC 7869 EF469121 JN049842 EF469074 EF469104 EF469056 Sung et al. (2007ab); Kepler et al. (2012b)
Atkinsonella hypoxylon B4728 – – – KP689514 KP689546 Young et al. (2015)
Balansia epichloe A.E.G. 96-15a – JN049848 – EF468908 EF468743 Sung et al. (2007a); Kepler et al. (2012b)
Balansia henningsiana A.E.G. 96-27a AY545723 JN049815 AY545727 DQ522413 AY489610 Castlebury et al. (2004); Lutzoni et al. (2004); Spatafora et al. (2007); Kepler et al. (2012b)
Claviceps fusiformis ATCC 26019 DQ522539 JN049817 U17402 – DQ522320 Rehner et al. (1995); Spatafora et al. (2007); Kepler et al. (2012b)
Claviceps purpurea GAM 12885 – U57669 AF543789 DQ522417 AF543778 Currie et al. (2003); Spatafora et al. (2007)
SA cp 11 EF469122 EF469075 EF469105 EF469058 Sung et al. (2007ab)
Collarina aurantiaca FMR 11134 – KJ807178 KJ807181 – – Crous et al. (2014)
FMR 11784 – KJ807177 KJ807180 – – Crous et al. (2014)
Conoideocrella luteorostrata NHJ 11343 EF468995 JN049859 – – EF468801 Sung et al. (2007a); Kepler et al. (2012b)
NHJ 12516 EF468994 JN049860 – EF468946 EF468800 Sung et al. (2007a); Kepler et al. (2012b)
Conoideocrella tenuis NHJ 6293 EU369112 JN049862 EU369044 EU369087 EU369029 Johnson et al. (2009); Kepler et al. (2012b)
Corallocytostroma ornithocopreoides WAC 8705 – – – LT216620 LT216546 Píchová et al. (2018)
Dussiella tuberiformis J.F.White – – – JQ257020 JQ257027 Kepler et al. (2012a)
Ephelis japonica CBS 236.64 – MH858427 – – – Vu et al. (2019)
Eph.oryzae – AB038564 – – – Tanaka et al. (2001)
Ephelis tripsaci CBS 857.72 – KP859042 KP858978 – – Hernández-Restrepo et al. (2016)
Epichloë elymi C.Schardl 760 – – AY986924 – AY986951 Chaverri et al. (2005a)
Epichloë typhina ATCC 56429 – JN049832 U17396 DQ522440 AF543777 Rehner et al. (1995); Currie et al. (2003); Spatafora et al. (2007); Kepler et al. (2012b)
Helicocollum surathaniense BCC 34463 – – KT222328 – KT222336 Luangsa-ard et al. (2017a)
BCC 34464 – – KT222329 – KT222337 Luangsa-ard et al. (2017a)
Heteroepichloe bambusae Ba-01 – AB065426 – – – Tanaka et al. (2002)
Bo-01 – AB065428 – – – Tanaka et al. (2002)
Heteroepichloe sasae E.sasae-H – AB065432 – – – Tanaka et al. (2002)
E.sasae-N – AB065431 – – – Tanaka et al. (2002)
Keithomyces carneus CBS 239.32 EF468988 NR_131993 NG_057769 EF468938 EF468789 Sung et al. (2007a)
Keithomyces sp. CBS 126563 MT078871 MT078883 MT078856 MT078921 – Mongkolsamrit et al. (2020a)
Marquandomyces marquandii CBS 182.27 EF468990 MH854923 MH866418 EF468942 EF468793 Sung et al. (2007a); Vu et al. (2019)
Marquandomyces sp. CBS 127132 MT078872 MT078882 MT078857 MT078922 – Mongkolsamrit et al. (2020a)
Metapochonia bulbillosa JCM 18596 AB758252 AB709836 AB709809 AB758690 AB758460 Nonaka et al. (2013)
CBS 145.70 AF339591 MH859529 AF339542 EF468943 EF468796 Sung et al. (2001); Sung et al. (2007a); Vu et al. (2019)
Metapochonia cordycipiticonsociata CGMCC 3.17365 KM263572 KM263569 KM263573 KM263579 KM263584 Huang et al. (2015)
CGMCC 3.17366 KM263570 KM263567 KM263574 KM263580 KM263582 Huang et al. (2015)
Metapochonia goniodes CBS 891.72 AF339599 AJ292409 AF339550 DQ522458 DQ522354 Zare et al. (2000); Sung et al. (2001); Spatafora et al. (2007)
Metapochonia microbactrospora CBS 101433 – AJ292408 AF339538 KJ398701 KJ398794 Zare et al. (2000); Kepler et al. (2014)
Metapochonia rubescens CBS 464.88 AF339615 MH862138 MH873830 EF468944 EF468797 Sung et al. (2001); Sung et al. (2007a); Vu et al. (2019)
JCM 18620 AB758247 AB709859 AB709832 AB758685 AB758455 Nonaka et al. (2013)
Metapochonia suchlasporia var. catenata CBS 248.83 – MH861579 MH873310 KJ398696 KJ398789 Kepler et al. (2014); Vu et al. (2019)
CBS 251.83 – MH861580 MH873311 KJ398697 KJ398790 Kepler et al. (2014); Vu et al. (2019)
Metarhiziopsis microspora CEHS133a – EF464589 EF464571 – – Marcelino et al. (2009)
INEHS133a – EF464583 EF464572 – – Marcelino et al. (2009)
Metarhizium anisopliae ARSEF 7487 – HQ331446 – DQ468370 DQ463996 Bischoff et al. (2006); Schneider et al. (2011)
CBS 130.71 MT078868 MT078884 MT078853 MT078918 MT078845 Mongkolsamrit et al. (2020a)
Metarhizium flavoviride CBS 125.65 MT078869 MT078885 MT078854 MT078919 MT078846 Mongkolsamrit et al. (2020a)
CBS 700.74 MT078870 – MT078855 MT078920 MT078847 Mongkolsamrit et al. (2020a)
CBS 218.56 – MH857590 MH869139 KJ398694 KJ398787 Kepler et al. (2014); Vu et al. (2019)
Moelleriella phyllogena CUP 067785 – – EU392610 – EU392674 Chaverri et al. (2008)
CUP 067793 – – EU392608 – EU392672 Chaverri et al. (2008)
Moelleriella umbospora CUP 067817 – – EU392628 – EU392688 Chaverri et al. (2008)
Morakotia fusca BCC 64125 – – KY794862 – KY794857 Mongkolsamrit et al. (2021)
BCC 79272 – – KY794861 – KY794856 Mongkolsamrit et al. (2021)
Mycophilomyces periconiae CPC 27558 – KY173418 KY173509 – – Crous et al. (2013)
Myriogenospora atramentosa A.E.G 96-32 AY489701 – AY489733 DQ522455 AY489628 Castlebury et al. (2004); Spatafora et al. (2007)
Neoaraneomyces araneicola DY101711 – MW730520 MW730609 MW753026 MW753033 Chen et al. (2022)
DY101712 – MW730522 MW730610 MW753027 MW753034 Chen et al. (2022)
Neobarya parasitica Marsons/n – KP899626 KP899626 – – Lawrey et al. (2015)
Niesslia exilis CBS 560.74 AY489688 MG827005 AY489720 – AY489614 Castlebury et al. (2004)
Nigelia aurantiaca BCC 13019 GU979939 – GU979948 GU979971 GU979957 Luangsa-ard et al. (2017b)
Nigelia martialis EFCC 6863 – – JF415974 – JF416016 Kepler et al. (2012b)
Orbiocrella petchii NHJ 6209 EU369104 JN049861 EU369039 EU369081 EU369023 Johnson et al. (2009); Kepler et al. (2012b)
NHJ 6240 EU369103 – EU369038 EU369082 EU369022 Johnson et al. (2009)
Papiliomyces liangshanensis EFCC 1452 EF468962 – EF468815 – EF468756 Sung et al. (2007a)
EFCC 1523 EF468961 – EF468814 EF468918 EF468755 Sung et al. (2007a)
Papiliomyces shibinensis GZUH SB13050311 KR153588 KR153585 – – KR153589 Wen et al. (2015)
Parametarhizium changbaiense CGMCC 19143 MN590231 MN589741 MN589994 MT921829 MN908589 Gao et al. (2021)
Parametarhizium hingganense CGMCC 19144 MN055706 MN055703 MN061635 MT939494 MN065770 Gao et al. (2021)
Paraneoaraneomyces sinensis ZY 22.006 OQ709248 OQ709254 OQ709260 OQ719621 OQ719626 This study
ZY 22.007 OQ709249 OQ709255 OQ709261 OQ719622 OQ719627 This study
ZY 22.008 OQ709250 OQ709256 OQ709262 OQ719623 OQ719628 This study
Parepichloe cinerea Ne-01 – AB065425 – – – Tanaka et al. (2002)
Periglandula ipomoeae IasaF13 – – – KP689517 KP689568 Steiner et al. (2011)
Pochonia boninensis JCM 18597 AB758255 AB709858 AB709831 AB758693 AB758463 Nonaka et al. (2013)
Pochonia chlamydosporia CBS 101244 DQ522544 JN049821 DQ518758 DQ522424 DQ522327 Spatafora et al. (2007); Kepler et al. (2012b)
Pochonia chlamydosporia var. catenulata CBS 504.66 AF339593 AJ292398 AF339544 EF469120 EF469069 Zare et al. (2000); Sung et al. (2001); Sung et al. (2007a)
Pochonia chlamydosporia var. catenulata JCM 18598 AB758248 AB709837 AB709810 AB758686 AB758456 Nonaka et al. (2013)
JCM 18600 AB758266 AB709839 AB709812 AB758704 AB758474 Nonaka et al. (2013)
Pochonia chlamydosporia var. chlamydosporia JCM 18605 AB758261 AB709844 AB709817 AB758699 AB758469 Nonaka et al. (2013)
JCM 18607 AB758270 AB709846 AB709819 AB758708 AB758478 Nonaka et al. (2013)
Pochonia chlamydosporia var. ellipsospora JCM 18609 AB758257 AB709848 AB709821 AB758695 AB758465 Nonaka et al. (2013)
JCM 18611 AB758265 AB709850 AB709823 AB758703 AB758473 Nonaka et al. (2013)
Pochonia chlamydosporia var. spinulospora JCM 18613 AB758258 AB709854 AB709827 AB758696 AB758466 Nonaka et al. (2013)
JCM 18619 AB758272 AB709857 AB709830 AB758710 AB758480 Nonaka et al. (2013)
Pochonia globispora CBS 203.86 – MH861942 MH873631 – – Vu et al. (2019)
Pochonia sinensis ZY 22.009 OQ709251 OQ709257 OQ709263 OQ719624 OQ719629 This study
ZY 22.010 OQ709252 OQ709258 OQ709264 OQ719625 OQ719630 This study
Pseudometarhizium araneogenum DY101741 – MW730532 MW730618 MW753030 MW753037 Chen et al. (2022)
DY101801 – MW730536 MW730623 MW753032 MW753039 Chen et al. (2022)
Pseudometarhizium lepidopterorum SD05361 – MW730543 MW730624 – MW753041 Chen et al. (2022)
SD05362 – MW730611 MW730629 – MW753042 Chen et al. (2022)
Purpureomyces khaoyaiensis BCC 1376 KX983468 – KX983462 KX983465 KX983457 Luangsa-ard et al. (2017b)
Purpureomyces maesotensis BCC 89300 – MN781917 MN781876 – MN781733 Mongkolsamrit et al. (2020a)
BCC 88441 – MN781916 MN781877 MN781824 MN781734 Mongkolsamrit et al. (2020a)
Purpureomyces pyriformis BCC 85074 – MN781929 MN781873 MN781821 MN781730 Mongkolsamrit et al. (2020a)
Regiocrella camerunensis ARSEF 7682 – – DQ118735 – DQ118743 Chaverri et al. (2005b)
Rotiferophthora angustispora CBS 101437 AF339584 AJ292412 AF339535 DQ522460 AF543776 Zare et al. (2000); Sung et al. (2001); Currie et al. (2003); Spatafora et al. (2007)
Samuelsia chalalensis CUP 067856 – – EU392637 – EU392691 Chaverri et al. (2008)
Samuelsia mundiveteris BCC 40021 – – GU552152 – GU552145 Mongkolsamrit et al. (2017)
Samuelsia rufobrunnea CUP 067858 – – AY986918 – AY986944 Chaverri et al. (2005a)
Shimizuomyces paradoxus EFCC 6279 EF469131 JN049847 EF469084 EF469117 EF469071 Sung et al. (2007ab); Kepler et al. (2012b)
EFCC 6564 EF469130 EF469083 EF469118 EF469072 Sung et al. (2007ab)
Sungia yongmunensis EFCC 2131 EF468977 JN049856 EF468833 – EF468770 Sung et al. (2007a); Kepler et al. (2012b)
EFCC 2135 EF468979 – EF468834 – EF468769 Sung et al. (2007a)
Tyrannicordyceps fratricida TNS 19011 JQ257022 – JQ257023 JQ257021 JQ257028 Kepler et al. (2012a)
Ustilaginoidea dichromenae MRLIB 9228 – – – JQ257018 JQ257025 Kepler et al. (2012a)
Ustilaginoidea virens ATCC 16180 – – – JQ257019 JQ257026 Kepler et al. (2012a)
MAFF 240421 – JQ349068 JQ257011 JQ257017 JQ257024 Kepler et al. (2012a)
Yosiokobayasia kusanagiensis TNS-F18494 JF415954 JN049873 JF415972 – JF416014 Kepler et al. (2012a)
Pleurocordyceps aurantiaca MFLUCC 17-2113 MG136904 MG136916 MG136910 MG136870 MG136875 Xiao et al. (2018)
Pleurocordyceps marginaliradians MFLU 17-1582 MG136908 MG136920 MG136914 MG271931 MG136878 Xiao et al. (2018)

Sequences highlighted in bold were generated in this study.

Phylogenetic analyses

Lasergene software (version 6.0, DNASTAR) was used to analyse the ambiguous bases of the PCR amplicon sequences. The SSU, ITS, LSU, RPB2 and EF1A sequences were retrieved from the GenBank database, based on previous studies by Mongkolsamrit et al. (2018, 2020b, 2021), Gao et al. (2021), Chen et al. (2022) and others (Table 2). The sequences for individual loci were aligned using the MAFFT multiple sequence alignment software version 7.037b (Katoh and Standley 2013) and modified manually using the MEGA software version 6.06 (Tamura et al. 2013). The SSU, ITS, LSU, RPB2 and EF1A sequences were then combined using the “Concatenate Sequence” function in the PhyloSuite version 1.2.3 (Xiang et al. 2023). The best-fit substitution model was selected for the Bayesian analysis and the Maximum Likelihood analysis using the corrected Akaike Information Criterion (AICc) in the ModelFinder (Kalyaanamoorthy et al. 2017).

In the present study, the combined loci were analysed using the Bayesian Inference (BI) and the Maximum Likelihood (ML) methods. MrBayes version 3.2 (Ronquist et al. 2012) was used for the BI analysis. The Markov Chain Monte Carlo (MCMC) method was used to perform 108 simulations with a sampling frequency of 103 generations and a 25% burn-in. ML analysis was performed using the IQ-TREE software version 1.6.11 (Nguyen et al. 2015) and 104 bootstrap (BS) tests were performed using the ultrafast algorithm (Minh et al. 2013). The BI and ML analyses were performed in the PhyloSuite platform version 1.2.3 (Xiang et al. 2023).

Results

Phylogenetic analyses

Pleurocordyceps aurantiacus (MFLUCC 17-2113) and P. marginaliradians (MFLU 17-1582) were used as the outgroup for the phylogenetic analysis. The concatenated sequences (SSU, ITS, LSU, RPB2 and EF1A) included 113 taxa and consisted of 3,368 nucleotides (SSU, 905 bp; ITS, 448 bp; LSU, 453 bp; RPB2, 756 bp; and EF1A, 806 bp) with inserted gaps (Suppl. material 1). ModelFinder was used to obtain the best-fit substitution model, based on the AICc algorithm and are listed in Suppl. material 2.

The phylogenetic trees (Fig. 1) constructed according to the ML and BI analyses were largely congruent and strongly supported in most clades. Most genera were clustered into independent clades (Chen et al. 2022; Fig. 1). Two new isolates, ZY 22.009 and ZY 22.010, belonged to a new species below named Pochonia sinensis. They were clustered into a single clade with high support value (100% BS support [BS]/1 posterior probability [PP]) under the genus Pochonia. The genus Pochonia was closely related to Rotiferophthora (Fig. 1). This result was in agreement with the previous studies by Kepler et al. (2014) and Chen et al. (2022). Furthermore, the remaining three new isolates, ZY 22.006, ZY 22.007 and ZY 22.008 clustered into another independent clade with a high support value (100% BS/1 PP) and showed a close relationship with Neoaraneomyces.

Figure 1. 

Phylogram based on the Maximum Likelihood (ML) analysis using the SSU, ITS, LSU, RPB2 and EF1A sequences of Clavicipitaceae. The ML bootstrap values (≥ 70%) and the Bayesian posterior probability values (≥ 0.70) are indicated along the branches (BP/ML). The new taxa are highlighted in bold.

Taxonomy

Paraneoaraneomyces Zhi.Y. Zhang & Y.F. Han, gen. nov.

MycoBank No: 848089

Etymology

Based on its close phylogenetic relationship to Neoaraneomyces.

Geographical distribution

China.

Description

Saprobic in soil. Sexual morph: not observed. Asexual morph: Hyphae hyaline, smooth, branched, septate. Phialides arising from aerial hyphae or hyphae regimental, solitary, straight to flexuous, tapering with enlarged base, smooth, hyaline. Conidia borne on the apex of the phialides or in small globose heads at the apices of the phialides. Conidia cymbiform to reniform, smooth-walled, one-celled, adhering in globose heads or the apex of phialides.

Type species

Paraneoaraneomyces sinensis Zhi. Y. Zhang & Y. F. Han.

Notes

Currently, the family Clavicipitaceae includes 52 genera and more than 500 species (Hyde et al. 2020; Mongkolsamrit et al. 2020a, 2021; Gao et al. 2021; Chen et al. 2022). Of these genera, no SSU, ITS, LSU, RPB2 and EF1A sequences are available for the genera Cavimalum, Epicrea, Helminthascus, Konradia, Loculistroma, Mycomalus and Neocordyceps, while the sequences for the genera Nigrocornus, Pseudomeria and Romanoa are unverified or lacking (https://www.ncbi.nlm.nih.gov/, accessed on 8 May 2023). Therefore, we could not compare the phylogenetic relationships between these genera and Paraneoaraneomyces. In addition, amongst these genera, Cavimalum, Epicrea, Helminthascus, Konradia, Mycomalus and Sphaerocordyceps no asexual morph has been reported (White et al. 2003; Hyde et al. 2020). We, therefore, have not been able to compare the morphological characteristics between these genera and Paraneoaraneomyces. Phylogenetically, Paraneoaraneomyces sinensis represents a well-supported monophyletic lineage in the family Clavicipitaceae and closely related to Neoaraneomyces (Fig. 1). Morphologically, Paraneoaraneomyces can be distinguished from other genera in the family Clavicipitaceae by the cymbiform to reniform conidia adhering to the apex of the phialides or in the form of small globose heads at the apex of the phialides and the phialides were solitary, straight to flexuous and arose from the aerial or regimental hyphae.

Paraneoaraneomyces sinensis Zhi. Y. Zhang & Y. F. Han, sp. nov.

MycoBank No: 848160
Fig. 2

Etymology

After the country of origin.

Type

Kaili City, Guizhou Province, China; 27°17’56’’N, 108°82’68’’E; isolated from the green belt soil in July 2022; Zhi-Yuan Zhang (holotype ZY H-22.006, ex-holotype ZY 22.006, ibid., ZY 22.007).

Geographical distribution

Guizhou Province, China.

Description

Culture characteristics (14 days at 25 °C): Colonies on PDA 35–37 mm in diameter, white, slightly raised at centre, fluffy, nearly round, margin regular; reverse: pale yellow. Colonies on MEA 35–37 mm in diameter, white, plicated, flocculent, nearly round, margin regular; reverse: pale yellow. Colonies on SNA 29–31 mm in diameter, white, flat, felty, nearly round, margin regular; reverse: white, compact at centre. Colonies on OA 36–38 mm in diameter, white, felty, early round, margin regular; reverse: white.

Figure 2. 

Morphology of Paraneoaraneomyces sinensis sp. nov. a–d colony on PDA, MEA, SNA and OA after 14 d at 25 °C (upper surface and lower surface) e–h phialides, conidia i–k phialides are arising from hyphae regimental, conidia. Scale bars: 10 μm (e–k).

Hyphae hyaline, smooth, branched, septate, 1.0–3.0 μm in diameter. Phialides arising from aerial hyphae or hyphae regimental, solitary, straight to flexuous, tapering with enlarged base, smooth, hyaline, 19.0–34.0 × 0.5–1.5 µm (av. 27.0 × 1.1, n = 50). Conidia borne on the apices of the phialides or in small globose heads at the apex of the phialides. Conidia cymbiform to reniform, smooth-walled, one-celled, adhering in globose heads or the apex of phialides, 3.0–5.5 × 1.0–1.5 µm (av. 4.3 × 1.4, n = 50). Sexual morph undetermined.

Additional material examined

Kaili City, Guizhou Province, China; 27°17’72’’N, 108°83’10’’E; isolated from the green belt soil in July 2022; Zhi-Yuan Zhang, ZY 22.008.

Notes

The multi-locus phylogenetic analyses showed that Paraneoaraneomyces sinensis is closely related to Neoaraneomyces araneicola (Fig. 1), but can be distinguished, based on differences in their sequence similarity. The ITS sequence of P. sinensis showed 93.6% similarity, differences in 13 base pairs (bp) and 22 gaps when compared to the 551 bp ITS sequence of N. araneicola DY101711 (Type strain). The LSU sequence of P. sinensis showed 99.3% similarity, differences in 5 bp and without gaps when compared to the 832 bp LSU sequence of N. araneicola DY101711. The RPB2 sequence of P. sinensis showed 83.9% similarity, differences in 158 bp and 8 gaps when compared to the 1,034 bp RPB2 sequence of N. araneicola DY101711. The EF1A sequence of P. sinensis showed 96.2% similarity, differences in 35 bp and without gaps when compared to the 937 bp EF1A sequence of N. araneicola DY101711. Morphologically, the phialides of P. sinensis were solitary, straight to flexuous, arising from the aerial or regimental hyphae compared to the phialides of N. araneicola that were solitary or in groups of two to four and arose from the aerial hyphae (Chen et al. 2022). Furthermore, the conidia of P. sinensis were cymbiform to reniform and adhering to the apex of the phialides or in small globose heads at the apex of the phialides compared with fusiform to ellipsoidal conidia that were arranged as chains in N. araneicola (Chen et al. 2022).

Pochonia sinensis Zhi. Y. Zhang & Y. F. Han, sp. nov.

MycoBank No: 848088
Fig. 3

Etymology

After the country of origin.

Type

Kaili City, Guizhou Province, China; 27°17’56’’N, 108°82’68’’E; isolated from the green belt soil in July 2022; Zhi-Yuan Zhang (holotype ZY H-22.009, ex-holotype ZY 22.009, ibid., ZY 22.010).

Geographical distribution

Guizhou Province, China.

Description

Culture characteristics (14 days at 25 °C): Colonies on PDA fast-growing, reaching 74–77 mm in diameter, white, flat, fluffy to flocculent, margin identified; reverse: white. Colonies on MEA 67 mm in diameter, white, flat, compact, fluffy to flocculent, margin identified; reverse: white. Colonies on SNA 59–60 mm in diameter, white, aerial mycelia sparse, flat, flocculent, nearly round, margin regular; reverse: white. Colonies on OA 58 mm in diameter, white, aerial mycelia sparse, flat, felty, nearly round; reverse: white.

Figure 3. 

Morphology of Pochonia sinensis sp. nov. a–d colony on PDA, MEA, SNA and OA after 14 d at 25 °C (upper surface and lower surface) e–j phialides, conidia. Scale bars: 10 μm (e–j).

Hyphae hyaline, smooth, branched, septate, 0.5–1.5 μm in diameter. Phialides produced from prostrate aerial hyphae, solitary or rarely in whorls of 2–3, slender, tapering towards the tip, 5.5–51.0 × 0.5–1.5 µm (av. 22.0 × 1.0, n = 50). Conidia in small globose heads at the apex of the phialides. Conidia ovoid, sometimes subglobose or ellipsoidal, smooth-walled, one-celled, adhering in globose heads, 3.0–4.5 × 2.0–3.0 µm (av. 3.6 × 2.5, n = 50). Swollen hyphae not observed. Dictyochlamydospores not observed. Crystals absent. Sexual morph undetermined.

Notes

The multi-locus phylogenetic analyses (Fig. 1) and morphological characteristics showed that ZY 22.009 and ZY 22.010 represent a new species of Pochonia. Morphologically, P. sinensis shared similar morphological characters with P. globispora and P. boninensis, but does not produce dictyochlamydospores (Zare and Gams 2007; Nonaka et al. 2013). However, P. sinensis can be easy distinguished from P. globispora and P. boninensis, based on the ovoid conidia and the absence of irregularly swollen hyphae (Zare and Gams 2007; Nonaka et al. 2013).

Discussion

In this study, we proposed a new Pochonia species and a new genus Paraneoaraneomyces within the family Clavicipitaceae. This study has important implications for the species diversity, taxonomy and geographic distribution of Clavicipitaceae (Hypocreales).

Fungi are highly abundant eukaryotes (Purvis and Hector 2000) with significant diversity and cosmopolitan distribution and play an essential role in the functions and processes of a wide variety of ecosystems. However, only 150,000 fungal species have been described to date and its plausible that several fungal genera and species are yet to be discovered. Taxonomy is a fundamental discipline of naming, describing and classifying a living organism, plant or fungus and represents the initial step towards understanding its biodiversity, ecological niche and biotechnological utility (Yasanthika et al. 2022). An increasing number of new fungal taxa are constantly being discovered, but mycotaxonomy of a new fungal species is challenging (Aime et al. 2021). Currently, integration of multiple methods is recommended for the taxonomic classification of newly-identified fungal species. Amongst these methods, morphological characteristics and phylogenetic analysis are of primary importance in addition to the ecological habitats, as well as the physiological and biochemical characteristics. The family Clavicipitaceae includes many entomopathogenic fungi, but only a small number of taxa are parasitic and most others show diverse nutritional patterns. Therefore, utmost care is necessary when classifying a new fungal isolate, based on the substrate or a parasitic fungus on an insect host. All the isolates obtained in this study were isolated from soil. Further investigations are necessary to determine if these new fungal isolates were parasitic to insects.

Soil is the largest natural reservoir of microorganisms and is inhabited by a large number of fungi. Taxonomy of soil fungi is an emerging area of research. Currently, only about 800,000 species of soil fungi have been identified worldwide (Senanayake et al. 2022). Majority of studies have focused on the diversity of fungi in the forest, silt, riparian, coastal and contaminated soils (Fracetto et al. 2013; Frac et al. 2018; Satyanarayana et al. 2019), but relatively little is known regarding the fungal taxa in the urban soils. Taxonomic studies of soil fungi use both culture-dependent and non-culture-dependent methods. The culture methods are of great interest because the isolated strains can be used to obtain genetic sequence and morphological data in applied research (Yasanthika et al. 2022). The new fungi described in this study were all isolated from soil and their ecological functions and applications are worthy of further study.

1 Host is a plant 2
– Host insects, nematodes, rotifers, protozoans or soil 3
2 Asexual morph produced Metarhiziopsis
– Sexual morph produced 4
3 Conidia with adhesive hapteron Pseudomeria
– Conidia without adhesive hapteron 5
4 Stromata stalked Neocordyceps
– Stromata lacking stalks 6
5 Conidia cymbiform to reniform Paraneoaraneomyces
– Conidia fusiform or ellipsoidal 7
6 Host bamboo Loculistroma
– Host grasses Nigrocornus
7 Conidiophores mononematous Neoaraneomyces
– Conidiophores synnematous or mononematous Pseudometarhizium

Acknowledgements

We greatly appreciate Dr. Bensch for her advice on the new species names. We appreciate Charlesworth for the English language editing to the whole manuscript.

Additional information

Conflict of interest

No conflict of interest was declared.

Ethical statement

No ethical statement was reported.

Funding

This work was financially supported by grants from the Guizhou Provincial Science and Technology Projects (ZK[2023]155), the Science Research Youth Program in Colleges and Universities (Qiankeji[2022]153), and the National Natural Science Foundation of China (no. 32060011, 31860520).

Author contributions

The individual contributions are as follows: Zhi-Yuan Zhang, Yao Feng, Shuo-Qiu Tong, and Chen-Yu Ding. conceptualized the study, performed microscopical examinations of fungal specimens, wrote, edited, and reviewed the manuscript. Zhi-Yuan Zhang and Yao Feng conducted phylogenetic studies. Gang Tao and Yan-Feng Han wrote, reviewed, and edited the manuscript. Shuo-Qiu Tong and Chen-Yu Ding prepared figures. Zhi-Yuan Zhang reviewed the manuscript and provided funding. All authors have read and agreed to the published version of the manuscript.

Author ORCIDs

Zhi-Yuan Zhang https://orcid.org/0000-0003-2031-7518

Yao Feng https://orcid.org/0000-0002-0888-8775

Shuo-Qiu Tong https://orcid.org/0009-0006-9422-5551

Chen-Yu Ding https://orcid.org/0000-0003-2639-3300

Gang Tao https://orcid.org/0000-0002-0882-3752

Yan-Feng Han https://orcid.org/0000-0002-8646-3975

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Aime MC, Miller AN, Aoki T, Bensch K, Cai L, Crous PW, Hawksworth DL, Hyde KD, Kirk PM, Lücking R, May TW, Malosso E, Redhead SA, Rossman AY, Stadler M, Thines M, Yurkov AM, Zhang N, Schoch CL (2021) How to publish a new fungal species, or name, version 3.0. IMA Fungus 12(1): e11. https://doi.org/10.1186/s43008-021-00063-1
  • Araújo JPM, Lebert BM, Vermeulen S, Brachmann A, Ohm RA, Evans HC, de Bekker C (2022) Masters of the manipulator: Two new hypocrealean general, Niveomyces (Cordycipitaceae) and Torrubiellomyces (Ophiocordycipitaceae), parasitic on the zombie ant fungus Ophiocordyceps camponoti-floridani. Persoonia 49(1): 171–194. https://doi.org/10.3767/persoonia.2022.49.05
  • Castlebury LA, Rossman AY, Sung GH, Hyten AS, Spatafora JW (2004) Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycological Research 108(8): 864–872. https://doi.org/10.1017/S0953756204000607
  • Chaverri P, Bischoff JF, Liu M, Hodge KT (2005a) A new species of Hypocrella, H. macrostroma, and its phylogenetic relationships to other species with large stromata. Mycological Research 109(11): 1268–1275.https://doi.org/10.1017/S0953756205003904
  • Chaverri P, Bischoff JF, Evans HC, Hodge KT (2005b) Regiocrella, a new entomopathogenic genus with a pycnidial anamorph and its phylogenetic placement in the Clavicipitaceae. Mycologia 97(6): 1225–1237. https://doi.org/10.1080/15572536.2006.11832732
  • Chaverri P, Liu M, Hodge KT (2008) A monograph of the entomopathogenic genera Hypocrella, Moelleriella, and Samuelsia gen. nov. (Ascomycota, Hypocreales, Clavicipitaceae), and their aschersonia-like anamorphs in the Neotropics. Studies in Mycology 60: 1–66. https://doi.org/10.3114/sim.2008.60.01
  • Chen WH, Liang JD, Ren XX, Zhao JH, Han YF, Liang ZQ (2022) Phylogenetic, ecological and morphological characteristics reveal two new spider-associated genera in Clavicipitaceae. MycoKeys 91: 49–66. https://doi.org/10.3897/mycokeys.91.86812
  • Crous PW, Wingfield MJ, Guarro J, Cheewangkoon R, van der Bank M, Swart WJ, Stchigel AM, Cano-Lira JF, Roux J, Madrid H, Damm U, Wood AR, Shuttleworth LA, Hodges CS, Munster M, de Jesús Yáñez-Morales M, Zúñiga-Estrada L, Cruywagen EM, De Hoog GS, Silvera C, Najafzadeh J, Davison EM, Davison PJN, Barrett MD, Barrett RL, Manamgoda DS, Minnis AM, Kleczewski NM, Flory SL, Castlebury LA, Clay K, Hyde KD, Maússe-Sitoe SND, Chen S, Lechat C, Hairaud M, Lesage-Meessen L, Pawłowska J, Wilk M, Śliwińska-Wyrzychowska A, Mętrak M, Wrzosek M, Pavlic-Zupanc D, Maleme HM, Slippers B, Mac Cormack WP, Archuby DI, Grünwald NJ, Tellería MT, Dueñas M, Martín MP, Marincowitz S, de Beer ZW, Perez CA, Gené J, Marin-Felix Y, Groenewald JZ (2013) Fungal Planet description sheets: 154–213. Persoonia 31(1): 188–296. https://doi.org/10.3767/003158513X675925
  • Crous PW, Wingfield MJ, Schumacher RK, Summerell BA, Giraldo A, Gené J, Guarro J, Wanasinghe DN, Hyde KD, Camporesi E, Garethjones EB, Thambugala KM, Malysheva EF, Malysheva VF, Acharya K, Álvarez J, Alvarado P, Assefa A, Barnes CW, Bartlett JS, Blanchette RA, Burgess TI, Carlavilla JR, Coetzee MPA, Damm U, Decock CA, Denbreeÿen A, Devries B, Dutta AK, Holdom DG, Rooney-Latham S, Manjón JL, Marincowitz S, Mirabolfathy M, Moreno G, Nakashima C, Papizadeh M, Shahzadehfazeli SA, Amoozegar MA, Romberg MK, Shivas RG, Stalpers JA, Stielow B, Stukely MJC, Swart WJ, Tan YP, Vanderbank M, Wood AR, Zhang Y, Groenewald JZ (2014) Fungal Planet description sheets: 281–319. Persoonia 33(1): 212–289. https://doi.org/10.3767/003158514X685680
  • Currie CR, Wong B, Stuart AE, Schultz TR, Rehner SA, Mueller UG, Sung GH, Spatafora JW, Straus NA (2003) Ancient tripartite coevolution in the attine ant-microbe symbiosis. Science 299(5605): 386–388. https://doi.org/10.1126/science.1078155
  • Gams W, Zare R (2003) A taxonomic review of the clavicipitaceous anamorphs parasitizing nematodes and other microinvertebrates. In: White Jr JF, Bacon CW, Hywel-Jones NL, Spatafora JW (Eds) Clavicipitalean Fungi, Evolutionary Biology, Chemistry, Biocontrol and Cultural Impacts. Marcel Dekker, Inc., New York, 17–73. https://doi.org/10.1201/9780203912706.pt1
  • Gao S, Meng W, Zhang L, Yue Q, Zheng X, Xu L (2021) Parametarhizium (Clavicipitaceae) gen. nov. with two new species as a potential biocontrol agent isolated from forest litters in Northeast China. Frontiers in Microbiology 12: e627744. https://doi.org/10.3389/fmicb.2021.627744
  • Hernández-Restrepo M, Groenewald JZ, Crous PW (2016) Taxonomic and phylogenetic re-evaluation of Microdochium, Monographella and Idriella. Persoonia 36(1): 57–82. https://doi.org/10.3767/003158516X688676
  • Huang H, Luo Z, Yue HM, Gong WF, Cai L, Wang M (2015) Pochonia cordycepisociata, a new species associated with Chinese cordyceps in Tibet, China. Phytotaxa 208(4): 278–286. https://doi.org/10.11646/phytotaxa.208.4.3
  • Hyde KD, Norphanphoun C, Maharachchikumbura SSN, Bhat DJ, Jones EBG, Bundhun D, Chen YJ, Bao DF, Boonmee S, Calabon MS, Chaiwan N, Chethana KWT, Dai DQ, Dayarathne MC, Devadatha B, Dissanayake AJ, Dissanayake LS, Doilom M, Dong W, Fan XL, Goonasekara ID, Hongsanan S, Huang SK, Jayawardena RS, Jeewon R, Karunarathna A, Konta S, Kumar V, Lin CG, Liu JK, Liu NG, Luangsa-ard J, Lumyong S, Luo ZL, Marasinghe DS, McKenzie EHC, Niego AGT, Niranjan M, Perera RH, Phukhamsakda C, Rathnayaka AR, Samarakoon MC, Samarakoon SMBC, Sarma VV, Senanayake IC, Shang QJ, Stadler M, Tibpromma S, Wanasinghe DN, Wei DP, Wijayawardene NN, Xiao YP, Yang J, Zeng XY, Zhang SN, Xiang MM (2020) Refined families of Sordariomycetes. Mycosphere: Journal of Fungal Biology 11(1): 305–1059. https://doi.org/10.5943/mycosphere/11/1/7
  • Johnson D, Sung GH, Hywel-Jones NL, Luangsa-Ard JJ, Bischoff JF, Kepler RM, Spatafora JW (2009) Systematics and evolution of the genus Torrubiella (Hypocreales, Ascomycota). Mycological Research 113(3): 279–289. https://doi.org/10.1016/j.mycres.2008.09.008
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Kepler RM, Sung GH, Harada Y, Tanaka K, Tanaka E, Hosoya T, Bischoff JF, Spatafora JW (2012a) Host jumping onto close relatives and across kingdoms by Tyrannicordyceps (Clavicipitaceae) gen. nov. and Ustilaginoidea (Clavicipitaceae). American Journal of Botany 99(3): 552–561. https://doi.org/10.3732/ajb.1100124
  • Kepler RM, Sung GH, Ban S, Nakagiri A, Chen M, Huang B, Li Z, Spatafora JW (2012b) New teleomorph combinations in the entomopathogenic genus Metacordyceps. Mycologia 104(1): 182–197. https://doi.org/10.3852/11-070
  • Kepler RM, Humber RA, Bischoff JF, Rehner SA (2014) Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics. Mycologia 106(4): 811–829. https://doi.org/10.3852/13-319
  • Kim JC, Baek S, Park SE, Kim S, Lee MR, Jo M, Im JS, Ha P, Kim JS, Shin TY (2020) Colonization of Metarhizium anisopliae on the surface of pine tree logs: A promising biocontrol strategy for the Japanese pine sawyer, Monochamus alternatus. Fungal Biology 124(2): 125–134. https://doi.org/10.1016/j.funbio.2019.12.006
  • Lawrey JD, Etayo J, Dal-Forno M, Driscoll KE, Diederich P (2015) Molecular data support establishment of a new genus for the lichenicolous species Neobarya usneae (Hypocreales). The Bryologist 118(1): 83–92. https://doi.org/10.1639/0007-2745-118.1.083
  • Luangsa-ard JJ, Mongkolsamrit S, Noisripoom W, Thanakitpipattana D, Khonsanit A, Wutikhun T (2017a) Helicocollum, a new clavicipitalean genus pathogenic to scale insects (Hemiptera) in Thailand. Mycological Progress 16(4): 419–431. https://doi.org/10.1007/s11557-017-1283-3
  • Luangsa-ard JJ, Mongkolsamrit S, Thanakitpipattana D, Khonsanit A, Tasanathai K, Noisripoom W, Humber RA (2017b) Clavicipitaceous entomopathogens: New species in Metarhizium and a new genus Nigelia. Mycological Progress 16(4): 369–391. https://doi.org/10.1007/s11557-017-1277-1
  • Lutzoni F, Kauff F, Cox CJ, McLaughlin D, Celio G, Dentinger B, Padamsee M, Hibbett DS, James TY, Baloch E, Grube M, Reeb V, Hofstetter V, Schoch C, Arnold AE, Miadlikowska J, Spatafora J, Johnson D, Hambleton S, Crockett M, Schoemaker R, Sun GH, Lücking R, Lumbsch HT, O’Donnell K, Binder M, Diederich P, Ertz D, Gueidan C, Hall B, Hansen K, Harris RC, Hosaka K, Lim YW, Liu Y, Matheny B, Nishida H, Pfister D, Rogers J, Rossman A, Schmitt I, Sipman H, Stone J, Sugiyama J, Yahr R, Vilgalys R (2004) Where are we in assembling the Fungal Tree of Life, classifying the fungi and understanding the evolution of their subcellular traits? American Journal of Botany 91: 1446–1480. https://doi.org/10.3732/ajb.91.10.1446
  • Maharachchikumbura SSN, Hyde KD, Jones EBG, McKenzie EHC, Bhat JD, Dayarathne MC, Huang SK, Norphanphoun C, Senanayake IC, Perera RH, Shang QJ, Xiao Y, D’souza MJ, Hongsanan S, Jayawardena RS, Daranagama DA, Konta S, Goonasekara ID, Zhuang WY, Jeewon R, Phillips SJL, Abdel-Wahab MA, Al-Sadi AM, Bahkali AH, Boonmee S, Boonyuen N, Cheewangkoon R, Dissanayake AJ, Kang J, Li QR, Liu JK, Liu XZ, Liu ZY, Luangsa-ard JJ, Pang KL, Phookamsak R, Promputtha I, Suetrong S, Stadler M, Wen T, Wijayawardene NN (2016) Families of Sordariomycetes. Fungal Diversity 79(1): 1–317. https://doi.org/10.1007/s13225-016-0369-6
  • Mapook A, Hyde KD, Hassan K, Kemkuignou BM, Čmoková A, Surup F, Kuhnert E, Paomephan P, Cheng T, de Hoog S, Song Y, Jayawardena RS, Al-Hatmi AMS, Mahmoudi T, Ponts N, Studt-Reinhold L, Richard-Forget F, Chethana KWT, Harishchandra DL, Mortimer PE, Li H, Lumyong S, Aiduang W, Kumla J, Suwannarach N, Bhunjun CS, Yu FM, Zhao Q, Schaefer D, Stadler M (2022) Ten decadal advances in fungal biology leading towards human well-being. Fungal Diversity 116(1): 547–614. https://doi.org/10.1007/s13225-022-00510-3
  • Marcelino JAP, Gouli S, Giordano R, Gouli VV, Parker BL, Skinner M (2009) Fungi associated with a natural epizootic in Fiorinia externa Ferris (Hemiptera: Diaspididae) populations. Journal of Applied Entomology 133(2): 82–89. https://doi.org/10.1111/j.1439-0418.2008.01301.x
  • Moncalvo JM, Lutzoni FM, Rehner SA, Johnson J, Vilgalys R (2000) Phylogenetic relationships of agaric fungi based on nuclear large subunit ribosomal DNA sequences. Systematic Biology 49(2): 278–305. https://doi.org/10.1093/sysbio/49.2.278
  • Mongkolsamrit S, Luangsa-ard JJ, Hywel-Jones NL (2017) Samuelsia mundiveteris sp. nov. from Thailand. Mycologia 103(4): 921–927. https://doi.org/10.3852/11-049
  • Mongkolsamrit S, Noisripoom W, Thanakitpipattana D, Wutikhun T, Spatafora JW, Luangsa-ard JJ (2018) Disentangling cryptic species with isaria-like morphs in Cordycipitaceae. Mycologia 110(1): 230–257. https://doi.org/10.1080/00275514.2018.1446651
  • Mongkolsamrit S, Khonsanit A, Thanakitpipattana D, Tasanathai K, Noisripoom W, Lamlertthon S, Himaman W, Houbraken J, Samson RA, Luangsa-ard JJ (2020a) Revisiting Metarhizium and the description of new species from Thailand. Studies in Mycology 95: 171–251. https://doi.org/10.1016/j.simyco.2020.04.001
  • Mongkolsamrit S, Noisripoom W, Tasanathai K, Khonsanit A, Thanakitpipattana D, Himaman W, Kobmoo N, Luangsa-ard JJ (2020b) Molecular phylogeny and morphology reveal cryptic species in Blackwellomyces and Cordyceps (Cordycipitaceae) from Thailand. Mycological Progress 19(9): 957–983. https://doi.org/10.1007/s11557-020-01615-2
  • Mongkolsamrit S, Noisripoom W, Thanakitpipattana D, Khonsanit A, Lamlertthon S, Luangsa-ard JJ (2021) New species in Aciculosporium, Shimizuomyces and a new genus Morakotia associated with plants in Clavicipitaceae from Thailand. Fungal Systematics and Evolution 8: 27–37. https://doi.org/10.3114/fuse.2021.08.03
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Nonaka K, Ōmura S, Masuma R, Kaifuchi S, Masuma R (2013) Three new Pochonia taxa (Clavicipitaceae) from soils in Japan. Mycologia 105(5): 1202–1218. https://doi.org/10.3852/12-132
  • Píchová K, Pažoutová S, Kostovčík M, Chudíčková M, Stodůlková E, Novák P, Flieger M, van der Linde E, Kolařík M (2018) Evolutionary history of ergot with a new infrageneric classification (Hypocreales: Clavicipitaceae: Claviceps). Molecular Phylogenetics and Evolution 123: 73–87. https://doi.org/10.1016/j.ympev.2018.02.013
  • Rehner SA, Buckley E (2005) A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 97(1): 84–98. https://doi.org/10.3852/mycologia.97.1.84
  • Rehner SA, Samuels GJ (1995) Molecular systematics of the Hypocreales: A teleomorph gene phylogeny and the status of their anamorphs. Canadian Journal of Botany 73(S1): 816–823. https://doi.org/10.1139/b95-327
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schneider S, Rehner SA, Widmer F, Enkerli J (2011) A PCR-based tool for cultivation-ndependent detection and quantification of Metarhizium clade 1. Journal of Invertebrate Pathology 108(2): 106–114. https://doi.org/10.1016/j.jip.2011.07.005
  • Senanayake IC, Pem D, Rathnayaka AR, Wijesinghe SN, Tibpromma S, Wanasinghe DN, Phookamsak R, Kularathnage ND, Gomdola D, Harishchandra D, Dissanayake LS, Xiang MM, Ekanayaka AH, McKenzie EHC, Hyde KD, Zhang HX, Xie N (2022) Predicting global numbers of teleomorphic ascomycetes. Fungal Diversity 114(1): 237–278. https://doi.org/10.1007/s13225-022-00498-w
  • Spatafora JW, Sung GH, Sung JM, Hywel-Jones NY, White Jr JF (2007) Phylogenetic evidence for an animal pathogen origin of ergot and the grass endophytes. Molecular Ecology 16(8): 1701–1711. https://doi.org/10.1111/j.1365-294X.2007.03225.x
  • Steiner U, Leibner S, Schardl CL, Leuchtmann A, Leistner E (2011) Periglandula, a new fungal genus within the Clavicipitaceae and its association with Convolvulaceae. Mycologia 103(5): 1133–1145. https://doi.org/10.3852/11-031
  • Sung GH, Spatafora JW, Zare R, Hodge KT, Gams W (2001) A revision of Verticillium sect. Prostrata. II. Phylogenetic analyses of SSU and LSU nuclear rDNA sequences from anamorphs and teleomorphs of the Clavicipitaceae. Nova Hedwigia 72(3–4): 311–328. https://doi.org/10.1127/nova.hedwigia/72/2001/311
  • Sung GH, Hywel-Jones NL, Sung JM, Luangsa-ard JJ, Shrestha B, Spatafora JW (2007a) Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Studies in Mycology 57: 5–59. https://doi.org/10.3114/sim.2007.57.01
  • Sung GH, Sung JM, Hywel-Jones NL, Spatafora JW (2007b) A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Molecular Phylogenetics and Evolution 44(3): 1204–1223. https://doi.org/10.1016/j.ympev.2007.03.011
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30(12): 2725–2729. https://doi.org/10.1093/molbev/mst197
  • Tanaka E, Kawasaki S, Matsumura K, Kusuda R, Tanaka C, Peng YL, Tsukiboshi T, Tsuda M (2001) Phylogenetic studies of Ephelis species from various locations and hosts in Asia. Mycological Research 105(7): 811–817. https://doi.org/10.1017/S0953756201004178
  • Tanaka E, Tanaka C, Gafur A, Tsuda M (2002) Heteroepichloë, gen. nov. (Clavicipitaceae; Ascomycotina) on bamboo plants in East Asia. Mycoscience 43(2): 87–93. https://doi.org/10.1007/S102670200014
  • Tanaka E, Hosoe T, Degawa Y, Kolařík M (2021) Revision of the genus Aciculosporium (Clavicipitaceae) with a description of a new species on wavyleaf basketgrass, and proline-containing cyclic dipeptide production by A. take. Mycoscience 62(3): 166–175. https://doi.org/10.47371/mycosci.2021.01.002
  • Uchida R, Imasato R, Yamaguchi Y, Masuma R, Shiomi K, Tomoda H, Ōmura S (2005) New insecticidal antibiotics, Hydroxyfungerins A and B, produced by Metarhizium sp. FKI-1079. The Journal of Antibiotics 58(12): 804–809. https://doi.org/10.1038/ja.2005.107
  • Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8): 4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
  • Vu D, Groenewald M, de Vries M, Gehrmann T, Stielow B, Eberhardt U, Al-Hatmi A, Groenewald JZ, Cardinali G, Houbraken J, Boekhout T, Crous PW, Robert V, Verkley GJ (2019) Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation. Studies in Mycology 92(1): 1–20. https://doi.org/10.1016/j.simyco.2018.05.001
  • Wen TC, Zha LS, Xiao YP, Wang Q, Kang JC, Hyde KD (2015) Metacordyceps shibinensis sp. nov. from larvae of Lepidoptera in Guizhou Province, southwest China. Phytotaxa 226: 051–062. https://doi.org/10.11646/phytotaxa.226.1.5
  • White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR Protocols: a Guide to Methods and Applications. Academic Press, San Diego, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • White Jr JF, Bacon CW, Hywel-Jones NL, Spatafora JW (2003) Clavicipitalean Fungi: Evolutionary Biology, Chemistry, Biocontrol and Cultural Impacts. CRC Press. https://doi.org/10.1201/9780203912706
  • Xiang CY, Gao FL, Jakovlić I, Lei HP, Hu Y, Zhang H, Zou H, Wang GT, Zhang D (2023) Using PhyloSuite for molecular phylogeny and tree‐based analyses. iMeta 2(1): e87. https://doi.org/10.1002/imt2.87
  • Xiao YP, Wen TC, Hongsanan S, Jeewon R, Luangsa-ard JJ, Brooks S, Wanasinghe DN, Long FY, Hyde KD (2018) Multigene phylogenetics of Polycephalomyces (Ophiocordycipitaceae, Hypocreales), with two new species from Thailand. Scientific Reports 8(1): e18087. https://doi.org/10.1038/s41598-018-36792-4
  • Yasanthika WAE, Wanasinghe DN, Mortimer PE, Monkai J, Farias ARG (2022) The importance of culture-based techniques in the genomic era for assessing the taxonomy and diversity of soil fungi. Mycosphere : Journal of Fungal Biology 13(1): 724–751. https://doi.org/10.5943/mycosphere/13/1/8
  • Young CA, Schardl CL, Panaccione DG, Florea S, Takach JE, Charlton ND, Moore N, Webb JS, Jaromczyk J (2015) Genetics, genomics and evolution of ergot alkaloid diversity. Toxins 7(4): 1273–1302. https://doi.org/10.3390/toxins7041273
  • Zhang ZY, Han YF, Chen WH, Tao G (2023) Additions to Thelebolales (Leotiomycetes, Ascomycota): Pseudogeomyces lindneri gen. et sp. nov. and Pseudogymnoascus campensis sp. nov. MycoKeys 95: 47–60. https://doi.org/10.3897/mycokeys.95.97474

Supplementary materials

Supplementary material 1 

Sequence dataset

Zhi-Yuan Zhang, Yao Feng, Shuo-Qiu Tong, Chen-Yu Ding, Gang Tao, Yan-Feng Han

Data type: sequence

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (376.07 kb)
Supplementary material 2 

The best-fit evolutionary model in the phylogenetic analyses

Zhi-Yuan Zhang, Yao Feng, Shuo-Qiu Tong, Chen-Yu Ding, Gang Tao, Yan-Feng Han

Data type: table

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (17.76 kb)
login to comment