Research Article
Print
Research Article
Morphological and molecular analyses reveal two new species of Microcera (Nectriaceae, Hypocreales) associated with scale insects on walnut in China
expand article infoFeng Liu‡, Yu Deng‡, Fei-Hu Wang‡, Rajesh Jeewon§, Qian Zeng‡, Xiu-Lan Xu|, Ying-Gao Liu‡, Chun-Lin Yang‡
‡ Sichuan Agricultural University, Chengdu, China
§ University of Mauritius, Reduit, Mauritius
| Forestry Research Institute, Chengdu Academy of Agricultural and Forestry Sciences, Chengdu, China

Corresponding author: Chun-Lin Yang ( yangcl0121@163.com )

Academic editor: Sajeewa Maharachchikumbura
© 2023 Feng Liu, Yu Deng, Fei-Hu Wang, Rajesh Jeewon, Qian Zeng, Xiu-Lan Xu, Ying-Gao Liu, Chun-Lin Yang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Liu F, Deng Y, Wang F-H, Jeewon R, Zeng Q, Xu X-L, Liu Y-G, Yang C-L (2023) Morphological and molecular analyses reveal two new species of Microcera (Nectriaceae, Hypocreales) associated with scale insects on walnut in China. MycoKeys 98: 19-35. https://doi.org/10.3897/mycokeys.98.103484
Open Access

Abstract

The fungal genus Microcera consists of species mostly occurring as parasites of scale insects, but are also commonly isolated from soil or lichens. In the present study, we surveyed the diversity and assess the taxonomy of entomopathogenic fungi in Sichuan Province, China. Two new species of Microcera, viz. M. chrysomphaludis and M. pseudaulacaspidis, were isolated from scale insects colonising walnut (Juglans regia). Maximum Likelihood and Bayesian Inference analyses of ITS, LSU, tef1-α, rpb1, rpb2, acl1, act, tub2, cmdA and his3 sequence data provide evidence for the validity of the two species and their placement in Nectriaceae (Hypocreales). Microcera pseudaulacaspidis primarily differs from similar species by having more septate and smaller cylindrical macroconidia, as well as DNA sequence data. Meanwhile, Microcera chrysomphaludis has elliptical, one-septate ascospores with acute ends and cylindrical, slightly curved with 4–6 septate macroconidia up to 78 µm long. Morphological descriptions with illustrations of the novel species and DNA-based phylogeny generated from analyses of multigene dataset are also provided to better understand species relationships.

Key words

Two new taxa, entomopathogenic fungi, morphology, phylogenetic analyses

Introduction

The genus Microcera Desm. (Nectriaceae, Hypocreales) was introduced in the 19th century and was typified by M. coccophila Desm., commonly known as the “red-headed fungus”. Microcera has been considered to be a synonym of the Fusarium Link in some major taxonomic revisions (Booth 1971; Nelson et al. 1983; Leslie and Summerell 2006). The genus is characterised by superficial, flame-like conidiomata, forming a fusarium-like asexual stage (Gräfenhan et al. 2011; Herrera et al. 2013). Microcera species exhibit diverse ecological characteristics and are typically regarded as entomogenous fungi that are associated with scale insects, although they can occasionally be isolated from other substrates, such as aphids, adelgids, lichens and soil (Gräfenhan et al. 2011; Crous et al. 2021a, b, 2022a).

Currently, there are eight accepted species within the genus Microcera (Bills et al. 2009; Gräfenhan et al. 2011; O’Donnell et al. 2012; Herrera et al. 2013; Dao et al. 2015, 2016; Lombard et al. 2015; Crous et al. 2021b, 2022a; Xu et al. 2021). Based on DNA sequence data and ecological association, Gräfenhan et al. (2011) revised many anamorph- and teleomorph-typified genera of the Nectriaceae, resurrected Microcera and accepted four Microcera species, viz., M. coccophila, M. diploa (Berk. & M.A. Curtis) Gräfenhan & Seifert, M. rubra Gräfenhan & Seifert and M. larvarum (Fuckel) Gräfenhan, Seifert & Schroers. Lombard et al. (2015) supported Microcera as a monophyletic group distantly related to Fusarium, based on further phylogenetic inferences from DNA sequence data. Xu et al. (2021) isolated M. kuwanaspidis X.L. Xu & C.L. Yang from armoured scale insects Kuwanaspis howardi on Phyllostachys heteroclada in China. Two additional species, M. lichenicola and M. physciae Crous & Boers have been described from lichens (Crous et al. 2021b, 2022a).

During a survey of entomopathogenic fungi in Sichuan Province, China, two Microcera species, in association with the two scale insects Pseudaulacaspis pentagona and Chrysomphalus aonidum on walnut, were isolated. Microcera pseudaulacaspidis sp. nov. and M. chrysomphaludis sp. nov. are introduced here based on the morphological characteristics and multi-locus analyses (DNA based). They were compared morphologically with existing taxa. In this study, comprehensive descriptions, micrographs of macroscopic and microscopic morphological characteristics, as well as DNA sequence data, are provided to support the establishment of the new species.

Materials and methods

Specimen collection and isolation

Three specimens of scale insects (SICAU 22-0161, SICAU 22-0162 and SICAU 22-0163) that were infected, were collected from Neijiang City (29°48′15″N, 105°06′44″E) and Liangshan Yi Autonomous Prefecture (26°56′43″N, 102°16′16″E), Sichuan Province, on 16 April and 8 October 2022. The specimens were placed in sterilised tubes or plastic boxes and returned to the laboratory as described by Senanayake et al (2020). The fungi were isolated, based on the single spore isolation technique described by Chomnunti et al. (2014). Cultures were grown on PDA for 20–40 days, at 25 °C, under 12 h light/12 h dark for recording growth rates, shape, texture and colour of the colonies. Ascomata and sporodochia were observed and photographed using a dissecting microscope NVT-GG (Shanghai Advanced Photoelectric Technology Co. Ltd., Shanghai, China). We observed microscopic characteristics, such as asci, ascospores, pseudoparaphyses, ascomata wall, conidia, conidiophores, number of septa, metulae and conidiophores using an Olympus BX43. No fewer than 20 measurements of the two species were made for each feature using the Image Frame Work (IFW 0.9.0.7). The type specimens were deposited at the Herbarium of Sichuan Agricultural University, Chengdu, China (SICAU). The ex-type cultures were deposited at the Culture Collection in Sichuan Agricultural University (SICAUCC).

DNA extraction, PCR amplification and nucleotide sequencing

The New Plant Genomic DNA Kit (Beijing Aidlab Biotechnologies Co., Ltd, Beijing, China) was used to extract genomic DNA from fresh fungal mycelium. The extracted DNA to be used was stored at -20 °C. Amplified gene markers and their corresponding primers are shown in Table 1. Polymerase chain reaction (PCR) was performed in 25 µl reaction mixture containing 22 µl Master Mix (Beijing LABLEAD Biotech Co., Ltd., Beijing, China), 1 µl DNA template and 1 µl each of forward and reverse (10 µM) primers. The amplification reactions were performed as described by Gräfenhan et al. (2011), Lombard et al. (2015), Dai et al. (2016) and Wanasinghe et al. (2021). PCR products were sequenced at Hangzhou Youkang Biotech Co., Ltd., Chengdu, China. The newly-generated sequences were deposited in GenBank. New species are established as recommended by Jeewon and Hyde (2016).

Table 1.
Download as
CSV
XLSX

Gene markers and primer pairs used in this study.

Gene markers Primers Sequences of Primers 5’-3’ References
acl1 acl1-230up AGCCCGATCAGCTCATCAAG Gräfenhan et al. (2011)
acl1-1220low CCTGGCAGCAAGATCVAGGAAGT
act ACT-512F ATGTGCAAGGCCGGTTTCGC Carbone and Kohn (1999)
ACT1Rd CRTCGTACTCCTGCTTBGAGATCCAC Groenewald et al. (2013)
cmdA CAL-228F GAGTTCAAGGAGGCCTTCTCCC Carbone and Kohn 1999)
CAL2Rd TGRTCNGCCTCDCGGATCATCTC Groenewald et al. (2013)
his3 CYLH3F AGGTCCACTGGTGGCAAG Crous et al. (2006)
CYLH3R AGCTGGATG TCCTTGGAC
ITS ITS5 GGAAGTAAAAGTCGTAACAAGG White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC
LSU LR0R ACCCGCTGAACTTAAGC Rehner and Samuels (1994)
LR5 ATCCTGAGGGAAACTTC Vilgalys and Hester (1990)
rpb1 RPB1-Ac CAYCCWGGYTTYATCAAGAA Castlebury et al. (2004)
RPB1-Cr CCNGCDATNTCRTTRTCCATRTA
rpb2 RPB2-5F2 GGGGWGAYCAGAAGAAGGC O’Donnell et al. (2007)
RPB2-7cR CCCATRGCTTGYTTRCCCAT
tef1 EF1-728F CATCGAGAAGTTCGAGAAGG Carbone and Kohn (1999)
EF2 GGARGTACCAGTSATCATG O’Donnell et al. (1998)
tub2 T1 AACATGCGTGAGATTGTAAGT O’Donnell and Cigelnik (1997)
CYLTUB1R AGTTGTCGG GACGGAAGAG Crous et al. (2006)

Sequence alignment and phylogenetic analyses

Based on BLAST searches in GenBank and recent publications (Bills et al. 2009; Gräfenhan et al. 2011; O’Donnell et al. 2012; Herrera et al. 2013; Dao et al. 2015, 2016; Lombard et al. 2015; Xu et al. 2021), using the large subunit of the ATP citrate lyase (acl1), actin (act) regions, calmodulin (cmdA), histone H3 (his3), the internal transcribed spacer (ITS), the partial large subunit nuclear rDNA (LSU), the RNA polymerase II largest subunit (rpb1), the RNA polymerase II second largest subunit (rpb2), translation elongation factor 1-alpha (tef1-α), β-tubulin (tub2) and sequence data, reference sequences were downloaded and separate phylogenetic analyses, based on single gene datasets were carried out to initially determine the placement of the two species. Information on the taxa used and GenBank accession numbers of our novel species are listed in Table 2. Alignments for the individual locus matrices were generated with the online version of MAFFT version 7.429 (Katoh and Standley 2013) and ambiguous regions were excluded using BioEdit version 7.0.5.3 (Hall 1999). Combined sequences of ITS, LSU, tef1-α, rpb1, rpb2, acl1, act, tub2, cmdA and his3 were performed by SequenceMatrix v.1.7.8 (Vaidya et al. 2011). Maximum Likelihood (ML) and Bayesian Inference (BI) were constructed as described in Xu et al (2020). The phylogenetic tree constructed was viewed and edited using FigTree version 1.4.2 and Adobe Illustrator CS6.

Table 2.
Download as
CSV
XLSX

Specimen information and GenBank accession numbers of the sequences used in this study.

Species Strain/Voucher No. GenBank Accession No.
acl1 act cmdA his3 ITS LSU rpb1 rpb2 tef l-α tub2
Cosmospora coccinea CBS 341.70 T HQ897913 KM231221 KM231398 KM231550 HQ897827 KM231692 KM232242 HQ897777 KM231947 KM232086
Cosmospora cymosa CBS 762.69 T HQ897914 KM231222 KM231399 KM231551 HQ897828 KM231693 KM232243 HQ897778 KM231948 KM232087
Dialonectria episphaeria CBS 125494 = TG 2006-11 HQ897892 KM231227 KM231404 KM231556 HQ897811 KM231697 KM232248 HQ897756 KM231953 KM232092
Dialonectria ullevolea CBS 125493 = TG 2007-56 HQ897918 KM231226 KM231403 KM231555 KM231821 KM231696 KM232247 HQ897782 KM231952 KM232091
Fusicolla acetilerea BBA 63789 T = IMI181488 = NRRL20827 KM231065 – – – HQ897790 U88108 – HQ897701 – –
Fusicolla aquaeductuum CBS 837.85 = BBA 64559 = NRRL 20865 KM231067 – KM231406 – KM231823 KM231699 KM232250 HQ897744 KM231955 KM232094
Fusicolla epistroma BBA 62201 T = IMI 85601 = NRRL 20439 = KNUF-20-PBU01 KM231069 – – – OW982703 AF228352 LC592349 HQ897765 – –
Fusicolla matuoi CBS 581.78 = ATCC 18694 = MAFF 238445 = NRRL 20427 KM231070 KM231228 KM231405 KM231557 KM231822 KM231698 KM232249 HQ897720 KM231954 KM232093
Macroconia leptosphaeriae CBS 717.74 KM231062 KM231236 KM231414 KM231564 KM231827 KM231707 KM232257 KM232390 JF735695 KM232099
Macroconia leptosphaeriae CBS 100001 = CBS H-6030 KM231063 KM231234 KM231412 KM231562 HQ897810 KM231705 KM232255 HQ897755 KM231959 KM232097
Macroconia papilionacearum CBS 125495 HQ897912 KM231233 KM231411 KM231561 HQ897826 KM231704 KM232254 HQ897776 KM231958 KM232096
Microcera chrysomphaludis SICAUCC 22-0164 T OQ569756 OQ569739 OQ599375 OQ569753 OQ434281 OQ434276 OQ569747 OQ569742 OQ438144 OQ569750
Microcera chrysomphaludis SICAUCC 22-0165 OQ569757 OQ569740 OQ599376 OQ569754 OQ434282 OQ434277 OQ569748 OQ569743 OQ438145 OQ569751
Microcera coccophila CBS 310.34 T = NRRL 13962 = G.J.S. 98-50 HQ897843 KM231232 KM231410 KM231560 MH855540 KM231703 JX171462 JX171576 JF740692 KC291937
Microcera diploa CBS 735.79 = BBA 62173 = NRRL 13966 = NRRL 36545 HQ897899 – – – HQ897817 MW827663 JX171463 HQ897763 JF740693 –
Microcera kuwanaspidis SICAUCC 21-0006 T MW462125 MW462126 MW462127 MW462128 MW484993 MW462905 MW462129 MW462124 MW462117 MW462130
Microcera kuwanaspidis SICAUCC 21-0009 MZ044037 MZ044038 MZ044039 MZ044040 MZ029437 MZ029436 MZ044041 MZ044036 MZ044035 MZ044042
Microcera larvarum CBS 169.30 HQ897855 – – EU860049 EU860064 EU860064 – HQ897717 – EU860025
Microcera larvarum A.R. 4580 = CBS 133964 – – – – KC291751 KC291759 KC291894 – KC291832 KC291935
Microcera lichenicola CPC 41114 T = CBS 149169 – – – – ON811502 ON811561 – – – ON803591
Microcera physciae CPC 41284 = CBS 148283 – – – – OK664727 OK663766 OK651153 OK651168 OK651190 OK651208
Microcera physciae CPC 41038 T = CBS 148288 – – – – OK664728 OK663767 OK651154 OK651169 OK651191 OK651209
Microcera pseudaulacaspidis SICAUCC 22-0163 T OQ569755 OQ569738 OQ599374 OQ569752 OQ434280 OQ434275 OQ569746 OQ569741 OQ438143 OQ569749
Microcera rubra CBS 638.76 T = BBA 62460 = NRRL 20475 HQ897903 KM231231 KM231409 EU860050 HQ897820 KM231702 KM232253 HQ897767 JF740696 EU860018
Microcera sp. CPC 41230 = CBS 148313 – – – – ON811503 ON811562 ON803533 ON803543 ON803570 ON803592
Pseudocosmospora eutypae CBS 133966 T =A.R.4562 – – – – KC291721 KC291757 KC291871 – KC291830 KC291912
Pseudocosmospora eutypellae C.H. 11-01 = CBS 133961 T – – – – KC291735 KC291766 KC291884 – KC291837 KC291925
Pseudocosmospora rogersonii CBS 133981 T = GJ.S. 90-56 – – – – KC291729 KC291780 KC291878 – KC291852 KC291915
Tilachlidium brachiatum CBS 505.67 KM231076 KM231249 KM231436 – KM231839 KM231720 KM232272 KM232415 KM231976 KM232110
Tilachlidium brachiatum CBS 363.97 KM231077 KM231248 KM231435 KM231583 KM231838 KM231719 KM232271 KM232414 KM231975 KM232109

Notes: superscript T represents ex-type or ex-epitype isolates. “-” means that the sequence is missing or unavailable. New sequences are listed in bold

Genealogical concordance phylogenetic species recognition analysis

Phylogenetically closely-related species were analysed using the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) model by performing a pairwise homoplasy index (PHI) test as described by Quaedvlieg et al. (2014). The PHI test was performed in SplitsTree v.4.17.1 (Huson 1998; Huson and Bryant 2006) in order to determine the recombination level within phylogenetically closely-related species using a 6-locus concatenated dataset (ITS, LSU, tef1-α, acl1, cmdA and his3). The results can be visualised by constructing a split graph using LogDet conversion and the Splits options. Pairwise homoplasy index below a 0.05 threshold (Фw < 0.05) indicates significant recombination present in the dataset. The relationship between closely-related species was visualised by constructing a Splits graph.

Results

Phylogenetic analyses

The ML and BI analyses resulted in trees with similar topologies. Multi-locus phylogenetic analyses of species of Nectriaceae (Hypocreales) include sequences from 25 taxa and Tilachlidium brachiatum (Batsch) Petch (CBS 363.97, CBS 505.67) were used as outgroup (Fig. 1). The alignment contained 11882 characters (ITS = 1213, LSU = 1456, tef1-α = 1246, rpb1 = 1634, rpb2 = 2053, acl1 = 1060, act = 1206, tub2 = 707, cmdA = 779, his3 = 530), including gaps. The matrix had 4402 distinct alignment patterns, with 51.12% of undetermined characters or gaps. Estimated base frequencies were as follows: A = 0.236233, C = 0.270063, G = 0.255057, T = 0.238647, with substitution rates AC = 1.239837, AG = 3.452130, AT = 1.264349, CG = 0.971857, CT = 5.853200 and GT = 1.000000. The gamma distribution shape parameter α = 0.347827 and the Tree-Length = 2.637211. The best scoring RAxML tree with a final likelihood value of -68,438.855836 is presented in Fig. 1 where the isolates from this study formed two distinct, well-supported lineages (MLBS = 100%, BIPP = 1.00) and, thus, were considered to represent two previously-unknown species.

Figure 1. 

Phylogram generated from RAxML analysis, based on combined ITS, LSU, tef1-α, rpb1, r pb2, a cl1, act, tub2, cmdA and his3 sequence data of Microcera isolates. Bootstrap support values from Maximum Likelihood (MLBS, left) higher than 75% and Bayesian posterior probabilities (BIPP, right) equal to or greater than 0.95 are indicated at the nodes, respectively. The sequences from ex-type strains are in bold. The newly-generated sequence is in red.

Pairwise homoplasy index (PHI) test

The pairwise homoplasy index (PHI) test revealed that there was no significant recombination (Фw = 1) between Microcera pseudaulacaspidis (SICAUCC 22-0163), M. coccophila (CBS 310.34), M. diploa (CBS 735.79) and M. kuwanaspidis (SICAUCC 21-0006) (Fig. 2).

Figure 2. 

The result of the pairwise homoplasy index (PHI) test of closely-related species using both LogDet transformation and Splits decomposition. PHI test results (Фw) < 0.05 indicate significant recombination within the dataset.

Taxonomy

Microcera pseudaulacaspidis Feng Liu & C.L. Yang, sp. nov.

Index Fungorum No: 555034
Fig. 3

Etymology

In reference to the generic name of scale insect from which it was isolated.

Holotype

SICAU 22-0161.

Host

Pseudaulacaspis pentagona (Diaspididae, Homoptera)

Habitat

On the trunk of Juglans regia.

Sexual state

Undetermined.

Asexual state

Stromata byssoid, well-developed, bright orange to orange-red, formed directly on the margin of host scales or their covers with 1–7 sporodochia. Sporodochia 250–900 μm long, 400–860 µm wide, (x–= 620 × 570 μm, n = 50), conical, orange-red, upright masses on margin of host scales. Macroconidia 70–120 µm long × 4.2–10.5 µm wide (x–= 95.7 × 6.5 μm, n = 50), hyaline or jasmine, cylindrical, slightly curved, slender towards each end, 3–10 septate, mostly 7–9 septate, difficult to distinguish apical cell and basal cell. Microconidia and chlamydospores were not observed.

Figure 3. 

Microcera pseudaulacaspidis (SICAU 22-0161) a, b stromata and sporodochia on host substrate c–e conidiophore with developing macroconidia f germinated conidium g–o Macroconidia o, p colonies on PDA after 30 days. Scale bars: 200 µm (a, b); 20 µm (c–e); 10 µm (f–n).

Material examined

China, Sichuan Province, Neijiang City, Dongxing District, Paifang Village walnut industrial base (29°48′15″N, 105°06′44″E, alt. 340 m), on scale insect Pseudaulacaspis pentagona, 16 April 2022, Feng Liu, LF202204001, (SICAU 22-0161, holotype), ex-type culture SICAUCC 22-0163.

Culture characters

Colonies from a single macroconidium on PDA grow slowly and reach approximately 2 cm in diameter after 12 days at 25 °C, circular, flat, producing masses of macroconidia in the centre of the colony, measuring 76–125 µm long × 5.3–7.6 µm wide (x–= 91.2 × 6.3 µm, n = 50), smaller than those in nature, white mycelium on the surface and the back of colonies is dark orange.

Notes

Based on multi-gene phylogenetic analyses, Microcera pseudaulacaspidis is closely related to M. kuwanaspidis (Fig. 1). However, we observed significant differences in the DNA sequence data, including base-pair differences and gaps, with values of 1.45% (0 gaps), 17.67% (17 gaps), 3.22% (2 gaps), 1.53% (2 gaps), 1.70% (1 gap) and 3.82% (1 gap) in the ITS, LSU, tef1-α, tub2, cmdA and his3 genes, respectively. The PHI test also showed that no significant recombination events between M. pseudaulacaspidis and closely phylogenetically-related species occurred (Fig. 2). Based on a comparison of their morphological characteristics, M. pseudaulacaspidis can be distinguished from M. kuwanaspidis by shorter macroconidia (95.7 × 6.5 µm vs. 107 × 7.3 µm) with more septa (7–9-septate vs. 5–7-septate) (Xu et al. 2021). Given the morphological dissimilarities, distinct nucleotides at various sites and the well-supported lineage in our phylogeny, we have sufficient evidence to establish M. pseudaulacaspidis as a new species.

Microcera chrysomphaludis Feng Liu & C.L. Yang, sp. nov.

Index Fungorum No: 559445
Figs 4, 5

Etymology

In reference to the generic name of scale insect from which it was isolated.

Holotype

SICAU 22-0162.

Host

Chrysomphalus aonidum (Diaspididae, Homoptera)

Habitat

On the trunk of Juglans regia.

Sexual state

Perithecia 285–429 μm high, 216–386 µm diam. (x–= 350 × 290 μm, n = 50), scattered, gregarious, formed directly on margin of host scales, bright red to dark red, subglobose, ellipsoidal in section, a central, rounded, papillate ostiole, lined internally with periphyses. Peridium 62–95 µm thick, comprising two layers, outer stratum 32–55 µm thick, composed of small, hyaline to light brown cells of textura angularis; inner stratum 35–45 µm thick, composed of thinner, orange cells of textura angularis; thicker at sides towards apex, thinner at base. Hamathecium 8.5–19.2 µm diameter (x–= 12.3 µm, n = 30), longer than asci, septate, unbranched, paraphyses. Asci 83.3–128.5 × 7.5–15.2 µm (x–= 109.2 × 10.2 μm, n = 50), 8-spored, bitunicate, cylindrical, straight or curved, rounded at apex. Ascospores 16.8–27.5 × 7.8–10.8 µm (x–= 20.9 × 9.6 µm, n = 50), uniseriate, elliptical, with rounded ends, one-septate, slightly constricted at septum, hyaline, smooth-walled, with many guttules.

Figure 4. 

Microcera chrysomphaludis (SICAU 22-0162) a, b ascomata on host substrate c vertical section through ascostromata d peridium e ostiole of locule f paraphyses h ocular chamber g–j asci k–o ascospores p germinated ascospores; q, r colonies on PDA after 30 days. Scale bars: 200 µm (a, b); 50 µm c, 20 µm (d, e); 10 µm (f–p).

Asexual state

Stromata byssoid, pale yellow, formed directly on margin of host scales with 1–6 sporodochia. Sporodochia conical, erupted, yellowish, scattered or aggregated. Macroconidia 73–89 long, 6.9–10.6 µm wide (x–= 78.8 × 8.5 μm, n = 50), hyaline, cylindrical, slightly curved, slender towards each end, 2–7 septa, mostly 4–6 septa, slightly constricted at septum, difficult to distinguish apical cell and basal cell. Microconidia and chlamydospores were not observed.

Figure 5. 

Microcera chrysomphaludis (SICAU 22-0163) a–c stromata and sporodochia on host substrate d–g conidiophore with developing macroconidia h–l macroconidia m germinated conidium n, o colonies on PDA after 30 days. Scale bars: 200 µm (b, c); 20 µm (d–g); 10 µm (h–m).

Material examined

China, Sichuan Province, Liangshan Yi Autonomous Prefecture, Huili County (26°56′43″N, 107°16′16″E, alt. 1780 m), on scale insect Chrysomphalus aonidum, 8 October 2022, Feng Liu, LF202208001, (SICAU 22-0162, holotype), ex-type culture SICAUCC 22-0164. Ibid. LF202008002 (SICAU 22-0163, paratype), living culture SICAUCC 21-0165.

Culture characters

Ascospores germinate on PDA within 12 h and cultures grow slowly on PDA. Colonies reach 2.4 cm in diameter after 20 days. Colonies from single conidia flocculent, clinging to medium, with irregular margin, white to pink mycelium on surface and back of colonies dark orange. Mycelium creamy-white starting at centre, but gradually becoming pale pink after 20 days, forming sparsely distributed mycelial clumps near edge of colony. Conidia germinate on PDA within 12 h, cultures grow slowly on PDA. Colonies 2.5 cm in diameter after 20 days. Colonies from single ascospores cottony and hard, with regular margin; mycelium creamy-white to pale pink, with concentric rings; back of colonies pale yellow.

Notes

Multi-gene phylogenetic analyses have revealed that Microcera chrysomphaludis forms a highly robust clade that is closely related to M. coccophila and M. diploa. However, it is distinct from these two species with a high level of bootstrap support (ML/BY 100/1.00; Fig. 1). Morphologically, M. chrysomphaludis exhibits similar characteristics to M. coccophila, including superficial, subglobose, bright red ascomata, cylindrical asci and elliptical ascospores, as well as cylindrical macroconidia. However, M. chrysomphaludis can be differentiated from M. coccophila by its larger ascomata (285–429 × 216–386 µm vs. 194–387 × 194–355 μm), slightly shorter asci (109.2 × 10.2 μm vs. 115 × 15 µm), longer ascospores (16.8–27.5 × 7.8–10.8 μm vs. 14–19 × 6–10 μm) and shorter macroconidia (73–89 × 6.9–10.6 µm vs. 90–132 × 6–9 µm) and fewer septa (4–6 vs. 7–9) (Gräfenhan et al. 2011; Dao et al. 2015). Hence, we describe our collection as a new species in Microcera.

Discussion

In this study, two new species (Microcera chrysomphaludis and M. pseudaulacaspidis) associated with scale insects from walnut were introduced, based on phylogenetic inferences of a combined ITS, LSU, tef1-α, acl1, act, cmdA, his3, rpb1, rpb2 and tub2 DNA sequence dataset and morphological evidence.

Ecologically, Microcera species are mainly distributed in tropical regions, but they have also been reported in the subtropical and temperate regions. Most of the Microcera species are pathogens of scale insects (Gräfenhan et al. 2011; O’Donnell et al. 2012; Dao et al. 2015, 2016; Crous et al. 2021a; Xu et al. 2021), However, two new species have recently been described from lichens (Crous et al. 2021b, 2022a). Most Microcera species infecting scale insects occur in the tree canopy and are more noticeable under moist conditions (Dao et al. 2015, 2016; Xu et al. 2021), consistent with the findings of this study. Morphologically, the sexual morph in this genus is characterised by orange to dark red perithecia with a blunt papilla producing cylindrical to narrowly clavate asci and 1(–3)-septate ascospores, while the asexual morph is predominantly fusarium-like, with verticillate to penicillate conidiophores producing small macroconidia (Gräfenhan et al. 2011; Lombard et al. 2015; Crous et al. 2021a, b). Similar morphs were observed and documented in this study to provide further evidence of a connection between our isolates and other Microcera species (e.g. Figs 4, 5).

Gräfenhan et al. (2011) analysed an association of Microcera to Fusarium, Cladosterigma Pat., Mycogloea L.S. Olive and Tetracrium Henn. and accepted four species in Microcera. In recent years, numerous newly-discovered species have been described by employing extensive sampling coupled with multigene phylogenies (Sung et al. 2007; Lombard and Crous 2012; Wei et al. 2019; Lucking et al. 2021). Lombard et al. (2015) performed a multi-gene phylogenetic analysis, using combined datasets of ITS, LSU, tef1-α, acl1, act, cmdA, his3, rpb1, rpb2 and tub2 to clarify intraspecific and intergeneric relationships within Nectriaceae. In this paper, M. pseudaulacaspidis was distinguished from M. kuwanaspidis and established as a new species, based on base-pair differences, particularly in the LSU (17.67%), tef1-α (3.22%) and his3 (3.82%). Additionally, M. chrysomphaludis formed a distinct and well-supported subclade and was found to be morphologically distinct from M. coccophila in terms of the size of asci, ascospores and macroconidia (Gräfenhan et al. 2011; O’Donnell et al. 2012; Dao et al. 2015). Through multigene phylogenetic analysis, the connection between the sexual and asexual morphs of M. chrysomphaludis was also confirmed.

Entomopathogenic fungi are common on scale insects and have great potential in biological control (Zha et al. 2019; Sharma et al. 2020). Based on field trials, Microcera larvarum has been reported to have a significant biological control effect of Saissetia oleae, an economically important pest of olive and citrus plants (Cozzi et al. 2002). Microcera species have also been exploited for various biopharmaceuticals in recent years due to their secondary metabolites with medicinal properties. For instance, parnafungins, extracted from M. larvarum, have intrinsic antifungal activity (Parish et al. 2008). Isaka et al. (2015) isolated two new ascochlorin derivatives from cultures of Microcera sp. BCC 17074 and demonstrated their significant cytotoxic activities against various cancer cells. Furthermore, Cadelis et al. (2020) isolated four new secondary metabolites from M. larvarum isolates, which exhibited potent antimicrobial activity.

This paper presents novel findings of two new entomopathogenic fungi, Microcera chrysomphaludis and M. pseudaulacaspidis, which were isolated from scale insects found on walnut trees in China. We conducted surveys in numerous walnut orchards across Sichuan Province and observed significant infections of scale insects by these two species, resulting in high mortality rates, particularly in wet and humid conditions. Further screening and evaluation of these entomopathogenic fungi could facilitate their potential use as commercial biological control agents.

Acknowledgements

This study was supported by the Sichuan Science and Technology Program (grant number 2022NSFSC1011). The three anonymous reviewers are also acknowledged for their useful comments.

Additional information

Conflict of interest

No conflict of interest was declared.

Ethical statement

No ethical statement was reported.

Funding

No funding was reported.

Author contributions

Funding acquisition: CLY. Investigation: QZ, FHW, YD. Project administration: CLY. Supervision: XLX, CLY, YGL. Validation: RJ. Writing - review and editing: FL.

Author ORCIDs

Feng Liu https://orcid.org/0000-0003-4580-7169

Rajesh Jeewon https://orcid.org/0000-0002-8563-957X

Xiu-Lan Xu https://orcid.org/0000-0002-6832-5421

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Bills GF, Platas G, Overy DP, Collado J, Fillola A, Jimenez MR, Martin J, Del VA, Vicente F, Tormo JR, Pelaez F, Calati K, Harris G, Parish C, Xu D, Roemer T (2009) Discovery of the parnafungins, antifungal metabolites that inhibit mrna polyadenylation, from the Fusarium larvarum complex and other hypocrealean fungi. Mycologia 101(4): 449–472. https://doi.org/10.3852/08-163
  • Booth C (1971) The Genus Fusarium. Commonwealth Mycological Institute, Kew, Surrey, 237 pp.
  • Cadelis MM, Geese S, Gris L, Weir BS, Copp BR, Wiles S (2020) A revised structure and assigned absolute configuration of theissenolactone A. Molecules (Basel, Switzerland) 25(20): 4823. https://doi.org/10.3390/molecules25204823
  • Castlebury LA, Rossman AY, Sung GH, Hyten AS, Spatafora JW (2004) Multigene phylogeny reveals new lineage for Stachybotrys chartarum, the indoor air fungus. Mycological Research 108(8): 864–872. https://doi.org/10.1017/S0953756204000607
  • Chomnunti P, Hongsanan S, Aguirre-Hudson B, Tian Q, Peršoh D, Dhami MK, Alias AS, Xu J, Liu X, Stadler M, Hyde KD (2014) The sooty moulds. Fungal Diversity 66: 1–36. https://doi.org/10.1007/s13225-014-0278-5
  • Cozzi G, Stornelli C, Moretti A, Logrieco A, Porcelli F (2002) Field evaluation of Fusarium larvarum formulations in the biocontrol of Saissetia oleae on olive in Apulia. Acta Horticulturae (586): 811–814. https://doi.org/10.17660/ActaHortic.2002.586.175
  • Crous PW, Groenewald JZ, Risède JM, Simoneau P, Hyde KD (2006) Calonectria species and their Cylindrocladium anamorphs: Species with clavate vesicles. Studies in Mycology 55: 213–226. https://doi.org/10.3114/sim.55.1.213
  • Crous PW, Lombard L, Seifert KA, Schroers HJ, Gené J, Guarro J, Hirooka Y, Kema GHJ, Lamprecht SC, Cai L, Rossman AY, Stadler M, Summerbell RC, Taylor JW, Ploch S, Visagie CM, Frisvad JC, Abdel-Azeem AM, Abdollahzadeh J, Abdolrasouli A, Alberts JF, Araújo JPM, Bakhshi M, Bendiksby M, Bezerra JDP, Boekhout T, Câmara MPS, Carbia M, Cardinali G, Castañeda-Ruiz RF, Collemare J, Croll D, Damm U, Decock CA, de Vries RP, Fan XL, Groenewald JZ, Guevara-Suarez M, Gupta VK, Guarnaccia V, Hagen F, Haelewaters D, Hansen K, Hashimoto A, Hernández-Restrepo M, Houbraken J, Hubka V, Hyde KD, Iturriaga T, Jeewon R, Johnston PR, Korsten L, Kušan I, Labuda R, Lawrence DP, Lee HB, Lechat C, Li HY, Litovka YA, Marin-Felix Y, Matio Kemkuignou B, Mctaggart AR, Nakashima C, Nilsson RH, Noumeur SR, Peralta MP, Phillips AJL, Pitt JI, Polizzi G, Quaedvlieg W, Rajeshkumar KC, Restrepo S, Rhaiem A, Robert J, Robert V, Salgado-Salazar C, Samson RA, Shivas RG, Souza-Motta CM, Sun GY, Tan YP, Taylor JE, Tiago PV, Váczy KZ, van de Wiele N, van der Merwe NA, Verkley GJM, Vieira WAS, Weir BS, Wijayawardene NN, Yáñez-Morales MJ, Yurkov A, Zare R, Zhang CL, Thines M, Sub MPP, Sub EAB, Microbiology M, Physiology MP, Biodiversity EA (2021a) Fusarium: More than a node or a foot-shaped basal cell. Studies in Mycology 98: 100116. https://doi.org/10.1016/j.simyco.2021.100116
  • Crous PW, Osieck ER, Jurjevi Ž, Boers J, Van Iperen AL, Starink-Willemse M, Dima B, Balashov S, Bulgakov TS, Johnston PR, Morozova OV, Pinruan U, Sommai S, Alvarado P, Decock CA, Lebel T, Mcmullan-Fisher S, Moreno G, Shivas RG, Zhao L, Abdollahzadeh J, Abrinbana M, Ageev DV, Akhmetova G, Alexandrova AV, Altés A, Amaral AGG, Angelini C, Antonín V, Arenas F, Asselman P, Badali F, Baghela A, Bañares A, Barreto RW, Baseia IG, Bellanger JM, Berraf-Tebbal A, Biketova AY, Bukharova NV, Burgess TI, Cabero J, Câmara MPS, Cano-Lira JF, Ceryngier P, Chávez R, Cowan DA, de Lima AF, Oliveira RL, Denman S, Dang QN, Dovana F, Duarte IG, Eichmeier A, Erhard A, Esteve-Raventós F, Fellin A, Ferisin G, Ferreira RJ, Ferrer A, Finy P, Gaya E, Geering ADW, Gil-Durán C, Glässnerová K, Glushakova AM, Gramaje D, Guard FE, Guarnizo AL, Haelewaters D, Halling RE, Hill R, Hirooka Y, Hubka V, Iliushin VA, Ivanova DD, Ivanushkina NE, Jangsantear P, Justo A, Kachalkin AV, Kato S, Khamsuntorn P, Kirtsideli IY, Knapp DG, Kochkina GA, Koukol O, Kovács GM, Kruse J, Kumar TKA, Kušan I, Læssøe T, Larsson E, Lebeuf R, Levicán G, Loizides M, Marinho P, Luangsa-Ard JJ, Lukina EG, Magaña-Dueñas V, Maggs-Kölling G, Malysheva EF, Malysheva VF, Martín B, Martín MP, Matočec N, Mctaggart AR, Mehrabi-Koushki M, Mešić A, Miller AN, Mironova P, Moreau PA, Morte A, Müller K, Nagy LG, Nanu S, Navarro-Ródenas A, Nel WJ, Nguyen TH, Nóbrega TF, Noordeloos ME, Olariaga I, Overton BE, Ozerskaya SM, Palani P, Pancorbo F, Papp V, Pawłowska J, Pham TQ, Phosri C, Popov ES, Portugal A, Pošta A, Reschke K, Reul M, Ricci GM, Rodríguez A, Romanowski J, Ruchikachorn N, Saar I, Safi A, Sakolrak B, Salzmann F, Sandoval-Denis M, Sangwichein E, Sanhueza L, Sato T, Sastoque A, Senn-Irlet B, Shibata A, Siepe K, Somrithipol S, Spetik M, Sridhar P, Stchigel AM, Stuskova K, Suwannasai N, Tan YP, Thangavel R, Tiago I, Tiwari S, Tkalčec Z, Tomashevskaya MA, Tonegawa C, Tran HX, Tran NT, Trovão J, Trubitsyn VE, Van Wyk J, Vieira WAS, Vila J, Visagie CM, Vizzini A, Volobuev SV, Vu DT, Wangsawat N, Yaguchi T, Ercole E, Ferreira BW, de Souza AP, Vieira BS, Groenewald JZ (2021b) Fungal planet description sheets: 1284-1382. Persoonia 47: 178–374. https://doi.org/10.3767/persoonia.2021.47.06
  • Crous PW, Begoude BAD, Boers J, Braun U, Declercq B, Dijksterhuis J, Elliott TF, Garay-Rodriguez GA, Jurjević Ž, Kruse J, Linde CC, Loyd A, Mound L, Osieck ER, Rivera-Vargas LI, Quimbita AM, Rodas CA, Roux J, Schumacher RK, Starink-Willemse M, Thangavel R, Trappe JM, van Iperen AL, Van Steenwinkel C, Wells A, Wingfield MJ, Yilmaz N, Groenewald JZ (2022a) New and interesting fungi. 5. Fungal Systematics and Evolution 10(1): 19–90. https://doi.org/10.3114/fuse.2022.10.02
  • Crous PW, Sandoval-Denis M, Costa MM, Groenewald JZ, van Iperen AL, Starink-Willemse M, Hernández-Restrepo M, Kandemir H, Ulaszewski B, de Boer W, Abdel-Azeem AM, Abdollahzadeh J, Akulov A, Bakhshi M, Bezerra JDP, Bhunjun CS, Câmara MPS, Chaverri P, Vieira WAS, Decock CA, Gaya E, Gené J, Guarro J, Gramaje D, Grube M, Gupta VK, Guarnaccia V, Hill R, Hirooka Y, Hyde KD, Jayawardena RS, Jeewon R, Jurjević Ž, Korsten L, Lamprecht SC, Lombard L, Maharachchikumbura SSN, Polizzi G, Rajeshkumar KC, Salgado-Salazar C, Shang QJ, Shivas RG, Summerbell RC, Sun GY, Swart WJ, Tan YP, Vizzini A, Xia JW, Zare R, González CD, Iturriaga T, Savary O, Coton M, Coton E, Jany JL, Liu C, Zeng ZQ, Zhuang WY, Yu ZH, Thines M (2022b) Fusarium and allied fusarioid taxa (FUSA). 1. Fungal Systematics and Evolution 9(1): 161–200. https://doi.org/10.3114/fuse.2022.09.08
  • Dao HT, Beattie GAC, Rossman AY, Burgess LW, Holford P (2015) Systematics and biology of two species of Microcera associated with armoured scales on citrus in Australia. Mycological Progress 14(4): 1–14. https://doi.org/10.1007/s11557-015-1044-0
  • Dao HT, Beattie GAC, Rossman AY, Burgess LW, Holford P (2016) Four putative entomopathogenic fungi of armoured scale insects on citrus in Australia. Mycological Progress 15(5): 47. https://doi.org/10.1007/s11557-016-1188-6
  • Gräfenhan T, Schroers HJ, Nirenberg HI, Seifert KA (2011) An overview of the taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella. Studies in Mycology 68: 79–113. https://doi.org/10.3114/sim.2011.68.04
  • Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Herrera CS, Rossman AY, Samuels GJ, Chaverri P (2013) Pseudocosmospora, a new genus to accommodate Cosmospora vilior and related species. Mycologia 105(5): 1287–1305. https://doi.org/10.3852/12-395
  • Isaka M, Yangchum A, Supothina S, Laksanacharoen P, Jennifer LJ, Hywel-Jones NL (2015) Ascochlorin derivatives from the leafhopper pathogenic fungus Microcera sp. BCC 17074. The Journal of Antibiotics 68(1): 47–51. https://doi.org/10.1038/ja.2014.90
  • Jeewon R, Hyde KD (2016) Establishing species boundaries and new taxa among fungi:recommendations to resolve taxonomic ambiguities. Mycosphere : Journal of Fungal Biology 7(11): 1669–1677. https://doi.org/10.5943/mycosphere/7/11/4
  • Katoh K, Standley DM (2013) Mafft multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Lucking R, Aime MC, Robbertse B, Miller AN, Aoki T, Ariyawansa HA, Cardinali G, Crous PW, Druzhinina IS, Geiser DM, Hawksworth DL, Hyde KD, Irinyi L, Jeewon R, Johnston PR, Kirk PM, Malosso E, May TW, Meyer W, Nilsson HR, Opik M, Robert V, Stadler M, Thines M, Vu D, Yurkov AM, Zhang N, Schoch CL (2021) Fungal taxonomy and sequence-based nomenclature. Nature Microbiology 6(5): 540–548. https://doi.org/10.1038/s41564-021-00888-x
  • Nelson PE, Toussoun TA, Marasas WFO (1983) Fusarium species: An Illustrated Manual for Identification; Pennsylvania State University Press, University Park, PA, USA, 193 pp.
  • O’Donnell K, Cigelnik E (1997) Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7(1): 103–116. https://doi.org/10.1006/mpev.1996.0376
  • O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC (1998) Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the United States of America 95(5): 2044–2049. https://doi.org/10.1073/pnas.95.5.2044
  • O’Donnell K, Sarver BA, Brandt M, Chang DC, Noble-Wang J, Park BJ, Sutton DA, Benjamin L, Lindsley M, Padhye A, Geiser DM, Ward TJ (2007) Phylogenetic diversity and microsphere array-based genotyping of human pathogenic Fusaria, including isolates from the multistate contact lens-associated U.S. keratitis outbreaks of 2005 and 2006. Journal of Clinical Microbiology 45(7): 2235–2248. https://doi.org/10.1128/JCM.00533-07
  • O’Donnell K, Humber RA, Geiser DM, Kang S, Park B, Robert VA, Crous PW, Johnston PR, Aoki T, Rooney AP, Rehner SA (2012) Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST. Mycologia 104(2): 427–445. https://doi.org/10.3852/11-179
  • Parish CA, Smith SK, Calati K, Zink D, Wilson K, Roemer T, Jiang B, Xu D, Bills G, Platas G, Pelaez F, Diez MT, Tsou N, Mckeown AE, Ball RG, Powles MA, Yeung L, Liberator P, Harris G (2008) Isolation and structure elucidation of parnafungins, antifungal natural products that inhibit mRNA polyadenylation. Journal of the American Chemical Society 130(22): 7060–7066. https://doi.org/10.1021/ja711209p
  • Quaedvlieg W, Binder M, Groenewald JZ, Summerell BA, Carnegie AJ, Burgess TI, Crous PW (2014) Introducing the consolidated species concept to resolve species in the Teratosphaeriaceae. Persoonia 33(1): 1–40. https://doi.org/10.3767/003158514X681981
  • Senanayake IC, Rathnayake AR, Marasinghe DS, Calabon MS, Gentekaki E, Lee HB, Hurdeal VG, Pem D, Dissanayake LS, Wijesinghe SN, Bundhun D, Nguyen TT, Goonasekara ID, Abeywickrama PD, Bhunjun CS, Jayawardena RS, Wanasinghe DN, Jeewon R, Bhat DJ, Mm X (2020) Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere : Journal of Fungal Biology 11(1): 2678–2754. https://doi.org/10.5943/mycosphere/11/1/20
  • Sharma A, Srivastava A, Shukla AK, Srivastava K, Srivastava AK, Saxena AK (2020) Entomopathogenic fungi: a potential source for biological control of insect pests. Springer, Singapore, 225–250. https://doi.org/10.1007/978-981-15-3151-4_9
  • Sung GH, Sung JM, Hywei-Jones ML, Spatafora JW (2007) A multi-gene phylogeny of clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Molecular Phylogenetics and Evolution 44(3): 1204–1223. https://doi.org/10.1016/j.ympev.2007.03.011
  • Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27(2): 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
  • Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172(8): 4238–4246. https://doi.org/10.1128/jb.172.8.4238-4246.1990
  • Wanasinghe DN, Mortimer PE, Xu J (2021) Insight into the systematics of microfungi colonizing dead woody twigs of Dodonaea viscosa in Honghe (China). Journal of Fungi (Basel, Switzerland) 7(3): 180. https://doi.org/10.3390/jof7030180
  • White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR protocols: a guide to methods and applications, Academic Press, San Diego, California, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Xu XL, Yang CL, Jeewon R, Wanasinghe DN, Liu YG, Xiao QG (2020) Morpho-molecular diversity of Linocarpaceae (Chaetosphaeriales): Claviformispora gen. nov. from decaying branches of Phyllostachys heteroclada. MycoKeys 70: 1–17. https://doi.org/10.3897/mycokeys.70.54231
  • Xu XL, Zeng Q, Lv YC, Jeewon R, Maharachchikumbura S, Wanasinghe DN, Hyde KD, Xiao QG, Liu YG, Yang CL (2021) Insight into the systematics of novel entomopathogenic fungi associated with armored scale insect, Kuwanaspis howardi (Hemiptera: Diaspididae) in China. Journal of Fungi (Basel, Switzerland) 7(8): 628. https://doi.org/10.3390/jof7080628
  • Zha LS, Wen TC, Jeewon R, Xie ZM, Boonmee S, Eungwanichayapant PD, Hyde KD (2019) Xuefeng Cordyceps: Insights into species diversity, life cycle and host association. Current Science 117(5): 839–846. https://doi.org/10.18520/cs/v117/i5/839-846
login to comment