Research Article |
|
Corresponding author: Chun-Lin Yang ( yangcl0121@163.com ) Academic editor: Sajeewa Maharachchikumbura
© 2023 Feng Liu, Yu Deng, Fei-Hu Wang, Rajesh Jeewon, Qian Zeng, Xiu-Lan Xu, Ying-Gao Liu, Chun-Lin Yang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Liu F, Deng Y, Wang F-H, Jeewon R, Zeng Q, Xu X-L, Liu Y-G, Yang C-L (2023) Morphological and molecular analyses reveal two new species of Microcera (Nectriaceae, Hypocreales) associated with scale insects on walnut in China. MycoKeys 98: 19-35. https://doi.org/10.3897/mycokeys.98.103484
|
The fungal genus Microcera consists of species mostly occurring as parasites of scale insects, but are also commonly isolated from soil or lichens. In the present study, we surveyed the diversity and assess the taxonomy of entomopathogenic fungi in Sichuan Province, China. Two new species of Microcera, viz. M. chrysomphaludis and M. pseudaulacaspidis, were isolated from scale insects colonising walnut (Juglans regia). Maximum Likelihood and Bayesian Inference analyses of ITS, LSU, tef1-α, rpb1, rpb2, acl1, act, tub2, cmdA and his3 sequence data provide evidence for the validity of the two species and their placement in Nectriaceae (Hypocreales). Microcera pseudaulacaspidis primarily differs from similar species by having more septate and smaller cylindrical macroconidia, as well as DNA sequence data. Meanwhile, Microcera chrysomphaludis has elliptical, one-septate ascospores with acute ends and cylindrical, slightly curved with 4–6 septate macroconidia up to 78 µm long. Morphological descriptions with illustrations of the novel species and DNA-based phylogeny generated from analyses of multigene dataset are also provided to better understand species relationships.
Two new taxa, entomopathogenic fungi, morphology, phylogenetic analyses
The genus Microcera Desm. (Nectriaceae, Hypocreales) was introduced in the 19th century and was typified by M. coccophila Desm., commonly known as the “red-headed fungus”. Microcera has been considered to be a synonym of the Fusarium Link in some major taxonomic revisions (
Currently, there are eight accepted species within the genus Microcera (
During a survey of entomopathogenic fungi in Sichuan Province, China, two Microcera species, in association with the two scale insects Pseudaulacaspis pentagona and Chrysomphalus aonidum on walnut, were isolated. Microcera pseudaulacaspidis sp. nov. and M. chrysomphaludis sp. nov. are introduced here based on the morphological characteristics and multi-locus analyses (DNA based). They were compared morphologically with existing taxa. In this study, comprehensive descriptions, micrographs of macroscopic and microscopic morphological characteristics, as well as DNA sequence data, are provided to support the establishment of the new species.
Three specimens of scale insects (SICAU 22-0161, SICAU 22-0162 and SICAU 22-0163) that were infected, were collected from Neijiang City (29°48′15″N, 105°06′44″E) and Liangshan Yi Autonomous Prefecture (26°56′43″N, 102°16′16″E), Sichuan Province, on 16 April and 8 October 2022. The specimens were placed in sterilised tubes or plastic boxes and returned to the laboratory as described by
The New Plant Genomic DNA Kit (Beijing Aidlab Biotechnologies Co., Ltd, Beijing, China) was used to extract genomic DNA from fresh fungal mycelium. The extracted DNA to be used was stored at -20 °C. Amplified gene markers and their corresponding primers are shown in Table
| Gene markers | Primers | Sequences of Primers 5’-3’ | References |
|---|---|---|---|
| acl1 | acl1-230up | AGCCCGATCAGCTCATCAAG |
|
| acl1-1220low | CCTGGCAGCAAGATCVAGGAAGT | ||
| act | ACT-512F | ATGTGCAAGGCCGGTTTCGC |
|
| ACT1Rd | CRTCGTACTCCTGCTTBGAGATCCAC |
|
|
| cmdA | CAL-228F | GAGTTCAAGGAGGCCTTCTCCC |
|
| CAL2Rd | TGRTCNGCCTCDCGGATCATCTC |
|
|
| his3 | CYLH3F | AGGTCCACTGGTGGCAAG |
|
| CYLH3R | AGCTGGATG TCCTTGGAC | ||
| ITS | ITS5 | GGAAGTAAAAGTCGTAACAAGG |
|
| ITS4 | TCCTCCGCTTATTGATATGC | ||
| LSU | LR0R | ACCCGCTGAACTTAAGC |
|
| LR5 | ATCCTGAGGGAAACTTC |
|
|
| rpb1 | RPB1-Ac | CAYCCWGGYTTYATCAAGAA |
|
| RPB1-Cr | CCNGCDATNTCRTTRTCCATRTA | ||
| rpb2 | RPB2-5F2 | GGGGWGAYCAGAAGAAGGC |
|
| RPB2-7cR | CCCATRGCTTGYTTRCCCAT | ||
| tef1 | EF1-728F | CATCGAGAAGTTCGAGAAGG |
|
| EF2 | GGARGTACCAGTSATCATG |
|
|
| tub2 | T1 | AACATGCGTGAGATTGTAAGT |
|
| CYLTUB1R | AGTTGTCGG GACGGAAGAG |
|
Based on BLAST searches in GenBank and recent publications (
Specimen information and GenBank accession numbers of the sequences used in this study.
Phylogenetically closely-related species were analysed using the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) model by performing a pairwise homoplasy index (PHI) test as described by
The ML and BI analyses resulted in trees with similar topologies. Multi-locus phylogenetic analyses of species of Nectriaceae (Hypocreales) include sequences from 25 taxa and Tilachlidium brachiatum (Batsch) Petch (CBS 363.97, CBS 505.67) were used as outgroup (Fig.
Phylogram generated from RAxML analysis, based on combined ITS, LSU, tef1-α, rpb1, r pb2, a cl1, act, tub2, cmdA and his3 sequence data of Microcera isolates. Bootstrap support values from Maximum Likelihood (MLBS, left) higher than 75% and Bayesian posterior probabilities (BIPP, right) equal to or greater than 0.95 are indicated at the nodes, respectively. The sequences from ex-type strains are in bold. The newly-generated sequence is in red.
The pairwise homoplasy index (PHI) test revealed that there was no significant recombination (Фw = 1) between Microcera pseudaulacaspidis (SICAUCC 22-0163), M. coccophila (CBS 310.34), M. diploa (CBS 735.79) and M. kuwanaspidis (SICAUCC 21-0006) (Fig.
In reference to the generic name of scale insect from which it was isolated.
SICAU 22-0161.
Pseudaulacaspis pentagona (Diaspididae, Homoptera)
On the trunk of Juglans regia.
Undetermined.
Stromata byssoid, well-developed, bright orange to orange-red, formed directly on the margin of host scales or their covers with 1–7 sporodochia. Sporodochia 250–900 μm long, 400–860 µm wide, (x–= 620 × 570 μm, n = 50), conical, orange-red, upright masses on margin of host scales. Macroconidia 70–120 µm long × 4.2–10.5 µm wide (x–= 95.7 × 6.5 μm, n = 50), hyaline or jasmine, cylindrical, slightly curved, slender towards each end, 3–10 septate, mostly 7–9 septate, difficult to distinguish apical cell and basal cell. Microconidia and chlamydospores were not observed.
China, Sichuan Province, Neijiang City, Dongxing District, Paifang Village walnut industrial base (29°48′15″N, 105°06′44″E, alt. 340 m), on scale insect Pseudaulacaspis pentagona, 16 April 2022, Feng Liu, LF202204001, (SICAU 22-0161, holotype), ex-type culture SICAUCC 22-0163.
Colonies from a single macroconidium on PDA grow slowly and reach approximately 2 cm in diameter after 12 days at 25 °C, circular, flat, producing masses of macroconidia in the centre of the colony, measuring 76–125 µm long × 5.3–7.6 µm wide (x–= 91.2 × 6.3 µm, n = 50), smaller than those in nature, white mycelium on the surface and the back of colonies is dark orange.
Based on multi-gene phylogenetic analyses, Microcera pseudaulacaspidis is closely related to M. kuwanaspidis (Fig.
In reference to the generic name of scale insect from which it was isolated.
SICAU 22-0162.
Chrysomphalus aonidum (Diaspididae, Homoptera)
On the trunk of Juglans regia.
Perithecia 285–429 μm high, 216–386 µm diam. (x–= 350 × 290 μm, n = 50), scattered, gregarious, formed directly on margin of host scales, bright red to dark red, subglobose, ellipsoidal in section, a central, rounded, papillate ostiole, lined internally with periphyses. Peridium 62–95 µm thick, comprising two layers, outer stratum 32–55 µm thick, composed of small, hyaline to light brown cells of textura angularis; inner stratum 35–45 µm thick, composed of thinner, orange cells of textura angularis; thicker at sides towards apex, thinner at base. Hamathecium 8.5–19.2 µm diameter (x–= 12.3 µm, n = 30), longer than asci, septate, unbranched, paraphyses. Asci 83.3–128.5 × 7.5–15.2 µm (x–= 109.2 × 10.2 μm, n = 50), 8-spored, bitunicate, cylindrical, straight or curved, rounded at apex. Ascospores 16.8–27.5 × 7.8–10.8 µm (x–= 20.9 × 9.6 µm, n = 50), uniseriate, elliptical, with rounded ends, one-septate, slightly constricted at septum, hyaline, smooth-walled, with many guttules.
Microcera chrysomphaludis (SICAU 22-0162) a, b ascomata on host substrate c vertical section through ascostromata d peridium e ostiole of locule f paraphyses h ocular chamber g–j asci k–o ascospores p germinated ascospores; q, r colonies on PDA after 30 days. Scale bars: 200 µm (a, b); 50 µm c, 20 µm (d, e); 10 µm (f–p).
Stromata byssoid, pale yellow, formed directly on margin of host scales with 1–6 sporodochia. Sporodochia conical, erupted, yellowish, scattered or aggregated. Macroconidia 73–89 long, 6.9–10.6 µm wide (x–= 78.8 × 8.5 μm, n = 50), hyaline, cylindrical, slightly curved, slender towards each end, 2–7 septa, mostly 4–6 septa, slightly constricted at septum, difficult to distinguish apical cell and basal cell. Microconidia and chlamydospores were not observed.
China, Sichuan Province, Liangshan Yi Autonomous Prefecture, Huili County (26°56′43″N, 107°16′16″E, alt. 1780 m), on scale insect Chrysomphalus aonidum, 8 October 2022, Feng Liu, LF202208001, (SICAU 22-0162, holotype), ex-type culture SICAUCC 22-0164. Ibid. LF202008002 (SICAU 22-0163, paratype), living culture SICAUCC 21-0165.
Ascospores germinate on PDA within 12 h and cultures grow slowly on PDA. Colonies reach 2.4 cm in diameter after 20 days. Colonies from single conidia flocculent, clinging to medium, with irregular margin, white to pink mycelium on surface and back of colonies dark orange. Mycelium creamy-white starting at centre, but gradually becoming pale pink after 20 days, forming sparsely distributed mycelial clumps near edge of colony. Conidia germinate on PDA within 12 h, cultures grow slowly on PDA. Colonies 2.5 cm in diameter after 20 days. Colonies from single ascospores cottony and hard, with regular margin; mycelium creamy-white to pale pink, with concentric rings; back of colonies pale yellow.
Multi-gene phylogenetic analyses have revealed that Microcera chrysomphaludis forms a highly robust clade that is closely related to M. coccophila and M. diploa. However, it is distinct from these two species with a high level of bootstrap support (ML/BY 100/1.00; Fig.
In this study, two new species (Microcera chrysomphaludis and M. pseudaulacaspidis) associated with scale insects from walnut were introduced, based on phylogenetic inferences of a combined ITS, LSU, tef1-α, acl1, act, cmdA, his3, rpb1, rpb2 and tub2 DNA sequence dataset and morphological evidence.
Ecologically, Microcera species are mainly distributed in tropical regions, but they have also been reported in the subtropical and temperate regions. Most of the Microcera species are pathogens of scale insects (
Entomopathogenic fungi are common on scale insects and have great potential in biological control (
This paper presents novel findings of two new entomopathogenic fungi, Microcera chrysomphaludis and M. pseudaulacaspidis, which were isolated from scale insects found on walnut trees in China. We conducted surveys in numerous walnut orchards across Sichuan Province and observed significant infections of scale insects by these two species, resulting in high mortality rates, particularly in wet and humid conditions. Further screening and evaluation of these entomopathogenic fungi could facilitate their potential use as commercial biological control agents.
This study was supported by the Sichuan Science and Technology Program (grant number 2022NSFSC1011). The three anonymous reviewers are also acknowledged for their useful comments.
No conflict of interest was declared.
No ethical statement was reported.
No funding was reported.
Funding acquisition: CLY. Investigation: QZ, FHW, YD. Project administration: CLY. Supervision: XLX, CLY, YGL. Validation: RJ. Writing - review and editing: FL.
Feng Liu https://orcid.org/0000-0003-4580-7169
Rajesh Jeewon https://orcid.org/0000-0002-8563-957X
Xiu-Lan Xu https://orcid.org/0000-0002-6832-5421
All of the data that support the findings of this study are available in the main text or Supplementary Information.