Tony Martin Callaghan, Sabine Marie Podmirseg, Daniel Hohlweck, Joan Elizabeth Edwards, Anil Kumar Puniya, Sumit Singh Dagar, Gareth Wyn Griffith

Data type: Adobe PDF file

Explanation note: Putative fused zoospores in isolate GE09 (A) and the similar structure reported by Orpin (1975) (B). Swollen sporangiophores and twisted rhizoids, as found in isolate GE09, were also reported for Piromyces spiralis (C, D) by Ho et al. (1993), whilst Anaeromyces (formerly Piromyces) polycephalus also forms a swollen sporangiophore (E). In older cultures of GE09, thick walled putative spore structures were frequently observed (F, G). Scalebar indicates 20 µm. A video of the putative fused zoospore is found at: https://www.youtube.com/watch?v=im14hz1jiX0.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (6.19 MB)

Tony Martin Callaghan, Sabine Marie Podmirseg, Daniel Hohlweck, Joan Elizabeth Edwards, Anil Kumar Puniya, Sumit Singh Dagar, Gareth Wyn Griffith

Data type: Adobe PDF file

Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3’ end of the primer binding site which are likely to impede PCR amplification.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (884.27 kb)

Tony Martin Callaghan, Sabine Marie Podmirseg, Daniel Hohlweck, Joan Elizabeth Edwards, Anil Kumar Puniya, Sumit Singh Dagar, Gareth Wyn Griffith

Data type: Adobe PDF file

Explanation note: Intragenomic variation in ITS sequences among the five clones sequenced from isolate GE09. 18S boundary ends with GATCATTA and 5.8S begins with CAACTTT, according to the convention of Hibbett et al. (1995).

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (124.91 kb)

Tony Martin Callaghan, Sabine Marie Podmirseg, Daniel Hohlweck, Joan Elizabeth Edwards, Anil Kumar Puniya, Sumit Singh Dagar, Gareth Wyn Griffith

Data type: Microsoft Excel file

Explanation note: Details of ITS sequences falling into the Buwchfawromyces clade. The first five are all derived from the isolate GE09.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Download file (20.50 kb)