11 urn:lsid:arphahub.com:pub:C004A564-9D6A-5F9F-B058-6A3815DFE9C3 MycoKeys MC 1314-4057 1314-4049 Pensoft Publishers 10.3897/mycokeys.62.47854 47854 Research Article Ascomycota Phylogeny Taxonomy Asia Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China Zhu Haiyan 1 2 3 Pan Meng 1 Bezerra Jadson D.P. https://orcid.org/0000-0002-7782-8602 4 Tian Chengming 1 Fan Xinlei xinleifan@bjfu.edu.cn https://orcid.org/0000-0002-4946-4442 1 The Key Laboratory for Silviculture and Conservation of Ministry of Education, Beijing Forestry University, Beijing 100083, China Beijing Forestry University Beijing China State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China Institute of Microbiology, Chinese Academy of Sciences Beijing China College of Life Sciences, University of Chinese Academy of Sciences, Beijing 100049, China University of Chinese Academy of Sciences Beijing China Setor de Micologia, Departamento de Biociências e Tecnologia, Instituto de Patologia Tropical e Saúde Pública (IPTSP), Universidade Federal de Goiás, Rua 235, s/n, Setor Universitário, CEP: 7460505, Goiânia, Goiás, Brazil Universidade Federal de Goiás Goiânia Brazil

Corresponding author: Xinlei Fan (xinleifan@bjfu.edu.cn)

Academic editor: N. Wijayawardene

 2020 03 02 2020 62 97 121 0CDEF6D5-DE44-51A1-81F8-818FFC66ACD9 3661750 31 10 2019 11 01 2020 Haiyan Zhu, Meng Pan, Jadson D.P. Bezerra, Chengming Tian, Xinlei Fan This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Members of Cytospora encompass important plant pathogens, saprobes and endophytes on a wide range of woody hosts with a worldwide distribution. In the current study, we obtained seven representative isolates from six tree hosts of Betulaceae, Juglandaceae, Rosaceae, Tiliaceae and Ulmaceae in Mount Dongling of China. Based on morphological comparison and phylogenetic analyses using partial ITS, LSU, act, rpb2, tef1-α and tub2 gene sequences, we identified two known species (Cytospora leucostoma and C. pruinopsis) and two novel species (C. coryli and C. spiraeicola). These results represent the first study on Cytospora species associated with canker disease from Mount Dongling of China.

 Cytosporaceae phylogeny taxonomy wood-inhabiting fungi The Fundamental Research Funds for the Central Universities (2019ZY23), the National Natural Science Foundation of China (31670647) and the College Student Research and Career-creation Program of Beijing (S201810022005). Citation

Zhu H, Pan M, Bezerra JDP, Tian C, Fan X (2020) Discovery of Cytospora species associated with canker disease of tree hosts from Mount Dongling of China. MycoKeys 62: 97–121. https://doi.org/10.3897/mycokeys.62.47854

 Introduction

The genus Cytospora was established by Ehrenberg (1818) and belongs to Cytosporaceae, Diaporthales, Sordariomycetes (Wijayawardene et al. 2018, Fan et al. 2020). It is characterised by single or labyrinthine of pycnidial locules, filamentous conidiophores (enteroblastic and phialidic conidiogenous cells) producing hyaline, allantoid conidia in the asexual morph; diaporthalean-like perithecia, clavate to elongate obovoid asci with four or eight hyaline, allantoid ascospores in the sexual morph (Spielman 1983, 1985, Adams et al. 2005). Species of Cytospora contain important pathogens that cause stem canker and dieback disease on more than 100 species of woody and coniferous plants, thereby causing severe commercial and ecological damage and significant losses worldwide (Sinclair et al. 1987, Adams et al. 2005, 2006, Fan et al. 2014a, b, 2015a, b, Lawrence et al. 2018, Pan et al. 2018, Zhu et al. 2018a, Zhang et al. 2019). Previous Cytospora species and their related sexual morphs viz. Leucostoma, Valsa, Valsella and Valseutypella were listed by old fungal literature without any living culture and sufficient evidence for their identification (Fries 1823, Saccardo 1884, Kobayashi 1970, Barr 1978, Sutton 1980, Gvritishvili 1982, Spielman 1983, 1985). Adams et al. (2005) revised the genus Cytospora from Eucalyptus with 28 species and accepted all sexual genera combined under Valsa, either as subgenera or species without additional infrageneric rank. Following the single-name for pleomorphic taxa, Cytospora (1818), the older asexual typified name was proposed as the recommended name against Valsa (1849), the younger sexual typified name (Fan et al. 2015a, b, Rossman et al. 2015).

Currently, 388 species epithets of Cytospora have been recorded in Index Fungorum (2020) (accessed 2 January 2020). However, Kirk et al. (2008) estimated approximately 110 species, but most of them lack herbarium materials, ex-type cultures and DNA sequence data.

Species identification criteria of Cytospora were previously carried out by the host-based method and morphology in China; however, these bases are unreliable due to the uninformative illustrations and descriptions, weak host specificity and overlapping morphological characteristics (Teng 1963, Tai 1979, Wei 1979). Recent studies have been able to use multiphase approaches to solve the taxonomy of Cytospora (Fan et al. 2014a, b, 2015a, b, Yang et al. 2015, Lawrence et al. 2016, Norphanphoun et al. 2017, Pan et al. 2018, Zhu et al. 2018a, Zhang et al. 2019). Fan et al. (2020) summarised 52 species of Cytospora associated with canker and dieback disease in China, using a six gene matrix (ITS, LSU, act, rpb2, tef1-α and tub2), of which 13 species were newly introduced.

Mount Dongling has high plant diversity in western Beijing, including more than 1,000 tree hosts (Ma et al. 1995). As more plant species were recorded in this region, the exploration of fungal diversity gradually increased as most fungi are often linked to particular host plants as pathogens or endophytes. Species of Alternaria, Diaporthe, Leptostroma, Pestalotiopsis and Phoma were the most commonly isolated endophytes from Pinus tabuliformis and later, an additional 38 endophytic taxa were identified from Acer truncatum from Mount Dongling (Guo et al. 2008, Sun et al. 2011). Further, pathogens belonging in Botryosphaeriales have been identified from Mount Dongling, including five species from Aplosporella, Botryosphaeria and Phaeobotryon (Zhu et al. 2018b). Zhu et al. (2019) subsequently introduced six species of diaporthalean fungi residing in four families (viz. Diaporthaceae, Erythrogloeaceae, Juglanconidaceae and Melanconidaceae) from Mount Dongling. For the current understanding, many common host plants represent high fungal diversity causing canker and dieback disease in Mount Dongling. Juglans mandshurica and J. regia (Juglandaceae) were infected by Botryosphaeria dothidea (Botryosphaeriaceae), Diaporthe eres, D. rostrata (Diaporthaceae) and Juglanconis oblonga (Juglanconidaceae). Rhus typhina (Anacardiaceae) was infected by Aplosporella ginkgonis, A. javeedii (Aplosporellaceae), Phaeobotryon rhois and P. rhoinum (Botryosphaeriaceae). Quercus mongolica (Fagaceae) was infected by Dendrostoma donglinensis (Erythrogloeaceae) (Zhu et al. 2018b, 2019).

During the course of cognitive practices to investigate forest pathogens that cause canker or dieback disease in Mount Dongling of China, seven Cytospora strains were obtained from six unrelated hosts, i.e. Corylus mandshurica (Betulaceae), Juglans mandshurica (Juglandaceae), Prunus sibirica, Spiraea salicifolia (Rosaceae), Tilia nobilis (Tiliaceae) and Ulmus pumila (Ulmaceae). Phylogenetic analyses inferred from combined ITS, LSU, act, rpb2, tef1-α and tub2 gene regions were conducted to provide a multi-gene phylogeny for Cytospora, based on a large set of freshly collected specimens in Mount Dongling of China. Thus, the current study aims to clarify the systematics and taxonomy of Cytospora species with detailed descriptions and illustrations and compare it to known species in the genus.

 Materials and methods Sampling and isolation

Seven infected branches of six hosts were collected from Mount Dongling of China (Table 1). Sampled trees expressed general symptoms and signs of canker diseases including elongate, slightly sunken and discoloured areas in the bark, several prominent dark sporocarps immersed in bark, erumpent through the surface of bark when mature (Fig. 1). A total of seven isolates was established by removing a mucoid spore mass from conidiomata or ascomata of fresh material, spreading the suspension on the surface of 1.8 % potato dextrose agar (PDA) and incubating at 25 °C for up to 24 h. Single germinating spores were transferred on to fresh PDA plates. Specimens and isolates were deposited in the Key Laboratory for Silviculture and Conservation of the Ministry of Education in Beijing Forestry University (BJFU) and at the working Collection of X.L. Fan (CF), housed at the BJFU. Axenic cultures are maintained in the China Forestry Culture Collection Centre (CFCC).

Isolates and GenBank accession numbers used in the phylogenetic analyses of Cytospora.

Species Strain1 Host Origin GenBank accession numbers
ITS LSU act rpb2 tef1-α tub2
Cytospora ailanthicola CFCC 89970T Ailanthus altissima Ningxia, China MH933618 MH933653 MH933526 MH933592 MH933494 MH933565
Cytospora ampulliformis MFLUCC 16-0583T Sorbus intermedia Russia KY417726 KY417760 KY417692 KY417794 NA NA
MFLUCC 16-0629 Acer platanoides Russia KY417727 KY417761 KY417693 KY417795 NA NA
Cytospora amygdali CBS 144233T Prunus dulcis California, USA MG971853 NA MG972002 NA MG971659 MG971718
Cytospora atrocirrhata CFCC 89615 Juglans regia Qinghai, China KR045618 KR045700 KF498673 KU710946 KP310858 KR045659
CFCC 89616 Juglans regia Qinghai, China KR045619 KR045701 KF498674 KU710947 KP310859 KR045660
Cytospora beilinensis CFCC 50493T Pinus armandii Beijing, China MH933619 MH933654 MH933527 NA MH933495 MH933561
CFCC 50494 Pinus armandii Beijing, China MH933620 MH933655 MH933528 NA MH933496 MH933562
Cytospora berberidis CFCC 89927T Berberis dasystachya Qinghai, China KR045620 KR045702 KU710990 KU710948 KU710913 KR045661
CFCC 89933 Berberis dasystachya Qinghai, China KR045621 KR045703 KU710991 KU710949 KU710914 KR045662
Cytospora bungeana CFCC 50495T Pinus bungeana Shanxi, China MH933621 MH933656 MH933529 MH933593 MH933497 MH933563
CFCC 50496 Pinus bungeana Shanxi, China MH933622 MH933657 MH933530 MH933594 MH933498 MH933564
Cytospora californica CBS 144234T Juglans regia California, USA MG971935 NA MG972083 NA MG971645 NA
Cytospora carbonacea CFCC 89947 Ulmus pumila Qinghai, China KR045622 KP310812 KP310842 KU710950 KP310855 KP310825
Cytospora carpobroti CMW 48981T Carpobrotus edulis South Africa MH382812 MH411216 NA NA MH411212 MH411207
Cytospora celtidicola CFCC 50497T Celtis sinensis Anhui, China MH933623 MH933658 MH933531 MH933595 MH933499 MH933566
CFCC 50498 Celtis sinensis Anhui, China MH933624 MH933659 MH933532 MH933596 MH933500 MH933567
Cytospora centrivillosa MFLUCC 16-1206T Sorbus domestica Italy MF190122 MF190068 NA MF377600 NA NA
MFLUCC 17-1660 Sorbus domestica Italy MF190123 MF190069 NA MF377601 NA NA
Cytospora ceratosperma CFCC 89624 Juglans regia Gansu, China KR045645 KR045724 NA KU710976 KP310860 KR045686
CFCC 89625 Juglans regia Gansu, China KR045646 KR045725 NA KU710977 KP31086 KR045687
Cytospora ceratospermopsis CFCC 89626T Juglans regia Shaanxi, China KR045647 KR045726 KU711011 KU710978 KU710934 KR045688
CFCC 89627 Juglans regia Shaanxi, China KR045648 KR045727 KU711012 KU710979 KU710935 KR045689
Cytospora chrysosperma CFCC 89629 Salix psammophila Shaanxi, China KF765673 KF765689 NA KF765705 NA NA
CFCC 89981 Populus alba subsp. pyramidalis Gansu, China MH933625 MH933660 MH933533 MH933597 MH933501 MH933568
CFCC 89982 Ulmus pumila Tibet, China KP281261 KP310805 KP310835 NA KP310848 KP310818
Cytospora coryli CFCC 53162T Corylus mandshurica Beijing, China MN854450 MN854661 NA MN850751 MN850758 MN861120
Cytospora cotini MFLUCC 14-1050T Cotinus coggygria Russia KX430142 KX430143 NA KX430144 NA NA
Cytospora curvata MFLUCC 15-0865T Salix alba Russia KY417728 KY417762 KY417694 KY417796 NA NA
Cytospora davidiana CXY 1350T Populus davidiana Inner Mongolia, China KM034870 NA NA NA NA NA
CXY 1374 Populus davidiana Heilongjiang, China KM034869 NA NA NA NA NA
Cytospora elaeagni CFCC 89632 Elaeagnus angustifolia Ningxia, China KR045626 KR045706 KU710995 KU710955 KU710918 KR045667
CFCC 89633 Elaeagnus angustifolia Ningxia, China KF765677 KF765693 KU710996 KU710956 KU710919 KR045668
Cytospora elaeagnicola CFCC 52882 Elaeagnus angustifolia Xinjiang, China MK732341 MK732338 MK732344 MK732347 NA NA
CFCC 52883 Elaeagnus angustifolia Xinjiang, China MK732342 MK732339 MK732345 MK732348 NA NA
CFCC 52884 Elaeagnus angustifolia Xinjiang, China MK732343 MK732340 MK732346 MK732349 NA NA
Cytospora erumpens CFCC 50022 Prunus padus Shanxi, China MH933627 MH933661 MH933534 NA MH933502 MH933569
MFLUCC 16-0580T Salix × fragilis Russia KY417733 KY417767 KY417699 KY417801 NA NA
Cytospora eucalypti CBS 144241 Eucalyptus globulus California, USA MG971907 NA MG972056 NA MG971617 MG971772
Cytospora euonymicola CFCC 50499T Euonymus kiautschovicus Shaanxi, China MH933628 MH933662 MH933535 MH933598 MH933503 MH933570
CFCC 50500 Euonymus kiautschovicus Shaanxi, China MH933629 MH933663 MH933536 MH933599 MH933504 MH933571
Cytospora euonymina CFCC 89993T Euonymus kiautschovicus Shanxi, China MH933630 MH933664 MH933537 MH933600 MH933505 MH933590
CFCC 89999 Euonymus kiautschovicus Shanxi, China MH933631 MH933665 MH933538 MH933601 MH933506 MH933591
Cytospora fraxinigena MFLUCC 14-0868T Fraxinus ornus Italy MF190133 MF190078 NA NA NA NA
MFLU 17–0880 Fraxinus ornus Italy MF190134 MF190079 NA NA NA NA
Cytospora fugax CXY 1371 NA NA KM034852 NA NA NA NA KM034891
CXY 1381 NA NA KM034853 NA NA NA NA KM034890
Cytospora gigalocus CFCC 89620T Juglans regia Qinghai, China KR045628 KR045708 KU710997 KU710957 KU710920 KR045669
CFCC 89621 Juglans regia Qinghai, China KR045629 KR045709 KU710998 KU710958 KU710921 KR045670
Cytospora gigaspora CFCC 50014 Juniperus procumbens Shanxi, China KR045630 KR045710 KU710999. KU710959 KU710922 KR045671
CFCC 89634T Salix psammophila Shaanxi, China KF765671 KF765687 KU711000 KU710960 KU710923 KR045672
Cytospora granati CBS 144237T Punica granatum California, USA MG971799 NA MG971949 NA MG971514 MG971664
Cytospora hippophaës CFCC 89639 Hippophaë rhamnoides Gansu, China KR045632 KR045712 KU711001 KU710961 KU710924 KR045673
CFCC 89640 Hippophaë rhamnoides Gansu, China KF765682 KF765698 KF765730 KU710962 KP310865 KR045674
Cytospora japonica CFCC 89956 Prunus cerasifera Ningxia, China KR045624 KR045704 KU710993 KU710953 KU710916 KR045665
CFCC 89960 Prunus cerasifera Ningxia, China KR045625 KR045705 KU710994 KU710954 KU710917 KR045666
Cytospora joaquinensis CBS 144235T Populus deltoides California, USA MG971895 NA MG972044 NA MG971605 MG971761
Cytospora junipericola BBH 42444 Juniperus communis Italy MF190126 MF190071 NA NA MF377579 NA
Cytospora junipericola MFLU 17-0882T Juniperus communis Italy MF190125 MF190072 NA NA MF377580 NA
Cytospora juniperina CFCC 50501T Juniperus przewalskii Sichuan, China MH933632 MH933666 MH933539 MH933602 MH933507 NA
CFCC 50502 Juniperus przewalskii Sichuan, China MH933633 MH933667 MH933540 MH933603 MH933508 MH933572
CFCC 50503 Juniperus przewalskii Sichuan, China MH933634 MH933668 MH933541 MH933604 MH933509 NA
Cytospora kantschavelii CXY 1383 Populus maximowiczii Jilin, China KM034867 NA NA NA NA NA
CXY 1386 Populus maximowiczii Chongqing, China KM034867 NA NA NA NA NA
Cytospora leucosperma CFCC 89622 Pyrus bretschneideri Gansu, China KR045616 KR045698 KU710988 KU710944 KU710911 KR045657
CFCC 89894 Pyrus bretschneideri Qinghai, China KR045617 KR045699 KU710989 KU710945 KU710912 KR045658
Cytospora leucostoma CFCC 50015 Sorbus aucuparia Ningxia, China KR045634 KR045714 KU711002 NA KU710925 KR045675
CFCC 50016 Sorbus aucuparia Ningxia, China MH820400 MH820393 MH820408 NA MH820404 MH820389
CFCC 50017 Prunus cerasifera Ningxia, China MH933635 MH933669 MH933542 NA MH933510 MH933573
CFCC 50018 Prunus serrulata Gansu, China MH933636 MH933670 MH933543 NA MH933511 MH933574
CFCC 50019 Rosa helenae Gansu, China MH933637 MH933671 MH933544 NA NA NA
CFCC 50020 Prunus persica Gansu, China MH933638 MH933672 MH933545 NA NA NA
CFCC 50021 Prunus salicina Gansu, China MH933639 MH933673 MH933546 NA MH933512 MH933575
CFCC 50023 Cornus alba Shanxi, China KR045635 KR045715 KU711003 KU710964 KU710926 KR045676
CFCC 50024 Prunus pseudocerasus Qinghai, China MH933640 MH933674 MH933547 MH933605 NA MH933576
CFCC 50467 Betula platyphylla Beijing, China KT732948 KT732967 NA NA NA NA
CFCC 50468 Betula platyphylla Beijing, China KT732949 KT732968 NA NA NA NA
CFCC 53140 Prunus sibirica Beijing, China MN854445 MN854656 MN850760 MN850746 MN850753 MN861115
CFCC 53141 Prunus sibirica Beijing, China MN854446 MN854657 MN850761 MN850747 MN850754 MN861116
CFCC 53156 Juglans mandshurica Beijing, China MN854447 MN854658 MN850762 MN850748 MN850755 MN861117
MFLUCC 16-0574 Rosa sp. Russia KY417731 KY417764 KY417696 KY417798 NA NA
MFLUCC 16-0589 Salix alba Russia KY417732 KY417766 KY417698 KY417800 NA NA
Cytospora longiostiolata MFLUCC 16-0628T Salix × fragilis Russia KY417734 KY417768 KY417700 KY417802 NA NA
Cytospora longispora CBS 144236T Prunus domestica California, USA MG971905 NA MG972054 NA MG971615 MG971764
Cytospora lumnitzericola MFLUCC 17-0508T Lumnitzera racernosa Tailand MG975778 MH253461 MH253457 MH253453 NA NA
Cytospora mali CFCC 50028 Malus pumila Gansu, China MH933641 MH933675 MH933548 MH933606 MH933513 MH933577
CFCC 50029 Malus pumila Ningxia, China MH933642 MH933676 MH933549 MH933607 MH933514 MH933578
CFCC 50030 Malus pumila Shaanxi, China MH933643 MH933677 MH933550 MH933608 MH933524 MH933579
CFCC 50031 Crataegus sp. Shanxi, China KR045636 KR045716 KU711004 KU710965 KU710927 KR045677
CFCC 50044 Malus baccata Qinghai, China KR045637 KR045717 KU711005 KU710966 KU710928 KR045678
Cytospora melnikii CFCC 89984 Rhus typhina Xinjiang, China MH933644 MH933678 MH933551 MH933609 MH933515 MH933580
MFLUCC 15-0851T Malus domestica Russia KY417735 KY417769 KY417701 KY417803 NA NA
MFLUCC 16-0635 Populus nigra var. italica Russia KY417736 KY417770 KY417702 KY417804 NA NA
Cytospora nivea MFLUCC 15-0860 Salix acutifolia Russia KY417737 KY417771 KY417703 KY417805 NA NA
CFCC 89641 Elaeagnus angustifolia Ningxia, China KF765683 KF765699 KU711006 KU710967 KU710929 KR045679
CFCC 89643 Salix psammophila Shaanxi, China KF765685 KF765701 NA KU710968 KP310863 KP310829
Cytospora oleicola CBS 144248T Olea europaea California, USA MG971944 NA MG972098 NA MG971660 MG971752
Cytospora palm CXY 1276 Cotinus coggygria Beijing, China JN402990 NA NA NA KJ781296 NA
CXY 1280T Cotinus coggygria Beijing, China JN411939 NA NA NA KJ781297 NA
Cytospora parakantschavelii MFLUCC 15-0857T Populus × sibirica Russia KY417738 KY417772 KY417704 KY417806 NA NA
MFLUCC 16-0575 Pyrus pyraster Russia KY417739 KY417773 KY417705 KY417807 NA NA
Cytospora parapistaciae CBS 144506T Pistacia vera California, USA MG971804 NA MG971954 NA MG971519 MG971669
Cytospora parasitica MFLUCC 15-0507T Malus domestica Russia KY417740 KY417774 KY417706 KY417808 NA NA
XJAU 2542-1 Malus sp. Xinjiang, China MH798884 MH798897 NA NA MH813452 NA
Cytospora paratranslucens MFLUCC 15-0506T Populus alba var. bolleana Russia KY417741 KY417775 KY417707 KY417809 NA NA
MFLUCC 16-0627 Populus alba Russia KY417742 KY417776 KY417708 KY417810 NA NA
Cytospora pistaciae CBS 144238T Pistacia vera California, USA MG971802 NA MG971952 NA MG971517 MG971667
Cytospora platanicola MFLU 17-0327T Platanus hybrida Italy MH253451 MH253452 MH253449 MH253450 NA NA
Cytospora platyclada CFCC 50504T Platycladus orientalis Yunnan, China MH933645 MH933679 MH933552 MH933610 MH933516 MH933581
CFCC 50505 Platycladus orientalis Yunnan, China MH933646 MH933680 MH933553 MH933611 MH933517 MH933582
CFCC 50506 Platycladus orientalis Yunnan, China MH933647 MH933681 MH933554 MH933612 MH933518 MH933583
Cytospora platycladicola CFCC 50038T Platycladus orientalis Gansu, China KT222840 MH933682 MH933555 MH933613 MH933519 MH933584
CFCC 50039 Platycladus orientalis Gansu, China KR045642 KR045721 KU711008 KU710973 KU710931 KR045683
Cytospora plurivora CBS 144239T Olea europaea California, USA MG971861 NA MG972010 NA MG971572 MG971726
Cytospora populicola CBS 144240T Populus deltoides California, USA MG971891 NA MG972040 NA MG971601 MG971757
Cytospora populina CFCC 89644T Salix psammophila Shaanxi, China KF765686 KF765702 KU711007 KU710969 KU710930 KR045681
Cytospora populinopsis CFCC 50032T Sorbus aucuparia Ningxia, China MH933648 MH933683 MH933556 MH933614 MH933520 MH933585
CFCC 50033 Sorbus aucuparia Ningxia, China MH933649 MH933684 MH933557 MH933615 MH933521 MH933586
Cytospora pruinopsis CFCC 50034T Ulmus pumila Shaanxi, China KP281259 KP310806 KP310836 KU710970 KP310849 KP310819
CFCC 50035 Ulmus pumila Jilin, China KP281260 KP310807 KP310837 KU710971 KP310850 KP310820
CFCC 53153 Ulmus pumila Beijing, China MN854451 MN854662 MN850763 MN850752 MN850759 MN861121
Cytospora predappioensis MFLUCC 17-2458T Platanus hybrida Italy MG873484 MG873480 NA NA NA NA
Cytospora pruinosa CFCC 50036 Syringa oblata Qinghai, China KP310800 KP310802 KP310832 NA KP310845 KP310815
CFCC 50037 Syringa oblata Qinghai, China MH933650 MH933685 MH933558 NA MH933522 MH933589
Cytospora prunicola MFLU 17-0995T Prunus sp. Italy MG742350 MG742351 MG742353 MG742352 NA NA
Cytospora punicae CBS 144244 Punica granatum California, USA MG971943 NA MG972091 NA MG971654 MG971798
Cytospora quercicola MFLU 17-0881 Quercus sp. Italy MF190128 MF190074 NA NA NA NA
MFLUCC 14-0867T Quercus sp. Italy MF190129 MF190073 NA NA NA NA
Cytospora ribis CFCC 50026 Ulmus pumila Qinghai, China KP281267 KP310813 KP310843 KU710972 KP310856 KP310826
CFCC 50027 Ulmus pumila Qinghai, China KP281268 KP310814 KP310844 NA KP310857 KP310827
Cytospora rosae MFLU 17-0885 Rosa canina Italy MF190131 MF190076 NA NA NA NA
Cytospora rostrata CFCC 89909T Salix cupularis Gansu, China KR045643 KR045722 KU711009 KU710974 KU710932 KR045684
CFCC 89910 Salix cupularis Gansu, China KR045644 KR045723 KU711010 KU710975 KU710933 NA
Cytospora rusanovii MFLUCC 15-0853 Populus × sibirica Russia KY417743 KY417777 KY417709 KY417811 NA NA
MFLUCC 15-0854T Salix babylonica Russia KY417744 KY417778 KY417710 KY417812 NA NA
Cytospora salicacearum MFLUCC 15-0861 Salix × fragilis Russia KY417745 KY417779 KY417711 KY417813 NA NA
MFLUCC 15-0509T Salix alba Russia KY417746 KY417780 KY417712 KY417814 NA NA
MFLUCC 16-0576 Populus nigra var. italica Russia KY417741 KY417775 KY417707 KY417809 NA NA
MFLUCC 16-0587 Prunus cerasus Russia KY417742 KY417776 KY417708 KY417810 NA NA
Cytospora salicicola MFLUCC 15-0866 Salix alba Russia KY417749 KY417783 KY417715 KY417817 NA NA
MFLUCC 14-1052T Salix alba Russia KU982636 KU982635 KU982637 NA NA NA
Cytospora salicina MFLUCC 15-0862T Salix alba Russia KY417750 KY417784 KY417716 KY417818 NA NA
MFLUCC 16-0637 Salix × fragilis Russia KY417751 KY417785 KY417717 KY417819 NA NA
Cytospora schulzeri CFCC 50040 Malus domestica Ningxia, China KR045649 KR045728 KU711013 KU710980 KU710936 KR045690
CFCC 50042 Malus asiatica Qinghai, China KR045650 KR045729 KU711014 KU710981 KU710937 KR045691
Cytospora sibiraeae CFCC 50045T Sibiraea angustata Gansu, China KR045651 KR045730 KU711015 KU710982 KU710938 KR045692
CFCC 50046 Sibiraea angustata Gansu, China KR045652 KR045731 KU711015 KU710983 KU710939 KR045693
Cytospora sophorae CFCC 50047 Styphnolobium japonicum Shanxi, China KR045653 KR045732 KU711017 KU710984 KU710940 KR045694
CFCC 50048 Magnolia grandiflora Shanxi, China MH820401 MH820394 MH820409 MH820397 MH820405 MH820390
CFCC 89598 Styphnolobium japonicum Gansu, China KR045654 KR045733 KU711018 KU710985 KU710941 KR045695
Cytospora sophoricola CFCC 89595T Styphnolobium japonicum var. pendula Gansu, China KR045655 KR045734 KU711019 KU710986 KU710942 KR045696
CFCC 89596 Styphnolobium japonicum var. pendula Gansu, China KR045656 KR045735 KU711020 KU710987 KU710943 KR045697
Cytospora sophoriopsis CFCC 89600T Styphnolobium japonicum Gansu, China KR045623 KP310804 KU710992 KU710951 KU710915 KP310817
Cytospora sorbi MFLUCC 16-0631T Sorbus aucuparia Russia KY417752 KY417786 KY417718 KY417820 NA NA
Cytospora sorbicola MFLUCC 16-0584T Acer pseudoplatanus Russia KY417755 KY417789 KY417721 KY417823 NA NA
MFLUCC 16-0633 Cotoneaster melanocarpus Russia KY417758 KY417792 KY417724 KY417826 NA NA
Cytospora spiraeae CFCC 50049T Spiraea salicifolia Gansu, China MG707859 MG707643 MG708196 MG708199 NA NA
CFCC 50050 Spiraea salicifolia Gansu, China MG707860 MG707644 MG708197 MG708200 NA NA
Cytospora spiraeicola CFCC 53138T Spiraea salicifolia Beijing, China MN854448 MN854659 NA MN850749 MN850756 MN861118
CFCC 53139 Tilia nobilis Beijing, China MN854449 MN854660 NA MN850750 MN850757 MN861119
Cytospora tamaricicola CFCC 50507 Rosa multifolora Yunnan, China MH933651 MH933686 MH933559 MH933616 MH933525 MH933587
CFCC 50508T Tamarix chinensis Yunnan, China MH933652 MH933687 MH933560 MH933617 MH933523 MH933588
Cytospora tanaitica MFLUCC 14-1057T Betula pubescens Russia KT459411 KT459412 KT459413 NA NA NA
Cytospora thailandica MFLUCC 17-0262T Xylocarpus moluccensis Thailand MG975776 MH253463 MH253459 MH253455 NA NA
MFLUCC 17-0263T Xylocarpus moluccensis Thailand MG975777 MH253464 MH253460 MH253456 NA NA
Cytospora tibouchinae CPC 26333T Tibouchina semidecandra France KX228284 KX228335 NA NA NA NA
Cytospora translucens CXY 1351 Populus davidiana Inner Mongolia, China KM034874 NA NA NA NA KM034895
Cytospora ulmi MFLUCC 15-0863T Ulmus minor Russia KY417759 NA NA NA NA NA
Cytospora vinacea CBS 141585T Vitis interspecific hybrid ‘Vidal’ USA KX256256 NA NA NA KX256277 KX256235
Cytospora viticola CBS 141586T Vitis vinifera ‘Cabernet Franc’ USA KX256239 NA NA NA KX256260 KX256218
Cytospora xylocarpi MFLUCC 17-0251T Xylocarpus granatum Thailand MG975775 MH253462 MH253458 MH253454 NA NA
Diaporthe vaccinii CBS 160.32 Vaccinium macrocarpon USA KC343228 NA JQ807297 NA KC343954 KC344196

Abbreviations: BBH: BIOTEC Bangkok Herbarium, National Science and Technology Development Agency, Thailand; CBS: Westerdijk Fungal Biodiversity Institute (CBS-KNAW Fungal Biodiversity Centre), Utrecht, The Netherlands; CFCC: China Forestry Culture Collection Centre, Beijing, China; CMW: Culture collection of Michael Wingfield, university of Pretoria, South africa; CPC: Culture collection of Pedro Crous, The Netherlands; MFLU: Mae Fah Luang University herbarium, Thailand; MFLUCC: Mae Fah Luang University Culture Collection, Thailand; XJAU: Xinjiang Agricultural University, Xinjiang, China; NA: not applicable. All the new isolates used in this study are indicated in bold type and the strains from generic type species are marked by a superscript (T).

 10.3897/mycokeys.62.47854.figure1 3661752 097DC130-7A5C-5882-A31A-7CE6572FE104

Disease symptoms associated with Cytospora species. ACorylus mandshuricaBSpiraea salicifoliaCUlmus pumilaDPrunus sibirica.

https://binary.pensoft.net/fig/375793 Morphological analysis

Species identification was based on morphological features of the ascomata or conidiomata from infected host materials and micromorphology, supplemented by cultural characteristics. Microscopic photographs (structure and size of stromata; structure and size of ectostromatic disc and ostioles) were captured using a Leica stereomicroscope (M205 FA) (Leica Microsystems, Wetzlar, Germany). Microscopic observations (shape and size of conidiophores, asci and conidia/ascospores) were determined under a Nikon Eclipse 80i microscope (Nikon Corporation, Tokyo, Japan), equipped with a Nikon digital sight DS-Ri2 high definition colour camera, using differential interference contrast (DIC) illumination. The Nikon software NIS-Elements D Package v. 3.00, Adobe Bridge CS v. 6 and Adobe Photoshop CS v. 5 were used for the manual editing. More than 10 conidiomata/ascomata, 10 asci and 30 conidia/ascospores were measured by Nikon software NIS-Elements D Package v. 3.00 to calculate the mean size/length and respective standard deviations (SD). Colony diameters were measured and the colony features were described using the colour charts of Rayner (1970).

 DNA extraction, PCR amplification and sequencing

Fungal mycelium grown on the cellophane of PDA was scraped for the extraction of genomic DNA following a modified CTAB method (Doyle and Doyle 1990). The primers and PCR conditions are listed in Table 2. DNA sequencing was performed using an ABI PRISM 3730XL DNA Analyser with a BigDye Terminater Kit v.3.1 (Invitrogen, USA) at the Shanghai Invitrogen Biological Technology Company Limited (Beijing, China). The DNA sequences, obtained from forward and reverse primers, were combined using SeqMan v. 7.1.0 in the DNASTAR Lasergene Core Suite software (DNASTAR Inc., Madison, WI, USA).

Genes used in this study with PCR primers, primer DNA sequence, optimal annealing temperature and corresponding references.

Locus Definition Primers Primer DNA sequence (5'–3') Optimal annealing temp (°C) References of primers used
ITS internal transcribed spacer of ribosomal RNA ITS1 TCCGTAGGTGAACCTGCGG 51 White et al. 1990
ITS4 TCCTCCGCTTTTGATATGC
LSU large subunit of ribosomal RNA LROR ACCCGCTGAACTTAAGC 55 Vilgalys and Hester 1990
LR7 TACTACCACCAAGATCT
act actin ACT-512F ATGTGCAAGGCCGGTTTCGC 61 Carbone and Kohn 1999
ACT-783R TACGAGTCCTTCTGGCCCAT
rpb2 RNA polymerase II second largest subunit RPB2-5F GA(T/C)GA(T/C)(A/C)G(A/T)GATCA(T/C)TT(T/C)GG 52 Liu et al. 1999
RPB2-7cR CCCAT(A/G)GCTTG(T/C)TT(A/G)CCCAT
tef-1α translation elongation factor 1-alpha EF1-668F CGGTCACTTGATCTACAAGTGC 55 Alves et al. 2008
EF1-1251R CCTCGAACTCACCAGTACCG
tub2 beta-tubulin Bt2a GGTAACCAAATCGGTGCTGCTTTG 55 Glass and Donaldson 1995
Bt2b ACCCTCAGTGTAGTGACCCTTGGC
Phylogenetic analyses

The current isolates were initially identified as Cytospora species, based on both morphological observations and BLAST results. To clarify their further phylogenetic position, an analysis, based on the combined six genes (ITS, LSU, act, rpb2, tef1-α and tub2), was performed to compare Cytospora species from the current study with other strains in GenBank. Diaporthe vaccinii was selected as the outgroup in all analyses. Subsequent alignments for each gene were generated using MAFFT v.7 (Katoh and Standley 2013) and manually adjusted using MEGA v. 6 (Tamura et al. 2013). Ambiguously aligned sequences were excluded from analysis. Reference sequences were selected, based on ex-type or ex-epitype sequences available from recently published literature (Fan et al. 2014a, b, 2015a, b, 2020, Yang et al. 2015, Lawrence et al. 2016, Norphanphoun et al. 2017, Zhu et al. 2018a, Zhang et al. 2019, Fan et al. 2020) (Table 1). Phylogenetic analyses were performed with PAUP v.4.0b10 for the maximum parsimony (MP) method (Swofford 2003), MrBayes v.3.1.2 for the Bayesian Inference (BI) method (Ronquist and Huelsenbeck 2003) and RAxML for the maximum likelihood (ML) method (Stamatakis 2006).

A partition homogeneity test (PHT) with heuristic search and 1,000 replicates was performed using PAUP v.4.0b10 to test the discrepancy amongst the ITS, LSU, act, rpb2, tef1-α and tub2 sequence datasets in reconstructing phylogenetic trees. MP analysis was performed using a heuristic search option of 1,000 random-addition sequences with a tree bisection and reconnection (TBR) branch swapping algorithm (Swofford 2003). The branches of zero length were collapsed and all equally parsimonious trees were saved. Clade stability was assessed with a bootstrap analysis of 1,000 replicates (Hillis and Bull 1993). Other parsimony scores, such as tree length (TL), consistency index (CI), retention index (RI) and rescaled consistency (RC), were calculated (Swofford 2003). ML analysis was performed with the GTR + G + I model of site substitution following recent studies (Zhu et al. 2018a), including estimation of gamma-distributed rate heterogeneity and a proportion of invariant sites using PhyML v. 3.0 (Guindon et al. 2010). The branch support was evaluated with a bootstrapping method of 1,000 replicates (Hillis and Bull 1993). BI analysis was performed using a Markov Chain Monte Carlo (MCMC) algorithm with Bayesian posterior probabilities (Rannala and Yang 1996). A nucleotide substitution model was estimated by MrModeltest v.2.3 (Posada and Crandall 1998) and a weighted Bayesian analysis was considered. Two MCMC chains were run from random trees for 1,000,000 generations and trees were sampled each 100 generations. The first 25% of trees were discarded as the burn-in phase of each analysis and the posterior probabilities (BPP) were calculated to assess the remaining trees (Rannala and Yang 1996). The branch support from MP and ML analysis was evaluated with a bootstrapping (BS) method of 1,000 replicates (Hillis and Bull 1993). Phylograms were plotted in Figtree v. 1.4.4 (http://tree.bio.ed.ac.uk/software/figtree) and edited in Adobe Illustrator CS6 v.16.0.0 (https://www.adobe.com/cn/products/illustrator.html). Novel sequences, generated in the current study, were deposited in GenBank (Table 1) and the aligned matrices, used for phylogenetic analyses, were submitted in TreeBASE (www.treebase.org; study ID S25564).

 Results Phylogenetic analyses

A combined matrix of six gene sequences of Cytospora was considered. The combined alignments matrix (ITS, LSU, act, rpb2, tef1-α and tub2) included 172 accessions (seven from this study and 165 retrieved from GenBank) and counted 3,652 characters including gaps (665 characters for ITS, 525 for LSU, 337 for act, 730 for rpb2, 771 for tef1-α and 624 for tub2), of which 2,067 characters were constant, 189 variable characters were parsimony-uninformative and 1,396 (38.22%) characters were variable and parsimony-informative. The MP analysis generated 100 parsimonious trees, the first tree of which is presented in Fig. 2 (TL = 8,029, CI = 0.345, RI = 0.804, RC = 0.278). Tree topologies of ML and BI analyses were similar to the MP tree. Based on the multi-locus phylogeny and morphology, seven strains were assigned to four species within Cytospora coryli, C. leucostoma, C. pruinopsis and C. spiraeicola, including two taxa which we describe here as new. The two isolates of C. spiraeicola formed a distinct and strongly supported clade (MP/ML/BI = 100/100/1) with close phylogenetic affinity to C. elaeagnicola and C. spiraeae. The strain of C. coryli from Corylus mandshurica shared a close relationship to Cytospora euonymicola and C. gigalocus with 100% MP, 99% ML, 0.99 BI supports.

10.3897/mycokeys.62.47854.figure2 3661764 3E7522DB-9BE2-5B76-92D8-04BA645C3AB5

Phylogram of Cytospora, based on combined ITS, LSU, act, rpb2, tef1-α and tub2 genes. The MP and ML bootstrap support values above 50% are shown at the first and second positions, respectively. Thickened branches represent posterior probabilities above 0.95 from the BI. Ex-type strains are in bold. Strains from the current study are in blue.

https://binary.pensoft.net/fig/375794 Taxonomy Fungi Diaporthales Valsaceae C0298731-0C80-5D50-9972-3FA962BB480F Cytospora coryli 833820 H.Y. Zhu & X.L. Fan sp. nov. Fig. 3 Etymology.

Named after the host genus on which it was collected, Corylus.

 Holotype.

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°27'07.00"E, 39°59'26.47"N), from branches of Corylus mandshurica, 17 Aug 2017, H.Y. Zhu & X.L. Fan, holotype CF 2019813, ex-type living culture CFCC 53162.

 Description.

Necrotrophic on branches of Corylus mandshurica. Sexual morph: not observed. Asexual morph: Conidiomata pycnidial, flat, immersed in the bark, scattered to gregarious, erumpent through the surface of bark, surrounded by conspicuous black stroma walls in the margin, with multiple locules. Conceptacle absent. Ectostromatic disc grey to black, discoid, circular to ovoid, 270–340 µm in diam., with one ostiole per disc. Ostiole grey to black, at the same or above level as the disc surface, inconspicuous. Locules numerous, subdivided frequently by invaginations with common walls, circular to irregular, 1550–1710 µm in diam. Conidiophores hyaline, branched at the base, in the middle, approximately cylindrical with the top end acute, 15.5–18.5 × 1–2 (av. = 17 ± 1.2 × 1.1 ± 0.2, n = 10) µm, sometimes reduced to conidiogenous cells. Conidiogenous cells enteroblastic, phialidic, sub-cylindrical to cylindrical, 7.5–14 × 1–2 (av. = 9.3 ± 1.7 × 1.4 ± 0.2, n = 10) μm. Conidia hyaline, allantoid, smooth, aseptate, thin-walled, 5–7 × 1–2 (av. = 5.6 ± 0.5 × 1.4 ± 0.2, n = 30) μm.

10.3897/mycokeys.62.47854.figure3 3661754 E08F928B-3927-5B2F-AF37-DE4ED8D3161A

Cytospora coryli from Corylus mandshurica (CF 2019813). A, B habit of conidiomata on twig C transverse section of conidioma D longitudinal section through conidioma E conidiophores and conidiogenous cells F conidia G colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A); 500 μm (B–D); 10 μm (E, F).

https://binary.pensoft.net/fig/375795 Culture characteristics.

Cultures are initially white with hazel at the centre, growing fast up 9 cm in diam. after 3 days, becoming honey to hazel from the edge to centre after 7–10 days. In reverse, the cultures are the same as the upper colour after 3 days, becoming cinnamon from the edge to centre after 7–10 days. Colonies are flat, sparse at the centre and compact to the margin. Pycnidia distributed radially on colony surface.

 Habitat and distribution.

Known from Corylus mandshurica in Mount Dongling, China.

 Notes.

Cytospora coryli is associated with canker disease of Corylus mandshurica in China. The only strain CFCC 53162 representing Cytospora coryli clusters as a single lineage and appears mostly related to C. euonymicola from Euonymus kiautschovicus and to Cytospora gigalocus from Juglans regia (Fan et al. 2015a, 2020) (Fig. 2). Cytospora coryli differs from C. euonymicola by its larger locules (1550–1710 vs. 1150–1400 µm) and larger conidia (5–7 × 1–2 vs. 4.5–5 × 1 μm) (Fan et al. 2020), C. coryli differs from C. gigalocus by its smaller locules (1550–1710 vs. 1630–2180 µm) with single ostiole (one to five ostioles in C. gigalocus) and the larger size of conidia (5–7 × 1–2 vs. 4.6–5.6 × 0.8–1.3 μm) (Fan et al. 2015a). Based on morphology and sequence data, we describe it as a new species.

 Fungi Diaporthales Valsaceae D20E4F61-8608-533C-815B-4F248C7DA6D6 Cytospora leucostoma (Pers.) Sacc., Michelia 2: 264 (1881) Figs 4 , 5 Sphaeria leucostoma Pers., Ann. Bot. 11: 23 (1794) Valsa leucostoma (Pers.) Fr., Summa Veg. Scand., Section Post. (Stockholm): 411 (1849) Valsa persoonii Nitschke, Pyrenomyc. Germ. 2: 222 (1870) Leucostoma persoonii (Nitschke) Höhn., Mitt. Bot. Inst. Tech. Hochsch. Wien 5: 78 (1928)[Additional synonyms in Species Fungorum.] Description.

Necrotrophic on branches of Betulaceae, Juglandaceae and Rosaceae. Sexual morph: Ascostromata immersed in the bark, erumpent through the surface of bark, scattered, 950–2550 µm in diam., with 8–10 perithecia arranged circularly to irregularly. Conceptacle absent. Ectostromatic disc pale grey, fusoid, 600–2150 µm in diam., with 8–10 ostioles arranged irregularly per disc. Ostioles numerous, dark grey to black, at the same or above the level as the disc, concentrated, arranged irregularly in a disc, 60–120 µm in diam. Perithecia beige with a little black when mature, flask-shaped to spherical, arranged circularly to irregularly, 270–560 µm in diam. Paraphyses large, broad and cylindrical with 1–4 septa, 39–78 × 5.8–8.7 (av. = 50.6 ± 13.7 × 7 ± 0.8, n = 10) μm. Asci free, clavate to elongate obovoid, 35–45 × 6–8 (av. = 40.4 ± 3.3 × 6.9 ± 0.5, n = 10) μm, 8-spored. Ascospores uniseriate to biseriate, elongate-allantoid, thin-walled, hyaline, aseptate, 7–10 × 2–3 (av. = 8.3 ± 0.9× 2.6 ± 0.2, n = 30) μm. Asexual morph: Conidiomata pycnidial, immersed in the bark, scattered, erumpent through the surface of bark, with multiple locules and a conspicuous central column. Central column beneath the disc more or less conical, brown. Conceptacle absent. Ectostromatic disc buff, discoid, circular to ovoid, 190–310 µm in diam., with 1–2 ostioles per disc. Ostioles grey to black, at the same or above the level as the disc surface, 60–65 μm in diam. Locules numerous, subdivided frequently by invaginations with common walls, circular to ovoid, 700–1000 µm in diam. Conidiophores hyaline, branched at the base or unbranched, approximately cylindrical, 8–14 × 1–2 (av. = 11.5 ± 1.8 × 1.4 ± 0.2, n = 10) µm, sometimes reduced to conidiogenous cells. Conidiogenous cells enteroblastic phialidic, sub-cylindrical to cylindrical, 7–11 × 1–2 (av. = 9 ± 1.4 × 1.5 ± 0.3, n = 10) μm. Conidia hyaline, elongate-allantoid, smooth, aseptate, 4.5–6 × 1–2 (av. = 5.4 ± 0.3 × 1.5 ± 0.2, n = 30) μm.

10.3897/mycokeys.62.47854.figure4 3661756 0AB91276-5926-5B63-AF15-78BDC001CDA0

Cytospora leucostoma (Sexual morph) from Prunus sibirica (CF 2019814). A, B habit of ascomata on twig C transverse section of ascoma D longitudinal section through ascoma E asci and ascospores F ascus G ascospores H colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A); 500 μm (B–D); 10 μm (E–G).

https://binary.pensoft.net/fig/375796 10.3897/mycokeys.62.47854.figure5 3661758 CCE23CAC-01FA-5EEB-934D-1CAB5430C37C

Cytospora leucostoma (Asexual morph) from Juglans mandshurica (CF 2019809). A, B habit of conidiomata on twig C transverse section of conidioma D longitudinal section through conidioma E conidiophores and conidiogenous cells F conidia G colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A); 500 μm (B–D); 10 μm (E, F).

https://binary.pensoft.net/fig/375797 Culture characteristics.

Cultures initially are white, growing fast up to 8 cm in diam. after 3 days and entirely covering the 9 cm Petri dish after 4 days, becoming greenish-olivaceous after 7–10 days and grey olivaceous after 30 days. In reverse, the cultures are the same as the upper colour after 7 days, becoming olivaceous grey to iron grey after 30 days. Colonies are flat with a uniform texture; sterile.

 Habitat and distribution.

Known from several species of Betulaceae, Juglandaceae and Rosaceae around the world.

 Materials examined.

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°26'47.36"E, 39°56'06.45"N), from branches of Prunus sibirica, 17 Aug 2017, H.Y. Zhu & X.L. Fan, CF 2019814, living culture CFCC 53140; ibid. CF 2019815, living culture CFCC 53141. China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°29'20.52"E, 39°57'47.49"N), from branches of Juglans mandshurica, 17 Aug 2017, H.Y. Zhu & X.L. Fan, CF 2019809, living culture CFCC 53156.

 Notes.

Cytospora leucostoma is commonly associated with canker disease of Prunoideae of Rosaceae in China (Fan et al. 2020). Morphologically, our taxa are similar to previous descriptions of C. leucostoma in having multi-loculate pycnidial stromata with a conspicuous black conceptacle, producing elongate-allantoid, large conidia (4.5–6 × 1–2 μm) (Teng 1963, Zhuang 2005, Fan et al. 2020). The greenish-yellow of the cultures on PDA medium from Juglans mandshurica is similar to descriptions of those collected from Prunoideae (Fan et al. 2020). Multigene phylogenetic analyses supported the morphological results with high support values (ML/MP/BI = 100/100/1, Fig. 2). By combining morphology and the DNA data, our isolates collected from dead branches of Prunus sibirica and Juglans mandshurica belong to this species. The current study represents a new host record of Juglans mandshurica.

 Fungi Diaporthales Valsaceae 597FB305-1753-5013-AFB7-18158480E228 Cytospora pruinopsis C.M. Tian & X.L. Fan, Mycological Progress 14(9): 74 (2015) Fig. 6 Description.

See Yang et al. (2015).

 Material examined.

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°27'29.37"E, 39°56'47.49"N), from branches of Ulmus pumila, 22 Aug 2017, H.Y. Zhu & X.L. Fan, CF 2019806, living culture CFCC 53153.

 Habitat and distribution.

Known from Ulmus pumila in Northern China.

 Notes.

Yang et al. (2015) described Cytospora pruinopsis from cankers of Ulmus pumila in Shannxi Province of China. The strain CFCC 53153 clusters in a well-supported clade with high support value (MP/ML/BI = 100/100/1), based on combined multi-locus gene phylogenetic analyses (Fig. 2). Morphologically, it confirms Cytospora pruinosa in having a single locule and small conidia (2–4 × 1 μm) as per the descriptions of Yang et al. (2015). Phylogenetically, our isolates represent 6/771 nucleotide differences of tef1-α comparing with ex-type strains CFCC 50034 of C. pruinosa. Morphology and sequence data confirmed that our isolates represent this species.

10.3897/mycokeys.62.47854.figure6 3661760 147C87CA-6FFD-512B-90ED-E88B04EC46A0

Cytospora pruinopsis from Ulmus pumila (CF 2019806). A, B habit of conidiomata on twig C transverse section of conidiomata D longitudinal section through conidioma E conidiophores and conidiogenous cells F conidia G colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A); 250 μm (B); 500 μm (C, D); 10 μm (E, F).

https://binary.pensoft.net/fig/375798 Fungi Diaporthales Valsaceae 37DD8FA7-A93E-510E-BD0B-0C4C2E4998C2 Cytospora spiraeicola 833821 H.Y. Zhu & X.L. Fan sp. nov. Fig. 7 Etymology.

Named after the host genus on which it was collected, Spiraea.

 Holotype.

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°28'28.52"E, 39°55'49.42"N), from branches of Spiraea salicifolia, 17 Aug 2017, H.Y. Zhu & X.L. Fan, holotype CF 2019803, ex-type living culture CFCC 53138.

 Description.

Necrotrophic on branches of Spiraea salicifolia and Tilia nobilis. Sexual morph: Ascostromata immersed in the bark, erumpent through the surface of bark, scattered, with 3–5 perithecia arranged regularly, 660–890 µm in diam. Conceptacle absent. Ectostromatic disc pale grey, usually surrounded by tightly crowded ostiolar necks, quadrangular, 240–350 µm in diam., with 5–8 ostioles arranged regularly per disc. Ostioles numerous, dark grey to black, at the same or above the level as the disc, concentrated, arranged regularly in a disc, 25–40 µm in diam. Perithecia dark grey to black, flask-shaped to spherical, arranged circularly, 210–250 µm in diam. Paraphyses lacking. Asci free, clavate to elongate, obovoid, 26–37 × 7.5–9 (av. = 33 ± 2.5 × 8.3 ± 0.9, n = 10) μm, 8-spored. Ascospores biseriate, elongate-allantoid, thin-walled, hyaline, slightly curved, aseptate, 8.5–12 × 2.5–3.5 (av. = 10 ± 1 × 3 ± 0.3, n = 30) μm. Asexual morph: not observed.

10.3897/mycokeys.62.47854.figure7 3661762 AF882ECC-F21C-566C-9169-4512021BBD4F

Cytospora spiraeicola from Spiraea salicifolia (CF 2019803). A, B habit of ascomata on twig C transverse section of ascoma D longitudinal section through ascoma E asci and ascospores F, G ascus H ascospores I colonies on PDA at 3 days (left) and 30 days (right). Scale bars: 1 mm (A, B); 500 μm (C, D); 10 μm (E–H).

https://binary.pensoft.net/fig/375799 Culture characteristics.

Cultures are white, growing up to 4 cm in diam. with irregular margin after 3 days, covering the 9 cm Petri dish after 6 days, becoming vinaceous buff to hazel after 7–10 days. In reverse, the cultures are the same as the upper colour after 3 days, becoming isabelline to umber after 7–10 days. Colonies are felty with a heterogeneous texture, lacking aerial mycelium.

 Habitat and distribution.

Known from Spiraea salicifolia and Tilia nobilis in Mount Dongling, China.

 Additional material examined.

China, Beijing City, Mentougou District, Mount Dongling, Xiaolongmen Forestry Centre (115°29'20.49"E, 39°57'47.43"N), from branches of Tilia nobilis, 17 Aug 2017, H.Y. Zhu & X.L. Fan, CF 2019804, living culture CFCC 53139.

 Notes.

Cytospora spiraeicola is associated with canker disease of Spiraea salicifolia and Tilia nobilis in China, with characteristics similar to Cytospora elaeagnicola and C. spiraeae in phylogram (Fig. 2). Morphologically, it differs from C. spiraeae by the smaller perithecia (210–250 vs. 270–400 µm in diam.) and longer ascospores (8.5–12 × 2.5–3.5 vs. 7–8 × 2–2.5 µm) (Zhu et al. 2018a). Phylogenetically, C. spiraeicola (CFCC 53138) differs from C. elaeagnicola (CFCC 52882) by ITS (8/665), rpb2 (44/730), tef1-α (75/771) and tub2 (42/624) and C. spiraeae (CFCC 50049) by ITS (4/665), rpb2 (38/730), tef1-α (63/771) and tub2 (44/624) (Zhu et al. 2018a, Zhang et al. 2019). Therefore, we describe it as a novel species.

 Discussion

In the present study, seven specimens were collected from symptomatic branches and twigs associated with canker disease. Four Cytospora species were isolated from six tree hosts of Betulaceae, Juglandaceae, Rosaceae, Tiliaceae and Ulmaceae, which include two known species (Cytospora leucostoma and C. pruinopsis) and two novel species (C. coryli and C. spiraeicola). This study represents an investigation of Cytospora species associated with canker disease in Mount Dongling of China and included a comprehensive analysis of DNA sequence data to compare the novelties with known Cytospora species.

In a previous study, Zhu et al. (2018a) described Cytospora spiraeae from Spiraea salicifolia in Gansu Province of China during an investigation of forest pathogens of three hosts. Compared to the new species Cytospora spiraeicola, C. spiraeae has larger perithecia (270–400 vs. 210–250 µm) in diam. and shorter ascospores (7–8 × 2.5–3.5 × 8.5–12 vs. 2–2.5 µm). These morphological deviations are in line with the combined phylogenetic analyses which resolved C. spiraeicola as a unique lineage, highly supported. Besides this, the only strain of C. coryli, closely related to C. euonymicola and C. gigalocus, was distinguished by its different size of multiple locules and conidia (Fan et al. 2015a, 2020).

This study focused on Cytospora species in Mount Dongling of Beijing (China), which is considered as an attractive location with a high richness of fungal species (Guo et al. 2008, Zhu et al. 2018b, 2019). We hope that the descriptions and molecular data of Cytospora in this study could provide a resource for future studies in this genus and lay the foundation for the future canker disease caused by Cytospora species.

 Acknowledgements

This study is financed by the Fundamental Research Funds for the Central Universities (2019ZY23), the National Natural Science Foundation of China (31670647) and the College Student Research and Career-creation Program of Beijing (S201810022005). All authors want to thank the Experimental Teaching Centre (College of Forestry, Beijing Forestry University) for providing installed scientific equipment during the whole process.

 References AdamsGCRouxJWingfieldMJ (2006) Cytospora species (Ascomycota, Diaporthales, Valsaceae), introduced and native pathogens of trees in South Africa.Australasian Plant Pathology35: 521–548. https://doi.org/10.1071/AP06058 AdamsGCRouxJWingfieldMJCommonR (2005) Phylogenetic relationships and morphology of Cytospora species and related teleomorphs (Ascomycota, Diaporthales, Valsaceae) from Eucalyptus.Studies in Mycology52: 1–144. AlvesACrousPWCorreiaAPhillipsAJL (2008) Morphological and molecular data reveal cryptic speciation in Lasiodiplodia theobromae.Fungal Diversity28: 1–13. BarrME (1978) The Diaporthales in North America with emphasis on Gnomonia and its segregates.Mycologia Memoir7: 1–232. CarboneIKohnLM (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes.Mycologia91: 553–556. https://doi.org/10.1080/00275514.1999.12061051 DoyleJJDoyleJL (1990) Isolation of plant DNA from fresh tissue.Focus12: 13–15. https://doi.org/10.2307/2419362 EhrenbergCG (1818) Sylvae Mycologicae Berolinenses. Formis Theophili Bruschcke, Berlin, Germany. FanXLBezerraJDPTianCMCrousPW (2020) Cytospora (Diaporthales) in China.Persoonia45: 1–45. https://doi.org/10.3767/persoonia.2020.45.01 FanXLHydeKDLiuMLiangYMTianCM (2015a) Cytospora species associated with walnut canker disease in China, with description of a new species C. gigalocus.Fungal Biology119: 310–319. https://doi.org/10.1016/j.funbio.2014.12.011 FanXLHydeKDYangQLiangYMMaRTianCM (2015b) Cytospora species associated with canker disease of three anti-desertification plants in northwestern China.Phytotaxa197: 227–244. https://doi.org/10.11646/phytotaxa.197.4.1 FanXLLiangYMMaRTianCM (2014a) Morphological and phylogenetic studies of Cytospora (Valsaceae, Diaporthales) isolates from Chinese scholar tree, with description of a new species.Mycoscience55: 252–259. https://doi.org/10.1016/j.myc.2013.10.001 FanXLTianCMYangQLiangYMYouCJZhangYB (2014b) Cytospora from Salix in northern China.Mycotaxon129: 303–315. https://doi.org/10.5248/129.303 FriesEM (1823) Systema mycologicum. Vol. 2, Greifswald, Germany. GlassNLDonaldsonGC (1995) Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes.Applied and Environmental Microbiology61: 1323–1330. https://doi.org/10.1128/AEM.61.4.1323-1330.1995 GuindonSDufayardJFLefortVAnisimovaMHordijkWGascuelHO (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0.Systematic Biology59: 307–321. https://doi.org/10.1093/sysbio/syq010 GuoLDHuangGRWangY (2008) Seasonal and Tissue Age Influences on Endophytic Fungi of Pinus tabulaeformis (Pinaceae) in the Dongling Mountains, Beijing.Journal of Integrative Plant Biology50: 997–1003. https://doi.org/10.1111/j.1744-7909.2008.00394.x GvritishviliMN (1982) The fungal genus Cytospora in the USSR. Izdatelstv Sabchota Sakarstvelo, Tbilici, Russia. HillisDMBullJJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis.Systematic Biology42: 182–192. https://doi.org/10.1093/sysbio/42.2.182 KatohKStandleyDM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability.Molecular biology and evolution30: 772–780. https://doi.org/10.1093/molbev/mst010 KirkPMCanoonPFMinterDWStalpersJA (2008) Ainsworth & Bisby’s dictionary of the Fungi, 10rd edn, Wallingford, UK. https://doi.org/10.1079/9780851998268.0000 KobayashiT (1970) Taxonomic studies of Japanese Diaporthaceae with special reference to their life-histories. Tokyo, Japan. LawrenceDPTravadonRPouzouletJRolshausenPEWilcoxWFBaumgartnerK (2016) Characterization of Cytospora isolates from wood cankers of declining grapevine in North America, with the descriptions of two new Cytospora species.Plant Pathology5: 713–725. https://doi.org/10.1111/ppa.12621 LawrenceDPHollandLANouriMTTravadonRTrouillasFP (2018) Molecular phylogeny of Cytospora species associated with canker diseases of fruit and nut crops in California, with the descriptions of ten new species and one new combination.IMA Fungus9: 333–369. https://doi.org/10.5598/imafungus.2018.09.02.07 LiuYJWhelenSHallBD (1999) Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit.Molecular Biology and Evolution16: 1799–1808. https://doi.org/10.1093/oxfordjournals.molbev.a026092 MaKPGuoXMYuSL (1995) On the characteristics of the flora of Mount Dongling area and its relationship with a number of other mountainous floras in China.Bulletin Botanical Research15: 501–515. NorphanphounCDoilomMDaranagamaDAPhookamsakRWenTCBulgakovTSHydeKD (2017) Revisiting the genus Cytospora and allied species.Mycosphere8: 51–97. https://doi.org/10.5943/mycosphere/8/1/7 PanMZhuHYTianCMAlvarezLVFanXL (2018) Cytospora piceae sp. nov. associated with canker disease of Picea crassifolia in China.Phytotaxa383: 181–196. https://doi.org/10.11646/phytotaxa.383.2.4 PosadaDCrandallKA (1998) Modeltest: testing the model of DNA substitution.Bioinformatics14: 817–818. https://doi.org/10.1093/bioinformatics/14.9.817 RannalaBYangZ (1996) Probability distribution of molecular evolutionary trees: a new method of phylogenetic inference.Journal of Molecular Evolution43: 304–311. https://doi.org/10.1007/BF02338839 RaynerRW (1970) A Mycological Colour Chart. Commonwealth Mycological Institute, Kew, UK. RonquistFHuelsenbeckJP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models.Bioinformatics19: 1572–1574. https://doi.org/10.1093/bioinformatics/btg180 RossmanAYAdamsGCCannonPFCastleburyLACrousPWGryzenhoutMJaklitschWMMejiaLCStoykovDUdayangaDVoglmayrHWalkerM (2015) Recommendations of generic names in Diaporthales competing for protection or use.IMA Fungus6: 145–154. https://doi.org/10.5598/imafungus.2015.06.01.09 SaccardoPA (1884) Sylloge Fungorum III. Typis Seminarii, Italy. StamatakisA (2006) RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models.Bioinformatics22: 2688–2690. https://doi.org/10.1093/bioinformatics/btl446 SinclairWALyonHHJohnsonWT (1987) Diseases of Trees and Shrubs. Coinstock Publishing Associates, Cornell University Press, USA. SpielmanLJ (1983) Taxonomy and biology of Valsa species on hardwoods in North America, with special reference to species on maples, Cornell University, New York, USA. SpielmanLJ (1985) A monograph of Valsa on hardwoods in North America.Canadian Journal of Botany63: 1355–1378. https://doi.org/10.1139/b85-190 SunXGuoLDHydeKD (2011) Community composition of endophytic fungi in Acer truncatum and their role in decomposition.Fungal diversity47: 85–95. https://doi.org/10.1007/s13225-010-0086-5 SuttonBC (1980) The Coelomycetes: Fungi Imperfecti with pycnidia, acervuli and stromata. Kew: Commonwealth Mycological Institute. SwoffordDL (2003) PAUP*: Phylogenetic Analysis Using Parsimony, * and Other Methods, Version 4.0b10, Sinauer Associates, Sunderland. TaiFL (1979) Sylloge Fungorum Sinicorum. Science Press. Beijing, China. TamuraKStecherGPetersonDFilipskiAKumarS (2013) MEGA6: molecular evolutionary genetics analysis version 6.0.Molecular Biology and Evolution30: 2725–2729. https://doi.org/10.1093/molbev/mst197 TengSC (1963) Fungi of China. Science Press. Beijing, China. VilgalysRHesterM (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species.Journal of Bacteriology172: 4238–4246. https://doi.org/10.1128/JB.172.8.4238-4246.1990 WeiJC (1979) Identification of Fungus Handbook. Science Press. Shanghai, China. WhiteTJBrunsTLeeSTaylorJ (1990) Amplifcation and direct sequencing of fungal ribosomal RNA genes for phylogenetics.PCR Protocols: a guide to methods and applications18: 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1 WijayawardeneNNHydeKDLumbschHTLiuJKMaharachchikumburaSSNEkanayakaAHTianQPhookamsakR (2018) Outline of Ascomycota: 2017.Fungal Diversity88: 167–263. https://doi.org/10.1007/s13225-018-0394-8 YangQFanXLCrousPWLiangYMTianCM (2015) Cytospora from Ulmus pumila in Northern china.Mycological Progress14: 1–12. https://doi.org/10.1007/s11557-015-1096-1 ZhuHYPanMBonthondGTianCMFanXL (2019) Diaporthalean fungi associated with canker and dieback of trees from Mount Dongling in Beijing, China.MycoKeys59: 67–94. https://doi.org/10.3897/mycokeys.59.38055 ZhuHYTianCMFanXL (2018a) Multigene phylogeny and morphology reveal Cytospora spiraeae sp. nov. (Diaporthales, Ascomycota) in China.Phytotaxa338: 49–62. https://doi.org/10.11646/phytotaxa.338.1.4 ZhuHYTianCMFanXL (2018b) Studies of botryosphaerialean fungi associated with canker and dieback of tree hosts in Dongling Mountain of China.Phytotaxa348: 63–76. https://doi.org/10.11646/phytotaxa.348.2.1 ZhangLXAlvarezLVBonthondGTianCMFanXL (2019) Cytospora elaeagnicola sp. nov. associated with narrow-leaved oleaster canker disease in China.Mycobiology47: 319–328. https://doi.org/10.1080/12298093.2019.1633902 ZhuangWY (2005) Fungi of Northwestern China. Mycotaxon, Ltd. New York, USA.