Corresponding author: Markus Scholler (
Academic editor: Marco Thines
Species of rust fungi of the genus
Whereas urediniospore morphology features were sufficient to distinguish all 12
Bubner B, Buchheit R, Friedrich F, Kummer V, Scholler M (2019) Species identification of European forest pathogens of the genus
Several genera of rust fungi (
The genus
Fern rust species on the telial hosts are characterised and distinguished mainly by host taxonomy (telial host genus), size, shape and ornamentation of urediniospores (e.g.
In the present study, the urediniospore morphology of European
i) provide a detailed morphological description of urediniospores of all European
ii) provide molecular barcodes (ITS, nad6, 28S) for Central European species of
iii) assess the assignment of morphological species by comparison with the molecular data.
Dried herbarium specimens from the following public herbaria were used: B, FH, G, GLM, GZU, HBG,
Urediniospores and cross sections of sori (uredinia) from dried
Germ pore number and their position in the wall of urediniospores were evaluated by an adapted technique originally developed for the genus
Specimens were photographed with a Jenoptik ProgRes CT3 digital camera attached to a Zeiss Axioskop 2 plus light microscope (Oberkochen), using differential interference contrast (
Uredinia and urediniospores of dried specimens of
SEM studies were carried out to study surface structures which are not visible by light microscopy. Spine base diameters (30 per species) were also measured with SEM and the software IMAGEJ 1.5.
The statistical analyses for germ pore numbers and boxplots were carried out with the programme R 3.4.3 (
Samples were prepared from herbarium specimens by excising single rust pustules including the plant material. They were placed into micro tubes with 8–12 ceramic beads, 1.4 mm diameter (Bio-Budget technologies, Krefeld, Germany), frozen at -20 °C overnight and homogenised on a Bead Ruptor (biolabproducts, Bebensee, Germany) at a speed of 7.45 m/s for 25 s. After freezing the samples again for 10 min at -20 °C, homogenisation was repeated. DNA was extracted with the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. Selected samples were homogenised with glass mini mortars and pestles (Roth, Karlsruhe, Germany) in 400 µl of the homogenisation buffer included in the extraction kit.
Molecular barcodes were generated for three loci: ITS (Internal Transcribed Spacer of the ribosomal DNA in the nucleus), 28S (coding for the large subunit of the ribosomal RNA gene located on the ribosomal DNA in the nucleus), nad6 (coding for subunit 6 of NADH dehydrogenase, mitochondrial DNA). Primer sequences are listed in Table
PCR was performed with the Accuprime Taq Polymerase System (Life Technologies, Karlsruhe, Germany) using the supplied buffer II and the following final concentrations: 2 mM MgCl2, 0.2 mM of each dNTP and 500 nM of each primer. The PCR programme was as follows: 3 min denaturation at 94 °C, 40 amplification cycles (94 °C for 30 s, 50 °C for 30 s and 68 °C for 60 s) and 7 min strand completion at 68 °C. PCR products were visualised in 1.6% agarose gel. Deviations from the 50 °C annealing temperature are listed in Table
After purification of the PCR product with QIAquick-PCR Purification Kit (Qiagen, Hilden, Germany), it was sent to GATC Biotech AG (Konstanz, Germany) for sequencing. Sequencing was performed with the same primers used for the PCR. Forward and reverse sequences were edited and assembled with the software package GENEIOUS 10.0 (Biomatters, Auckland, New Zealand).
Primers and PCR conditions.
Locus | Primer | Sequence | Reference | Annealing temperature | Cycle number | |
---|---|---|---|---|---|---|
ITS | amplicon 1 | ITS1F | CTTGGTCATTTAGAGGAAGTAA | ( |
60–50 °C | 10 cycles with -1 °C per cycle (60–50 °C), then 30 cycles (50 °C) |
ITS4rust | CAGATTACAAATTTGGGCT | ( |
||||
amplicon 2* | ITS5u | CAAGGTTTCTGTAGGTG | ( |
60–50 °C | 10 cycles with -1 °C per cycle (60–50 °C), then 30 cycles (60 °C) | |
ITS4 | TCCTCCGCTTATTGATATGC | ( |
||||
28S | amplicon 1 | ITS4BRF | GGACCATGTACAAGTCTGTTGA | ( |
50 °C | 40 |
LR5 | ATCCTGAGGGAAACTTC | ( |
||||
nad6 | amplicon 1 | Nad6PucciF1 | TTCGATAATAAGTAGCCTAATAGTG | ( |
47 °C | 40 |
Nad6PucciR1 | AAATACAATAGGGCCAATCAT | ( |
*voucher KR-M-0035533, KR-M-0048135
Several comparison sequences were selected in order to compare the branch length between
Sequences were aligned with the ClustalW algorithm implemented in the programme BioEdit, version 7.1.3.0 (
i) Neighbour-Joining (
ii) Maximum-Likelihood (
c) Bayesian Inference (
Tree files resulting from the three methods were visualised using the programme TreeGraph 2 (
ITS sequences were generated for 72 specimens of 11
Species | Host plant species | Voucher (all herbarium |
Lab no. | ITS | 28S | nad6 |
---|---|---|---|---|---|---|
|
|
KR-M-0038517 | B1426 |
|
||
|
KR-M-0038523 | B1427 |
|
|||
|
KR-M-0038519 | B1428 |
|
|
||
|
KR-M-0038516 | B1442 |
|
|
||
|
KR-M-0049039 | B1893 |
|
|||
|
|
KR-M-0048589 | B1662 |
|
||
|
KR-M-0043192 | B1780 |
|
|||
|
|
KR-M-0050247 | B2206 |
|
|
|
|
|
KR-M-0043159 | B1964 |
|
||
|
|
KR-M-0043170 | B1435 |
|
||
|
KR-M-0043182 | B1438 |
|
|||
|
KR-M-0043165 | B1440 |
|
|
||
|
KR-M-0039321 | B1441 |
|
|
||
|
KR-M-0048087 | B1469 |
|
|
||
|
KR-M-0048085 | B1470 |
|
|
|
|
|
KR-M-0048086 | B1471 |
|
|
||
|
KR-M-0043162 | B1472 |
|
|||
|
KR-M-0048088 | B1473 |
|
|||
|
KR-M-0043151 | B1474 |
|
|||
|
KR-M-0043184 | B1475 |
|
|||
|
KR-M-0043178 | B1476 |
|
|||
|
KR-M-0048357 | B1494 |
|
|||
|
KR-M-0048477 | B1602 |
|
|
||
|
KR-M-0048480 | B1685 |
|
|
||
|
|
KR-M-0048133 | B1443 |
|
|
|
|
KR-M-0048134 | B1444 |
|
|
||
|
KR-M-0048132 | B1445 |
|
|
||
|
KR-M-0035461 | B1446 |
|
|
|
|
|
KR-M-0036224 | B1447 |
|
|
||
|
KR-M-0036225 | B1448 |
|
|
||
|
KR-M-0025768 | B1449 |
|
|
||
|
KR-M-0025185 | B1450 |
|
|
||
|
KR-M-0025184 | B1451 |
|
|
||
|
KR-M-0025191 | B1452 |
|
|
||
|
KR-M-0043149 | B1852 |
|
|
||
|
KR-M-0043154 | B1853 |
|
|
||
|
|
KR-M-0043177 | B1429 |
|
||
|
KR-M-0043189 | B1431 |
|
|||
|
KR-M-0043190 | B1432 |
|
|
||
|
KR-M-0043161 | B1433 |
|
|||
|
KR-M-0043152 | B1466 |
|
|
||
|
KR-M-0048818 | B1846 |
|
|||
|
KR-M-0043157 | B1847 |
|
|||
|
KR-M-0043146 | B1848 |
|
|||
|
KR-M-0043173 | B1849 |
|
|||
|
KR-M-0048694 | B1778 |
|
|
||
|
|
KR-M-0043186 | B1455 |
|
|
|
|
KR-M-0043153 | B1456 |
|
|
||
|
KR-M-0025400 | B1457 |
|
|
|
|
|
KR-M-0049066 | B1896 |
|
|
||
|
KR-M-0049049 | B1897 |
|
|
||
|
KR-M-0049050 | B1898 |
|
|
|
|
|
KR-M-0049051 | B1899 |
|
|
|
|
|
KR-M-0043687 | B1458 |
|
|
|
|
|
KR-M-0042052 | B1459 |
|
|
|
|
|
KR-M-0018587 | B1860 |
|
|||
|
KR-M-0018624 | B1861 |
|
|||
|
KR-M-0049062 | B1902 |
|
|||
|
KR-M-0049038 | B1903 |
|
|||
|
KR-M-0049065 | B1905 |
|
|
||
|
KR-M-0049068 | B1906 |
|
|
||
|
KR-M-0049063 | B1907 |
|
|||
|
KR-M-0048773 | B1911 |
|
|||
|
KR-M-0050303 | B2209 |
|
|
|
|
|
|
KR-M-0003937 | GBOL_1_f10 |
|
||
|
KR-M-0043175 | B1453 |
|
|
||
|
KR-M-0043160 | B1454 |
|
|
||
|
KR-M-0043187 | B1467 |
|
|
|
|
|
|
KR-M-0049177 | B1965 |
|
||
|
KR-M-0050248 | B2207 |
|
|
||
|
|
KR-M-0049033 | B1912 |
|
|
|
|
KR-M-0048787 | B1914 |
|
All 72 specimens with ITS sequences were sequenced for the loci nad6 and 28S. Twenty nine specimens yielded barcode sequences at the locus nad6 (sequencing success 40%), while 24 specimens were successfully sequenced at the locus 28S (sequencing success 33%, Table
ITS barcodes specimens of
Species | host plant species | voucher (all herbarium |
lab no. | ITS | 28S | nad6 |
---|---|---|---|---|---|---|
|
|
KR-M-0040758 | B1252 |
|
||
|
|
KR-M-0048660 | B1688 |
|
||
|
KR-M-0048741 | B1689 |
|
|||
|
|
KR-M-0035533 | B1412 |
|
|
|
|
KR-M-0048135 | B1416 |
|
|
||
|
KR-M-0048557 | B1835 |
|
|||
|
|
KR-M-0048587 | B1774 |
|
||
|
|
KR-M-0049100 | B2033 |
|
||
|
KR-M-0048149 | B1420 |
|
|||
|
|
KR-M-0039060 | B2038 |
|
||
|
|
KR-M-0004576 | B2039 |
|
||
|
KR-M-0043058 | B2040 |
|
|
||
|
|
KR-M-0050249 | B2208 |
|
|
|
|
KR-M-0012195 | B2011 |
|
|||
|
KR-M-0050313 | B2212 |
|
|
|
Phylogenetic analysis of the ITS barcode revealed four clades for clades within
ITS Phylogram of
In clade 2,
Amongst the specimens on the aecial host
The ITS phylogeny (Figure
Due to the low sequencing success of these two markers, only seven (nad6) and eight (28S)
Phylograms of supplementary barcodes. The nad6 phylogram is based on a 550 bp alignment, the 28S phylogram on a 680 bp alignment. The technical description is the same as for Figure
Deviations from the consensus ITS sequence of section
The ambiguity in ITS data to determine a clade 3, consisting of both
Germ pores
The number and position of the germ pores of all species were visualised. Germ pores provided three important features, namely (i) the number, (ii) the position and, finally, (iii) the size of pores. The four species with the highest number of germ pores per spore all belong to the section
Deviations from the consensus ITS sequence of section
Boxplot of germ pore numbers of urediniospores of 12
Comparative data of the main morphological spore characters are listed in Table
Comparative overview of morphological features of urediniospores and host range in
Species | Host plant genus (family) | Frequent spine length [µm] | Smooth spine-free areas | Frequent wall thickness [µm] | Frequent germ pore number | Ø germ pore diam. [µm] | Germ pore distri-bution | Frequent spore size [µm] | Other |
---|---|---|---|---|---|---|---|---|---|
|
1.5–2.0 | no | 0.8–1.0 | 10–11 | 2.4 | scattered | 30.0–37.5 × 15.0–19.0 | distance between spines mostly 1.5–4.0 µm, spines typically perpendicular to the wall | |
|
1.0–1.8 | no | 0.5–1.2 | 5–7 | 2.2 | scattered | 20.0–30.0 × 12.5–19.0 | distance between spines mostly 0.5–3.0 µm, spines typically erect | |
|
no spines | no spines | 0.5–0.8 | 4–6 | 2.7 | bizonate | 22.5–30.0 × 12.5–17.5 | Germ pores concentrated apically or nearly bizonate | |
|
±2.0 | yes | 0.5–1.0 | 6–7 | 2.4 | scattered | 30.0–37.5 × 20.0–22.5 | distance between spines mostly 1.0–5.0 µm, spines typically erect | |
|
±2.0 | no | 0.8–1.0 | 10–11 | 2.3 | scattered | 27.5–37.5 × 15.0–20.0 | distance between spines mostly 1.0–4.0 µm, spines typically erect | |
|
±2.0–2.2 | yes | 1.0–1.5 | 5–6 | 2.9 | scattered | 30.0–35.0 × 17.5–20.0 | distance between spines mostly 3.0–5.5 µm | |
|
±2.0 | yes | 2.0 | 5–6 | 2.4 | scattered | 27.5–35.0 × 17.5–22.5 | distance between spines 2.0–3.5 µm, spines typically erect, curved near base | |
|
±2.0 | yes | 0.5–1.0 | 5–6 | 2.3 | scattered | 30.0–40.0 × 17.5–22.5 | distance between spines 1.0–4.0 µm, spines typically erect | |
|
±2.0 | yes | 0.5–1.2 | 6–7 | 2.4 | scattered | 27.5-42.5 × 17.5-22.5 | distance between spines 2.0-5.0 µm, spines typically erect | |
|
no spines | no spines | 0.5-0.8 | 5-6 | 2.8 | ± bizonate | 30.0-40.0 × 17.5-20.0 | spores with very inconspicuous flat verrucae (visibly with SEM only) | |
|
1.8-2.5 | no | 0.8-1.0 | 9-13 | 2.3 | scattered | 27.5-37.5 × 17.5-22.5 | distance between spines mostly around 2.0 µm, spines typically perpendicular to the wall | |
|
±3.0 | no | 0.5-1.0 | 10-14 | 2.4 | scattered | 30.0-37.5 × 17.5-22.5 | distance between spines mostly 2.0-4.0 µm, spines irregularly directed |
Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–42.5 × 15.0–20.0 µm, mostly 30.0–37.5 × 15.0–19.0 µm; wall 0.5–1.5 µm, mostly 0.8–1.0 µm thick; echinulate without spine-free areas, spines 1.2–2.2 µm, mostly 1.5–2.0 µm long, irregularly distributed, sometimes also in rows, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–5.0 µm, mostly 1.5–4.0 µm, spine base 0.7–1.3 µm, mostly 0.9–1.1 µm diam.; germ pores scattered, 6–13, mostly 10–11, 2.0–3.0 µm diam., Ø 2.4 µm diam.
Urediniospore features are very similar to those of
Urediniospores of 11
Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 16.5–32.5 × 10.0–20.0 µm, mostly 20.0–30.0 × 12.5–19.0 µm; wall 0.5–1.8 µm, mostly 0.5–1.0 µm thick; soft (in microscopic mounts they often crack without pressure), very densely echinulate without spine-free areas, spines 1.0–2.0 µm, mostly 1.0–1.8 µm long, irregularly distributed, spines typically straight and perpendicular to the wall, distance between spine bases 0.5–4.0 µm, mostly 0.5–3.0 µm, spine base 0.4–0.7 µm, mostly 0.5–0.6 µm; germ pores scattered, 4–10, mostly 5–7, 1.3–2.5 µm, mostly 1.3–2.5 µm diam., Ø 2.2 µm diam.
Germ pores are more difficult to visualise and need more time to evaluate.
Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 22.5–32.5 × 12.5–17.5 µm, mostly 22.5–30.0 × 12.5–17.5 µm; wall 0.5–0.8 µm; spores smooth, germ pores low in number, probably around 4–6, 2.0–3.8 µm, mostly 2.0–3.0 µm diam., Ø 2.7 µm diam.; germ pores mostly apically, or both, basally and apically (bizonate).
Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 27.5–42.5 × 17.5–25.0 µm, mostly 30.0–37.5 × 20.0–22.5 µm; wall 0.5–1.8 µm, mostly 0.5–1.0 µm thick; spores densely echinulate with 1–2, mostly 1 round to ovoidal smooth area, typically located centrally, smooth area 7.5–17.5 × 6.5–10.0 µm, mostly 10.0–15.0 × 7.5–10.0 µm, spines 1.5–2.5 µm, mostly 1.8-2.2 µm long, irregularly distributed, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–9.0 µm, mostly 1.0–5.0 µm, spine base mostly around 1 µm; germ pores scattered, 5–11, mostly 6–7, 1.3–3.0 µm, mostly 2.0–2.5 µm diam., Ø 2.4 µm diam.
Urediniospores hyaline, ellipsoidal, obovoidal to oval, clavate, 25.0–47.5 × 12.5–25.0 µm, mostly 27.5–37.5 × 15.0–20.0 µm; wall 0.5–1.2 µm, mostly 0.8–1.0 µm thick; spores echinulate without spine-free areas, spines 1.2–3.0 µm, mostly 1.8–2.2 µm long, irregularly distributed, sometimes in rows, spines typically straight and perpendicular to the wall, distance between spine bases 1.0–6.0 µm, mostly 1.0–4.0 µm, mostly around 1 µm; germ pores scattered, 6–14, mostly 10–11, 1.3–3.0 µm, mostly 2.0–2.5 µm, Ø 2.3 µm diam.
See annotation under
Urediniospores hyaline, ellipsoidal to obovoidal, 21.3–38.8 × 15.0–22.5 µm, mostly 30.0–35.0 × 17.5–20.0 µm; wall 1.0–2.0 µm, mostly 1.0–1.5 µm thick; spores echinulate with 1–2 ovoidal smooth areas, typically located centrally, smooth area 11.5–17.5 × 6,3–10.0 µm, mostly 15.0–17.5 × 7.5–10.0 µm, spines 1.2–2.8 µm, mostly 2.0–2.2 µm long, irregularly distributed, spines often erect, distance between spines 0.5–9.0 µm, mostly 3.0–5.5 µm; germ pores scattered, 4–9, mostly 5–6, 2.0–4.5 µm, mostly 2.5–3.0 µm diam., Ø 2.9 µm diam.
Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 25.0–42.5 × 15.0–22.5 µm, mostly 27.5–35.0 × 17.5–22.5 µm; wall 1.2–2.2 µm, mostly around 2.0 µm thick; spores echinulate with 1–2, mostly 2 ovoidal smooth areas, typically located centrally, smooth area 11.5–20.0 × 7.5–12.5 µm, mostly 12.5–15.0 × 7.5–10.0 µm, spines 1.5–2.5 µm, mostly 1.8–2.2 µm long, erect, spines curved toward base, denser toward both spore poles, distance between spine bases 0.5–7.0 µm, mostly 2.0–3.5 µm, spine base 0.7–1.4 µm, mostly around 1 µm; germ pores scattered, 3–9, mostly 5–6, 2.0–3.8 µm, mostly 2.0–2.5 µm diam., Ø 2.4 µm diam.
Urediniospores hyaline, ellipsoidal, obovoidal to subglobose, 26.5–42.5 × 15.0–25.0 µm, mostly 30.0–40.0 × 17.5–22.5 µm; wall 0.5–2.5 µm, mostly 0.5–1.0 µm thick; spores echinulate with 1–2, mostly 1 ovoidal smooth area, typically located centrally, smooth area 15.0–22.5 × 6.3–11.3 µm, mostly 15.0–17.5 × 7.5–10.0 µm, spines 1.8–2.8 µm, mostly 1.8–2.2 µm long, irregularly distributed, erect, spines denser toward spore base, distances 0.5–7.0 µm, mostly 1.0–4.0 µm, spine base 0.7–1.6 µm, mostly 0.9–1.2 µm diam.; germ pores scattered, 4–10, mostly 5–6, 1.3–3.8 µm, mostly 2.0–2.5 µm diam., Ø 2.3 µm diam.
Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–49.0 × 17.5–25.0 µm, mostly 27.5–42.5 × 17.5–22.5 µm; wall 0.5–1.8 µm, mostly 0.5–1.2 µm thick; spores echinulate with 1 mostly ovoidal smooth area, located centrally to apically, smooth area 12.5–20.0 × 7.5–11.3 µm, mostly 15.0–17.5 × 7.5/10.0 µm, spines 1.5–2.8 long, irregularly distributed, erect, distances between spine bases 1.0–9.0 µm, mostly 2.0–5.0 µm, sometimes denser toward spore base, spine base 0.8–1.6 µm, mostly 0.9–1.2 µm diam.; germ pores scattered, 4–9, mostly 6–7, 1.25–3.0 µm, mostly 2.0–3.0 µm diam., Ø 2.4 µm diam.
Urediniospores hyaline, ellipsoidal to obovoidal, clavate, 27.5–45.0 × 15.0–25.0 µm, mostly 30.0–40.0 × 17.5–20.0 µm; wall 0.5–1.0 µm, mostly 0.5–0.8 µm thick; spores with flat verrucae verrucae 0.3–0.6 µm, mostly 0.4–0.5 µm in diam., mainly at the upper part of the spore (visible with SEM only); germ pores often bizonate, sometimes scattered, 3–8 mostly 5–6, 2.0–4.5 µm, mostly 2.5–3.0 µm diam., Ø2.8 µm diam.
See commentary under
Urediniospores hyaline, ellipsoidal, obovoidal to oval, 27.5–40.0 × 16.5–25.0 µm, mostly 27.5–37.5 × 17.5–22.5 µm; wall 0.5–1.0 µm, mostly 0.8–1.0 µm thick; echinulate without spine-free areas, spines 1.8–2.8 µm, mostly around 1.8–2.5 µm long, irregularly distributed, straight and perpendicular to the wall, distance between spine bases 1.0–8.0 µm, mostly 1.5–5.0 µm, spine base 0.5–1.2 µm, mostly 0.8–1.1 µm diam.; germ pores scattered, 8–15 (17), mostly 9–13, 1.3–3.0 µm, mostly 2.0–2.5 µm diam., Ø2.3 µm diam.
The North American
Further specimens examined (paratypes)Spain, Islas Canarias: La Palma, Cubo de la Galga, ca. 1.2 km SW of parking lot at coastal highway W San Bartolomé, wayside in Laurosilva, 16 Aug 2015, V. Kummer, II (
Spermogonia (0), aecia (I), telia (III) and basidia (IV) unknown. Uredinia hypophyllous, subepidermal, statistically distributed; sori round, wart-like elevations, 0.1–0.3 mm in diam., covered by brownish or yellow-brownish epidermis, on dark necrotic plant tissue margined by nerves, never on nerves directly, sori opening pore-like; peridium hemispheric, peridial cells colourless, about 7.5–25.0 × 7.5–10 µm, upper peridial cells more or less isodiametrical and lateral peridial cells elongated; urediniospores hyaline, ellipsoidal to obovoidal, sometimes subglobose to irregular, 25.5–46.5 × 15.0–25.0 µm, mostly 30.0–37.5 × 17.5–22.5 µm; cell wall thin, 0.5–1.2 µm, mostly 0.5–1.0 µm thick, densely echinulate without spine-free areas, densest at spore base, spines 2.0–3.2 µm long, mostly 3.0 µm long, slightly irregularly distributed, spines orientated in different directions, dense basal spines typically directed toward spore pedicel, distance between spines bases 0.5–5.0 µm, mostly 2.0–4.0 µm, spine base 0.6–1.3 µm, mostly around 1 µm; spore pedicel often laterally or semilaterally inserted, short and wide, 5.5–14 × 12.5–15.5 µm; germ pores scattered, 8–19 (21), mostly 10–14, 1.3–3.0 µm, mostly 2.0–3.0 µm diam., Ø 2.4 µm diam.; germ tubes septate, may develop simultaneously in one spore.
Spore morphology and symptoms on fern fronds of
The species is only known north-eastern La Palma, Islas Canarias, Spain.
Referring to the English botanist Thomas Jenkinson Woodward (1745 – 1820) and the host plant
This species differs from
In this study,
Four morphological groups can be distinguished within
This type section is characterised by urediniospores having numerous scattered germ pores and an echinulate wall without smooth areas.
This section is characterised by urediniospores having few bipolarly distributed germ pores and a smooth or almost smooth wall.
This section is characterised by urediniospores having few scattered germ pores and an echinulate wall with smooth areas.
This section is characterised by urediniospores having few scattered germ pores and an echinulate wall without smooth areas. It is similar to section
The following key to European
1 | Us with terminal mucro |
|
– | Us without terminal mucro ( |
|
2 | Surface of Us smooth or almost smooth, germ pores often formed apically (sect. |
|
– | Surface of Us echinulate, sometimes with particularly smooth areas, germ pores scattered |
|
3 | Us mostly 30.0–40.0 × 17.5–20.0 µm, germ pores up to 4.5 µm diam. ( |
|
– | Us smaller, mostly 22.5–30.0 × 12.5–17.5 µm, germ pores smaller, up to 3.8 µm diam. (germ pores are often not visible, check numerous Us) ( |
|
4 | Surface of Us with smooth spine-free areas, germ pores ± 6 (Sect. |
|
– | Surface of Us without smooth spine-free areas, germ pores either ± 6 ( |
|
5 | Us mostly 27.5–35.0 µm long, wall mostly 2.0 µm thick ( |
|
– | Us mostly more than 30.0 µm long, wall mostly thinner (< 2 µm) |
|
6 | Us mostly 30.0–40.0 µm long ( |
|
– | Us shorter, mostly 30.0‒37.5 µm |
|
7 | Spine distance mostly 1.0‒4.0 µm ( |
|
– | Spine distance 2.0‒5.5 µm |
|
8 | Spine distance mostly 3.0‒5.5 µm, Us 30.0–35.0 × 17.5‒20.0 µm, germ pore 2.9 µm diam. ( |
|
– | Spine distance 2.0‒5.0 µm, Us 27.5–42.5 × 17.5–22.5 µm, germ pore < 2.5 diam. ( |
|
9 | Us mostly 20.0‒30.0 × 12.5‒19.0 µm, wall 0.5‒1.0 µm thick, spines mostly 1.0‒1.8 µm long, germ pores usually 6, mostly 1.3‒2.0 µm diam., pores hardly visible (check numerous Us) ( |
|
– | Us larger, mostly 27.0 ‒ 37.5 × 17.5 ‒ 22.5 µm, germ pores ± 11 |
|
10 | Spines ± 3.0 µm long, orientated in different directions, Us mostly 30.0‒37.5 × 17.5‒22.5 µm ( |
|
– | Spines shorter, < 3.0 µm long, typically perpendicular to the wall |
|
11 | Us mostly ≥ 17.5 µm wide, 27.5‒40.0 × 16.5–25.0 µm, spines erect ( |
|
– | Us ± 17.5 µm wide, sometimes spines arranged in rows, typically erect (the following two species are morphologically barely distinguishable) |
|
12 | Us mostly 27.5–37.5 µm long ( |
|
– | Very similar, Us somewhat longer on average, mostly 30.0–37.5 µm ( |
|
In previous studies of the genus
The number, position and size of germ pores have not been documented even in more recent studies of
In general, identification using only the host is unreliable, since the range of telial hosts in
We were able to classify four sections by phylogenetic analysis of ITS sequences (Fig.
The alternative barcode nad6 has been tested on different rust species (
The fungal barcode 28S rDNA is the second most widely used, following ITS (
One possible solution to lacking species resolution is to declare all specimens with the same ITS sequence data as one species, which was the original concept of ITS barcoding (
Not all specimens studied morphologically were used for sequencing (i.e. old specimens, type specimens, specimens with little spore material) and not all of those specimens, where DNA was extracted, were successfully sequenced. The rate of successful ITS sequencing (63%) is relatively low. In a previous study on
Even more surprising is the low success rate for the 28S sequencing. The 28S sequencing was performed only on samples with successful ITS sequencing. Template DNA should be present because both loci belong to the same multicopy rDNA region on the nuclear DNA. Despite this linkage, 28S is reported to have a PCR success rate of only 80% as compared to ITS in a large scale study on
The support values for section
By morphology of urediniospores,
Amongst the 11 sequences of specimens found on the aecial host
The answer to the question which of the two species
Both morphological features of the urediniospores and ITS sequences provide data to distinguish subgeneric groups (sections) in the genus
Curators of the herbaria B, FH, G, GLM, HBG,
multimedia
Fig. S1.
multimedia
Fig. S2.
multimedia
Fig. S2.