Corresponding authors: Zhi-Yuan Zhang (
Academic editor: Thorsten Lumbsch
The fungal taxa belonging to the
Zhang Z-Y, Feng Y, Tong S-Q, Ding C-Y, Tao G, Han Y-F (2023) Morphological and phylogenetic characterisation of two new soil-borne fungal taxa belonging to Clavicipitaceae (Hypocreales, Ascomycota). MycoKeys 98: 113–132.
Phylogenetic analyses showed that the
In this study, we report the morphological and phylogenetic characterisation of two new taxa belonging to the family
The soil samples were collected in June 2020 from the Cengong County (
The phenotype was determined by growing the single isolates in plates containing potato dextrose agar (
Total DNA was extracted using the 5% chelex-100 solution as described previously (
Sequences of primers used in this study.
|
|
|
|
|
NS1 | GTAGTCATATGCTTGTCTC |
|
NS4 | CTTCCGTCAATTCCTTTAAG |
|
|
|
ITS1 | TCCGTAGGTGAACCTGCG |
|
ITS4 | TCCTCCGCTTATTGATATGC |
|
|
|
LR0R | ACCCGCTGAACTTAAGC |
|
LR7 | TACTACCACCAAGATCT |
|
|
|
2218R | ATGACACCRACRGCRACRGTYTG |
|
983F | GCYCCYGGHCAYCGTGAYTTYAT |
|
|
|
fRPB2-5F | GAYGAYMGWGATCAYTTYGG |
|
CCCATRGCTTGYTTRCCCAT |
|
GenBank accession numbers of the sequences used in this study.
Species | Strains |
|
|
|
|
|
References |
---|---|---|---|---|---|---|---|
|
MAFF 246966 | – |
|
|
|
|
|
|
MAFF 241224 | – |
|
|
|
|
|
TNS-F-60465 | – |
|
|
|
|
|
|
|
BCC 7961 | – |
|
|
|
|
|
|
BCC 7869 |
|
|
|
|
|
|
|
B4728 | – | – | – |
|
|
|
|
A.E.G. 96-15a | – |
|
– |
|
|
|
|
A.E.G. 96-27a |
|
|
|
|
|
|
|
ATCC 26019 |
|
|
|
– |
|
Rehner et al. (1995); |
|
GAM 12885 | – |
|
|
|
|
|
SA cp 11 |
|
|
|
|
|||
|
FMR 11134 | – |
|
|
– | – |
|
FMR 11784 | – |
|
|
– | – |
|
|
|
NHJ 11343 |
|
|
– | – |
|
|
NHJ 12516 |
|
|
– |
|
|
||
|
NHJ 6293 |
|
|
|
|
|
|
|
WAC 8705 | – | – | – |
|
|
|
|
J.F.White | – | – | – |
|
|
|
|
CBS 236.64 | – |
|
– | – | – |
|
Eph.oryzae | – |
|
– | – | – |
|
|
|
CBS 857.72 | – |
|
|
– | – |
|
|
C.Schardl 760 | – | – |
|
– |
|
|
|
ATCC 56429 | – |
|
|
|
|
Rehner et al. (1995); |
|
BCC 34463 | – | – |
|
– |
|
|
BCC 34464 | – | – |
|
– |
|
|
|
|
Ba-01 | – |
|
– | – | – |
|
Bo-01 | – |
|
– | – | – |
|
|
|
E.sasae-H | – |
|
– | – | – |
|
E.sasae-N | – |
|
– | – | – |
|
|
|
CBS 239.32 |
|
|
|
|
|
|
CBS 126563 |
|
|
|
|
– |
|
|
|
CBS 182.27 |
|
|
|
|
|
|
CBS 127132 |
|
|
|
|
– |
|
|
|
JCM 18596 |
|
|
|
|
|
|
CBS 145.70 |
|
|
|
|
|
||
|
CGMCC 3.17365 |
|
|
|
|
|
|
CGMCC 3.17366 |
|
|
|
|
|
|
|
|
CBS 891.72 |
|
|
|
|
|
|
|
CBS 101433 | – |
|
|
|
|
|
|
CBS 464.88 |
|
|
|
|
|
|
JCM 18620 |
|
|
|
|
|
|
|
|
CBS 248.83 | – |
|
|
|
|
|
CBS 251.83 | – |
|
|
|
|
||
|
CEHS133a | – |
|
|
– | – |
|
INEHS133a | – |
|
|
– | – |
|
|
|
ARSEF 7487 | – |
|
– |
|
|
|
CBS 130.71 |
|
|
|
|
|
|
|
|
CBS 125.65 |
|
|
|
|
|
|
CBS 700.74 |
|
– |
|
|
|
|
|
CBS 218.56 | – |
|
|
|
|
||
|
CUP 067785 | – | – |
|
– |
|
|
CUP 067793 | – | – |
|
– |
|
|
|
|
CUP 067817 | – | – |
|
– |
|
|
|
BCC 64125 | – | – |
|
– |
|
|
BCC 79272 | – | – |
|
– |
|
|
|
|
CPC 27558 | – |
|
|
– | – |
|
|
A.E.G 96-32 |
|
– |
|
|
|
|
|
DY101711 | – |
|
|
|
|
|
DY101712 | – |
|
|
|
|
|
|
|
Marsons/n | – |
|
|
– | – |
|
|
CBS 560.74 |
|
|
|
– |
|
|
|
BCC 13019 |
|
– |
|
|
|
|
|
EFCC 6863 | – | – |
|
– |
|
|
|
NHJ 6209 |
|
|
|
|
|
|
NHJ 6240 |
|
– |
|
|
|
|
|
|
EFCC 1452 |
|
– |
|
– |
|
|
EFCC 1523 |
|
– |
|
|
|
|
|
|
GZUH SB13050311 |
|
|
– | – |
|
|
|
CGMCC 19143 |
|
|
|
|
|
|
|
CGMCC 19144 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Ne-01 | – |
|
– | – | – |
|
|
IasaF13 | – | – | – |
|
|
|
|
JCM 18597 |
|
|
|
|
|
|
|
CBS 101244 |
|
|
|
|
|
|
|
CBS 504.66 |
|
|
|
|
|
|
|
JCM 18598 |
|
|
|
|
|
|
JCM 18600 |
|
|
|
|
|
|
|
|
JCM 18605 |
|
|
|
|
|
|
JCM 18607 |
|
|
|
|
|
|
|
|
JCM 18609 |
|
|
|
|
|
|
JCM 18611 |
|
|
|
|
|
|
|
|
JCM 18613 |
|
|
|
|
|
|
JCM 18619 |
|
|
|
|
|
|
|
|
CBS 203.86 | – |
|
|
– | – |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
DY101741 | – |
|
|
|
|
|
DY101801 | – |
|
|
|
|
|
|
|
SD05361 | – |
|
|
– |
|
|
SD05362 | – |
|
|
– |
|
|
|
|
BCC 1376 |
|
– |
|
|
|
|
|
BCC 89300 | – |
|
|
– |
|
|
BCC 88441 | – |
|
|
|
|
|
|
|
BCC 85074 | – |
|
|
|
|
|
|
ARSEF 7682 | – | – |
|
– |
|
|
|
CBS 101437 |
|
|
|
|
|
|
|
CUP 067856 | – | – |
|
– |
|
|
|
BCC 40021 | – | – |
|
– |
|
|
|
CUP 067858 | – | – |
|
– |
|
|
|
EFCC 6279 |
|
|
|
|
|
|
EFCC 6564 |
|
|
|
|
|||
|
EFCC 2131 |
|
|
|
– |
|
|
EFCC 2135 |
|
– |
|
– |
|
|
|
|
TNS 19011 |
|
– |
|
|
|
|
|
MRLIB 9228 | – | – | – |
|
|
|
|
ATCC 16180 | – | – | – |
|
|
|
MAFF 240421 | – |
|
|
|
|
|
|
|
TNS-F18494 |
|
|
|
– |
|
|
|
MFLUCC 17-2113 |
|
|
|
|
|
|
|
MFLU 17-1582 |
|
|
|
|
|
|
Sequences highlighted in bold were generated in this study.
Lasergene software (version 6.0, DNASTAR) was used to analyse the ambiguous bases of the PCR amplicon sequences. The
In the present study, the combined loci were analysed using the Bayesian Inference (
The phylogenetic trees (Fig.
Phylogram based on the Maximum Likelihood (
Based on its close phylogenetic relationship to
China.
Saprobic in soil.
Currently, the family
After the country of origin.
Kaili City, Guizhou Province, China;
Guizhou Province, China.
Culture characteristics (14 days at 25 °C):
Morphology of
Kaili City, Guizhou Province, China;
The multi-locus phylogenetic analyses showed that
After the country of origin.
Kaili City, Guizhou Province, China;
Guizhou Province, China.
Culture characteristics (14 days at 25 °C):
Morphology of
The multi-locus phylogenetic analyses (Fig.
In this study, we proposed a new
Soil is the largest natural reservoir of microorganisms and is inhabited by a large number of fungi. Taxonomy of soil fungi is an emerging area of research. Currently, only about 800,000 species of soil fungi have been identified worldwide (
1 | Host is a plant |
|
– | Host insects, nematodes, rotifers, protozoans or soil |
|
2 | Asexual morph produced |
|
– | Sexual morph produced |
|
3 | Conidia with adhesive hapteron |
|
– | Conidia without adhesive hapteron |
|
4 | Stromata stalked |
|
– | Stromata lacking stalks |
|
5 | Conidia cymbiform to reniform |
|
– | Conidia fusiform or ellipsoidal |
|
6 | Host bamboo |
|
– | Host grasses |
|
7 | Conidiophores mononematous |
|
– | Conidiophores synnematous or mononematous |
|
We greatly appreciate Dr. Bensch for her advice on the new species names. We appreciate Charlesworth for the English language editing to the whole manuscript.
No conflict of interest was declared.
No ethical statement was reported.
This work was financially supported by grants from the Guizhou Provincial Science and Technology Projects (ZK[2023]155), the Science Research Youth Program in Colleges and Universities (Qiankeji[2022]153), and the National Natural Science Foundation of China (no. 32060011, 31860520).
The individual contributions are as follows: Zhi-Yuan Zhang, Yao Feng, Shuo-Qiu Tong, and Chen-Yu Ding. conceptualized the study, performed microscopical examinations of fungal specimens, wrote, edited, and reviewed the manuscript. Zhi-Yuan Zhang and Yao Feng conducted phylogenetic studies. Gang Tao and Yan-Feng Han wrote, reviewed, and edited the manuscript. Shuo-Qiu Tong and Chen-Yu Ding prepared figures. Zhi-Yuan Zhang reviewed the manuscript and provided funding. All authors have read and agreed to the published version of the manuscript.
Zhi-Yuan Zhang
Yao Feng
Shuo-Qiu Tong
Chen-Yu Ding
Gang Tao
Yan-Feng Han
All of the data that support the findings of this study are available in the main text or Supplementary Information.
Sequence dataset
sequence
The best-fit evolutionary model in the phylogenetic analyses
table