Data Paper |
Corresponding author: Hanna Lindgren ( hlindgren@fieldmuseum.org ) Academic editor: Pradeep Divakar
© 2016 Hanna Lindgren, Steven D. Leavitt, Thorsten Lumbsch.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Lindgren H, Leavitt SD, Lumbsch HT (2016) Characterization of microsatellite markers in the cosmopolitan lichen-forming fungus Rhizoplaca melanophthalma (Lecanoraceae). MycoKeys 14: 31-36. https://doi.org/10.3897/mycokeys.14.9729
|
Rhizoplaca melanophthalma s.l. is a group of morphologically distinct and chemically diverse species that commonly occur in desert, steppe and montane habitats worldwide. In this study, we developed microsatellite markers to facilitate studies of genetic diversity, population structure, and gene flow in the nominal taxon of this group, Rhizoplaca melanophthalma. We characterized 10 microsatellite markers using a draft genome of R. melanophthalma s. str. assembled from Illumina reads. These loci were tested for 21 R. melanophthalma s. str. specimens and also with a subset of 18 specimens representing six additional species in the R. melanophthalma complex. The number of alleles per locus in R. melanophthalma s. str. ranged from 3 to 11 with an average of 6.7. Nei’s unbiased gene diversity ranged from 0.35 to 0.91. Amplifications of the microsatellite loci were largely successful in the other six species, although only three markers were found to be polymorphic. The new markers will provide an additional resource for studying genetic, population- and landscape-level processes in the cosmopolitan taxon Rhizoplaca melanophthalma s. str.
Ascomycetes , gene flow, landscape genetics, lichen-forming fungi, microsatellites, Rhizoplaca melanophthalma
Rhizoplaca melanophthalma (DC.) Leuckert & Poelt s.l. represents a group of morphologically distinct and chemically diverse species of lichen-forming fungi with broad ecological and geographical distributions. Species in this group occur all over the world in disjunct populations in continental climates, although species in this complex are notably absent from Australia. Rhizoplaca melanophthalma s.l. commonly grows on siliceous or calcareous rock in arid climates, but can also be found in montane coniferous forests, alpine tundra habitats, and bi-polar populations in the Arctic and Antarctica (
Previous multi-locus and phylogenomic studies support the circumscription of multiple species within R. melanophthalma s.l. (
The Rhizoplaca melanophthalma group provides an interesting system for assessing genetic diversity, population structure and gene flow in symbiotic fungal species with broad ecological and geographic distributions. To facilitate additional research into population- and landscape-level processes, 10 microsatellite markers were developed for R. melanophthalma s.str.
A total of 42 specimens representing seven different species in the Rhizoplaca melanophthalma species complex were included in this study. Twenty-one of these represented R. melanophthalma s. str., three R. haydenii, four R. novomexicana, two R. parilis, four R. polymorpha, six R. porteri and two R. shushanii (Table
Voucher information for Rhizoplaca specimens used in this study. Herbaria codes are provided for each specimen in parentheses following voucher number.
Species | DNA No. | Voucher | Locality |
---|---|---|---|
R. melanophthalma | 8639c | Leavitt 2013-CO-CP-8639C (F) | USA, CO |
R. melanophthalma | 8639d | Leavitt 2013-CO-CP-8639D (F) | USA, CO |
R. melanophthalma | 8654a | Leavitt 2013-CO-RM-8654A (F) | USA, CO |
R. melanophthalma | 8654b | Leavitt 2013-CO-RM-8654B (F) | USA, CO |
R. melanophthalma | 8663B | Leavitt 8663 (F) | USA, UT |
R. melanophthalma | 8663j | Leavitt-8663 (F) | USA, UT |
R. melanophthalma | 8665b | Leavitt-8665 (F) | USA, NV |
R. melanophthalma | 8665e | Leavitt-8665 (F) | USA, NV |
R. melanophthalma | 8665i | Leavitt-8665 (F) | USA, NV |
R. melanophthalma | 8665M | Leavitt-8665 (F) | USA, NV |
R. melanophthalma | 8668b | Leavitt-8668 (F) | USA, NV |
R. melanophthalma | 8668f | Leavitt-8668 (F) | USA, NV |
R. melanophthalma | 8668q | Leavitt-8668 (F) | USA, NV |
R. melanophthalma | 8668s | Leavitt-8668 (F) | USA, NV |
R. melanophthalma | 8668w | Leavitt-8668 (F) | USA, NV |
R. melanophthalma | 6026 | H9203303 (F) | Kyrgyzstan, Ala-Buka |
R. melanophthalma | 6029 | H9203135 (F) | Kyrgyzstan, Panfilov District |
R. melanophthalma | 6030 | H9203327 (F) | Kyrgyzstan, Chatkal |
R. melanophthalma | 6435 | Vondrak 9409 (PRA) | Russia, Chelyabinsk |
R. melanophthalma | 6604 | MAF-Lich 16805 (MAF) | Spain, Teruel |
R. melanophthalma | 6605 | MAF-Lich 16778 (MAF) | Spain, Teruel |
R. haydenii | 8683 | Leavitt 8683 (F) | USA, ID |
R. haydenii | 8935p | Leavitt 8935 (F) | USA, ID |
R. haydenii | 8935s | Leavitt 8935 (F) | USA, ID |
R. novomexicana | 8684a | Leavitt 8684A (F) | USA, NM |
R. novomexicana | 8684b | Leavitt 8684B (F) | USA, NM |
R. novomexicana | 8684c | Leavitt 8684C (F) | USA, NM |
R. novomexicana | 8684d | Leavitt 8684D (F) | USA, NM |
R. parilis | 8665N | Leavitt-8665 (F) | USA, NV |
R. parilis | 8665u | Leavitt-8665 (F) | USA, NV |
R. polymorpha | 8668g | Leavitt-8668 (F) | USA, NV |
R. polymorpha | 8668l | Leavitt-8668 (F) | USA, NV |
R. polymorpha | 8668p | Leavitt-8668 (F) | USA, NV |
R. polymorpha | 8668r | Leavitt-8668 (F) | USA, NV |
R. aff. porteri | 8665x | Leavitt-8665 (F) | USA, NV |
R. aff. porteri | 8668j | Leavitt-8668 (F) | USA, NV |
R. aff. porteri | 8668m | Leavitt-8668 (F) | USA, NV |
R. porteri | 8665t | Leavitt-8665 (F) | USA, NV |
R. porteri | 8668e | Leavitt-8668 (F) | USA, NV |
R. porteri | 8668h | Leavitt-8668 (F) | USA, NV |
R. shushanii | 8664A | Leavitt 13-TLM-001 (BRY-C) | USA, UT |
R. shushanii | 8664B | Leavitt 13-TLM-001 (BRY-C) | USA, UT |
A draft genome of an axenic culture of R. melanophthalma was obtained from a previous study (
Singleplex PCR reactions were performed in 10 µl reaction volumes consisting of 5.89 µl H2O, 1 µl 10x buffer (Roche Diagnostics, Indianapolis, USA), 0.6 µl 8 mM dNTP, 1 µl BSA, 0.15 µl Taq (Roche Diagnostics, Indianapolis, USA), 0.16 µl 6-FAM labeled M13 primer, 0.04 µl 10 µM M13 tailed forward primer, 0.16 µl 10 µM reverse primer, and 1 µl of genomic DNA. DNA amplification was performed using a touchdown PCR with initial denaturation at 95 °C for 5 min; followed by first 11 cycles of 30 s at 95 °C, 30 s at 60–50 °C, 1 min. at 72 °C, and then 35 cycles of 30 s at 95 °C, 30 s at 50 °C, 1.5 min. at 72 °C, and a final extension of 10 min. at 72 °C.
Fragment analysis was performed on an ABI 3730 DNA Analyzer (Applied Biosystems, Foster City, California, USA) using GeneScan-500 LIZ (Life Technologies, Warrington, UK) as an internal size standard. Genotyping was performed utilizing the microsatellite plugin in Geneious 9.1.2 (Biomatters Limited). Polymorphism within the microsatellites was tested in GenAlEx 6.5 (Peakall and Smouse 2012) by calculating Nei’s unbiased genetic diversity.
Of the 25 microsatellites assessed, 18 amplified successfully and 10 were polymorphic in all 21 R. melanophthalma s. str. specimens (Table
Locus | Primer sequences (5’–3’) | Repeat motif | Allele size range (bp) | GenBank accession no. |
---|---|---|---|---|
Rmel1 | F: *GGCTGGGTGTTGTAGTGTTG R: ATACCTGGCGCTCAAGAATG |
(GTT)18 | 179–203 | KX755412 |
Rmel2 | F: *TGGTGGATCTGAGAGCGTAC R: ACTTCAACCTTCACAACGCC |
(CAGGCT)10 | 328–382 | KX755413 |
Rmel3 | F: *CAAAGGTCAGGAGAGGAGGG R: TGGACGCGTGGCAATTTATC |
(AC)10 | 380–412 | KX755414 |
Rmel4 | F: *ATCGAGACTTACTTCCCGCC R: AATCGTATCTCCAGACCCGC |
(GT)11 | 353–385 | KX755415 |
Rmel5 | F: *TTAGCCCGAGACCACATACG R: TGGAGAGATGAAGCTGGCTC |
(CT)12 | 311–321 | KX755416 |
Rmel6 | F: *ACACCAGATCTCACTCAGGC R: CCGGGAGTAGGTGTAGATGC |
(AC)10 | 184–192 | KX755417 |
Rmel7 | F: *TCCGGAACTGGCTTGATAGG R: CTGAAGTCGATGTTGGGAGC |
(CCTT)11 | 314–362 | KX755418 |
Rmel8 | F: *TTTGCCCGACGTGCAATATC R: CTGCAGCACTCTAACCATGC |
(AG)11 | 420–438 | KX755419 |
Rmel9 | F: *ATCTCCTGCATCTTCTCCGC R: AACGTCACATTCGCAGTCAC |
(AC)10 | 309–331 | KX755420 |
Rmel10 | F: *TCATCACACCAGACACAGGG R: ACCTTAGGCCCAGACACATG |
(AG)10 | 464–468 | KX755421 |
Sample size, number of alleles (A) and Nei’s unbiased genetic diversity (He) of ten microsatellite loci developed for Rhizoplaca melanophthalma s. str.
Total | |||
---|---|---|---|
Locus | n | A | H e |
Rmel1 | 21 | 8 | 0.886 |
Rmel2 | 20 | 6 | 0.858 |
Rmel3 | 21 | 9 | 0.866 |
Rmel4 | 21 | 11 | 0.919 |
Rmel5 | 20 | 5 | 0.679 |
Rmel6 | 21 | 3 | 0.643 |
Rmel7 | 20 | 6 | 0.763 |
Rmel8 | 20 | 7 | 0.779 |
Rmel9 | 21 | 9 | 0.881 |
Rmel10 | 20 | 3 | 0.353 |
Average | 6.7 | 0.765 |
The 10 polymorphic microsatellite markers for the lichen-forming fungus R. melanophthalma will help elucidate population processes that have led to the observed distribution patterns in this widespread species.
The authors would like to thank the Negaunee Foundation for providing funding for this study, and Kevin Feldheim (Pritzker Laboratory for Molecular Systematics) for assistance in the lab.